ID: 919377064

View in Genome Browser
Species Human (GRCh38)
Location 1:196808353-196808375
Sequence GATTGTTATTTCCAGTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919377062_919377064 -2 Left 919377062 1:196808332-196808354 CCAAGAAAGAAGCCTTAGCAAGA No data
Right 919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG No data
919377060_919377064 18 Left 919377060 1:196808312-196808334 CCCATGTGAATGAAAATAAACCA No data
Right 919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG No data
919377061_919377064 17 Left 919377061 1:196808313-196808335 CCATGTGAATGAAAATAAACCAA No data
Right 919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG No data
919377059_919377064 23 Left 919377059 1:196808307-196808329 CCTATCCCATGTGAATGAAAATA No data
Right 919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919377064 Original CRISPR GATTGTTATTTCCAGTGAAT AGG Intergenic
No off target data available for this crispr