ID: 919381785

View in Genome Browser
Species Human (GRCh38)
Location 1:196869442-196869464
Sequence CCTTGGGCACTCCCTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919381785_919381791 1 Left 919381785 1:196869442-196869464 CCTCTGCAAGGGAGTGCCCAAGG 0: 1
1: 1
2: 0
3: 15
4: 167
Right 919381791 1:196869466-196869488 AAGCGGCCTCAGTAAGGTCCAGG 0: 1
1: 0
2: 0
3: 6
4: 71
919381785_919381790 -5 Left 919381785 1:196869442-196869464 CCTCTGCAAGGGAGTGCCCAAGG 0: 1
1: 1
2: 0
3: 15
4: 167
Right 919381790 1:196869460-196869482 CAAGGAAAGCGGCCTCAGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919381785 Original CRISPR CCTTGGGCACTCCCTTGCAG AGG (reversed) Intronic
900519460 1:3098591-3098613 CCTGGGGCACTTCCTTTCTGTGG - Intronic
900542087 1:3208076-3208098 GCTTGGGCTTTCCCATGCAGAGG - Intronic
901205196 1:7490678-7490700 CACTGGCCACTCCCTGGCAGAGG - Intronic
901527892 1:9835636-9835658 CCTTGGGGGGTCCCTGGCAGCGG - Intergenic
901828021 1:11875171-11875193 CCTGGGGCAGCCCCATGCAGCGG + Intergenic
905360509 1:37416268-37416290 CCTTGGGCTTTCCTGTGCAGAGG + Intergenic
905371802 1:37486389-37486411 CCTTGGGCTCTCACCAGCAGGGG + Intergenic
910768566 1:90807820-90807842 CCATGGGCACTGCATTGCAGTGG + Intergenic
913501250 1:119474670-119474692 TCTTGCCCAGTCCCTTGCAGGGG + Intergenic
915668867 1:157470395-157470417 CCTTCTCCACTCCCTGGCAGAGG + Intergenic
916744261 1:167672108-167672130 TCTTGTGACCTCCCTTGCAGAGG + Intronic
917294741 1:173506656-173506678 CCTTGGGCACACCCTTGTGTAGG + Intronic
917777404 1:178352454-178352476 CCTTGGGCAATCCATTCCTGTGG + Intronic
919369130 1:196702821-196702843 GCTTGGGCACTCCCTTGCAGAGG - Intronic
919381785 1:196869442-196869464 CCTTGGGCACTCCCTTGCAGAGG - Intronic
921419001 1:214924274-214924296 CCTCGGGCACTCCCTTGTGTGGG + Intergenic
922730281 1:227945826-227945848 CCTTGGGAACTGACTTACAGGGG + Intronic
923040447 1:230316497-230316519 CCTTGAGCGCTCCCTCCCAGTGG - Intergenic
924098562 1:240579913-240579935 CCTTGGGCATCCCCTTGCATGGG + Intronic
1069519283 10:69105605-69105627 CCTAGTGCACTCCCTTCCACTGG - Intergenic
1070765547 10:79054090-79054112 CCTTGGGGGCTCCTGTGCAGGGG + Intergenic
1070897020 10:79993468-79993490 TCTTGGACAGTACCTTGCAGAGG + Intergenic
1074455517 10:113592434-113592456 CCTTGGCGACTCCCTAGCACTGG + Intronic
1077218318 11:1404343-1404365 CCGTGGCCACTCCCCTGAAGAGG - Intronic
1077496589 11:2889683-2889705 CCTTGGTCACTCCCTGATAGGGG - Intronic
1078563847 11:12396642-12396664 GCTTGGGCAATGCCTGGCAGGGG - Intronic
1079094946 11:17504146-17504168 CCTAGGGCACTCCTGTGCACAGG - Intronic
1079104464 11:17561434-17561456 CCTGGGGATCTCCCTTGGAGGGG - Intronic
1080520755 11:33066087-33066109 CCCTGGGCTCTGCCTTACAGTGG - Intronic
1080615293 11:33940438-33940460 CCTTGGACCCTGCCTTGCAGAGG - Intergenic
1080682865 11:34492248-34492270 CCTTGGGCACTACATGGCTGGGG - Intronic
1081285786 11:41268323-41268345 CCTTGATCACAGCCTTGCAGAGG + Intronic
1081868482 11:46372484-46372506 CCTTGGGCCCTCCCTGGCTCAGG - Exonic
1082819974 11:57538182-57538204 CCAGGGGCCCTCCCTTGGAGAGG - Intergenic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085049300 11:73371935-73371957 CCTGGAGAACTCCCTTGAAGAGG - Intergenic
1089770061 11:120796455-120796477 CCTTGCACACTGCCTTGGAGGGG - Intronic
1090848038 11:130546710-130546732 CCTTCCCCACTCCCTTGCAGGGG - Intergenic
1092062703 12:5564228-5564250 GCTTTGGCACACACTTGCAGTGG + Intronic
1093598699 12:20994857-20994879 CCTTGGGCATTCTCTTCCAAAGG - Intergenic
1094099101 12:26742040-26742062 GTGTGGGCACTCCCTTGCAGAGG - Intronic
1096522197 12:52190847-52190869 CCTTGGGAGCTCCCTTGCCCTGG + Intronic
1100588336 12:96000006-96000028 CCTGGGGCACTACGTTGCATTGG + Intergenic
1103989047 12:124786113-124786135 CCTGGGACCCTCCCTTGGAGGGG - Intronic
1107787268 13:43969407-43969429 CCTTGGGCCCTCCCTGGCTCAGG - Intergenic
1110406861 13:75160588-75160610 CCTCTGACACTCCCATGCAGAGG + Intergenic
1110764629 13:79268659-79268681 CCTTAAGCAGTCCCTTGGAGTGG - Intergenic
1111029780 13:82580442-82580464 CCTTGGCCCCTCCAGTGCAGTGG - Intergenic
1114537791 14:23433794-23433816 CCCTGGGCTCTCCCCTTCAGTGG + Intronic
1117955851 14:61123254-61123276 CCCGTGGCACTCCCTGGCAGTGG - Intergenic
1119326444 14:73762313-73762335 CCTGGGCCACTCCTTTGGAGTGG - Intronic
1122299293 14:100722939-100722961 CCTTGGTCAGTCCCTTGGGGAGG + Intergenic
1123553298 15:21401806-21401828 CTCTAGGCACACCCTTGCAGAGG + Intergenic
1123589544 15:21839194-21839216 CTCTAGGCACACCCTTGCAGAGG + Intergenic
1124239307 15:28016960-28016982 TCTGGGGCCCTTCCTTGCAGGGG - Intronic
1125978478 15:43977632-43977654 CATTGGGCACTCCCTTTAATTGG - Intronic
1126344244 15:47675977-47675999 CCTTGGGCTGCCCCTGGCAGTGG + Intronic
1127200317 15:56639836-56639858 CCTTTGCCACTCCCTTGTATTGG - Intronic
1128698953 15:69789955-69789977 GCTGGGCCACTCCCTGGCAGTGG - Intergenic
1128983639 15:72203505-72203527 CCCAGGCCACTCCCTGGCAGAGG + Intronic
1129904116 15:79173827-79173849 GCTGGGGCACACCTTTGCAGTGG + Intergenic
1202961647 15_KI270727v1_random:129026-129048 CTCTAGGCACACCCTTGCAGAGG + Intergenic
1133219154 16:4311489-4311511 CCCTGGGCAGGACCTTGCAGGGG + Intergenic
1133387294 16:5379992-5380014 GCCTGGGCACAGCCTTGCAGTGG + Intergenic
1133387405 16:5381023-5381045 GCTTTGGAACTCCCTTGGAGAGG + Intergenic
1136477407 16:30522051-30522073 CCTTGCACACTCCCCTGCACTGG + Exonic
1137583920 16:49652467-49652489 CCCTGGGGAGTCCCTTGTAGGGG - Intronic
1138552092 16:57753708-57753730 GCCTGGGCACTCCCCAGCAGCGG + Intronic
1142173272 16:88633886-88633908 CCTGGGGCACCCCCTGGGAGGGG - Intergenic
1144435167 17:15233531-15233553 CCTTGGGTGCTTCCTTCCAGAGG - Intronic
1144845984 17:18219328-18219350 ACTTGGTCACTCCTCTGCAGAGG - Intergenic
1145298428 17:21613005-21613027 CCTAGGTCACTACCTTGCTGTGG + Intergenic
1145722885 17:27089658-27089680 CCTGGGACACTACCTTGCTGTGG + Intergenic
1147476371 17:40715468-40715490 CCATGGGCACTCTCCTGAAGGGG + Intergenic
1147631773 17:41936809-41936831 ACTTGGGCTCTCCCTTGGTGGGG - Exonic
1150830129 17:68511893-68511915 CCCGGGGCCCTCCCTTGCAGGGG + Intronic
1151250547 17:72830699-72830721 CCTTGGGCTCTACCTTGCGAGGG - Intronic
1152271331 17:79326640-79326662 CCCTGGGCACTCCCTGCCAGAGG + Intronic
1152505212 17:80745025-80745047 CTTTGGGCAGTCTCTAGCAGAGG - Intronic
1154453985 18:14503923-14503945 CTCTAGGCACACCCTTGCAGAGG + Intergenic
1160033325 18:75280964-75280986 GACTGGGCACTCCCCTGCAGGGG + Intronic
1160234776 18:77077419-77077441 CCTTGGACACTAGTTTGCAGGGG - Intronic
1161455205 19:4366465-4366487 CCTGGGGCAGGCCCTGGCAGTGG + Intronic
1165072020 19:33261219-33261241 CCAGGGGCACTCCCAAGCAGGGG - Intergenic
1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG + Intergenic
1166130872 19:40744817-40744839 CCCTGGGCTCTCCCCTGAAGGGG - Intronic
1166792027 19:45404311-45404333 CCTAGGGCACCCCCTGGCGGAGG - Intronic
1168655316 19:58123295-58123317 CCTTGGGCACTCCACTCCTGTGG + Intergenic
925012487 2:496253-496275 CCGTGGGCAGCACCTTGCAGGGG + Intergenic
926171957 2:10558176-10558198 CCTTGGGCCCACCCTGGCTGAGG + Intergenic
926687530 2:15709717-15709739 CCTTGCCCACTCCCTCCCAGAGG - Intronic
926702623 2:15813829-15813851 CCAGGAGGACTCCCTTGCAGAGG + Intergenic
928108669 2:28489306-28489328 ACTTGGCCACTCCCTGGCTGTGG + Intronic
931235010 2:60405884-60405906 CCCTGGCCATTCCCCTGCAGAGG + Intergenic
932117953 2:69070182-69070204 CCTTTGGCACACCCGTGCGGTGG + Intronic
933938413 2:87225610-87225632 CATGGGGCACCCACTTGCAGAGG + Intergenic
934494751 2:94787665-94787687 CTCTTGGCACACCCTTGCAGAGG + Intergenic
938067793 2:128291477-128291499 CCTGGGGCCCTCCCTGCCAGAGG - Intronic
938357622 2:130665013-130665035 CTCTTGGCACACCCTTGCAGAGG - Intergenic
938358153 2:130668174-130668196 CTCTTGGCACACCCTTGCAGAGG - Intergenic
938540971 2:132283148-132283170 CCTCGGGCACAGCCTAGCAGCGG + Intergenic
938541795 2:132289053-132289075 CCTTGGGCGCAGCCTGGCAGCGG + Intergenic
943571282 2:189578238-189578260 TCTTTTGCACTCCTTTGCAGCGG + Intronic
944957238 2:204825997-204826019 CTTTGGAGACTCCCGTGCAGTGG - Intronic
946806845 2:223479540-223479562 CCTTGGGTACTGCCTTGTGGAGG + Intergenic
947791777 2:232872870-232872892 CCTCGGCCCCTCCCTGGCAGCGG + Intronic
948600770 2:239106396-239106418 CCTTGGGCAGTCCCCAGAAGGGG + Intronic
1169231273 20:3889999-3890021 CCTTGGGCATTCTCTTCCTGAGG + Intronic
1170596109 20:17806990-17807012 CCTCGGGCTCTCCCCAGCAGAGG - Intergenic
1171870670 20:30521934-30521956 CCTTGGGCGCAGCCTGGCAGCGG + Intergenic
1173811291 20:45957460-45957482 CCTTGGGAGCTCCCAGGCAGTGG - Intronic
1174158229 20:48531164-48531186 CCTTGGGCACAACTTGGCAGGGG - Intergenic
1174199578 20:48797940-48797962 CTTTGGGCACCCCCTTGAATGGG - Intronic
1176217203 20:63953879-63953901 GCTCGGGCACTCCCTTGCTGTGG + Intronic
1176820186 21:13649373-13649395 CTCTAGGCACACCCTTGCAGAGG - Intergenic
1178467254 21:32859421-32859443 CCTTGAGCCCTCCCCTGCAGTGG + Intergenic
1182329456 22:29540492-29540514 GCTTGGCCACTCCCTAGCTGTGG - Intronic
1183236872 22:36625147-36625169 CTTTGTGCAATCCCTGGCAGGGG + Intronic
1184419843 22:44373404-44373426 CCTTGGCCTCTGCCCTGCAGGGG + Intergenic
1185166971 22:49267222-49267244 GCTGGGGCACTCCCTAGAAGGGG + Intergenic
950294851 3:11820521-11820543 CCTTGTGCACTGCCTGGCACAGG + Intronic
953478240 3:43224798-43224820 GTTTGGGGACTCCCCTGCAGGGG + Intergenic
953781856 3:45878271-45878293 CCTCTGGGTCTCCCTTGCAGGGG + Intronic
954274077 3:49531347-49531369 CATTGCGCCCTCCCTGGCAGGGG - Exonic
955149452 3:56352679-56352701 CCTTGATTACACCCTTGCAGAGG - Intronic
956621558 3:71226286-71226308 TCTTGGGCTCTTTCTTGCAGGGG + Intronic
961035868 3:123641219-123641241 CCCGGGGCAGTCCCTAGCAGAGG - Intronic
962896360 3:139718493-139718515 CCTTGGGGACTCCAATGAAGAGG + Intergenic
968750985 4:2388947-2388969 CCTTGGCCACTCCCTCTCTGTGG - Intronic
968891633 4:3372398-3372420 ACCTGGGCACTCACTTGCAGTGG - Intronic
973369487 4:49234346-49234368 CTCTTGGCACACCCTTGCAGAGG - Intergenic
973466827 4:50741713-50741735 CTTTGGGCACTACCTGGAAGTGG + Intergenic
973821032 4:54661518-54661540 CCTTGACCACTACCTTGAAGGGG - Intronic
973821372 4:54664529-54664551 ACTTGGACACTCCCTTGCTGTGG + Intronic
975649940 4:76582954-76582976 TCTTTGGCAATCACTTGCAGAGG - Intronic
978561571 4:110039383-110039405 TCTTGGGCAGTTCTTTGCAGCGG - Intergenic
978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG + Intergenic
979116368 4:116829537-116829559 GCTTGGGCACTCCAATGCATGGG - Intergenic
979358512 4:119733591-119733613 ACTTGGTCACTCCCTCACAGAGG + Intergenic
979439367 4:120733357-120733379 CCTTGGGCTCTCTCCTACAGTGG + Intronic
980335583 4:131469132-131469154 ACTGGGGCACTGCCTAGCAGAGG + Intergenic
981888785 4:149712247-149712269 CCTTGGGCACTGACTTGCTCAGG + Intergenic
984252086 4:177347328-177347350 CCTTGGTCCCTCCCAAGCAGAGG - Intronic
991930503 5:71749130-71749152 CCTTAGTCACTCCATTCCAGGGG - Intergenic
991940217 5:71843802-71843824 ACTTGGGCATTCCTTTGGAGAGG + Intergenic
993260749 5:85655397-85655419 CCTTCTGCATTCCCTAGCAGAGG - Intergenic
999282476 5:150374660-150374682 CCTGGGGGACTCCTTGGCAGGGG - Exonic
999282567 5:150374997-150375019 CCTGGGGGACTCCTTGGCAGGGG - Exonic
1001246610 5:170109603-170109625 CCTTGGGCCCACCCTCACAGGGG + Intronic
1001954822 5:175842021-175842043 CCATAGGCCCTCCCTTCCAGGGG + Intronic
1002461064 5:179374093-179374115 CCTCGGCCCCTCTCTTGCAGTGG - Intergenic
1008921821 6:56850533-56850555 CCTTGGGGACTTTCTTGCAAAGG - Intronic
1017710452 6:157162960-157162982 CCTTGGGCTCTGGCTTCCAGGGG - Intronic
1017954188 6:159164715-159164737 GCCTTGGCACTGCCTTGCAGTGG + Intergenic
1019021104 6:168918432-168918454 CCATGGGCCCTGCCTTGCTGTGG + Intergenic
1022101120 7:27169696-27169718 CCTGGGGCACTCTGTTGCACTGG - Intronic
1026717868 7:72805700-72805722 CCTTGGTCTCTCCCTTACATAGG - Intronic
1029598696 7:101551168-101551190 CCTGGGCCACTCCCAGGCAGAGG + Intronic
1031149195 7:118033227-118033249 CCTTAGCCACTTCCTTTCAGAGG + Intergenic
1032441732 7:131947486-131947508 CCTTAGGGACTACCTTCCAGGGG - Intergenic
1032700317 7:134373325-134373347 TCTTGGGGGCTCCCTTGCAGGGG + Intergenic
1034062865 7:148109095-148109117 CCTTGGCCAAGCCCTTGCACAGG + Intronic
1041927573 8:63252340-63252362 CCTTCTGCACTGCCTAGCAGAGG - Intergenic
1042567170 8:70123870-70123892 CCTTGGGCACTCACCTGCTCGGG + Exonic
1043660621 8:82736250-82736272 CCTTTTGCACTGCCTAGCAGAGG - Intergenic
1049360066 8:142208240-142208262 TCTTGGGCAGTCCCTAGAAGGGG - Intergenic
1049453700 8:142676384-142676406 CCTTGGGAACCCCCATCCAGCGG - Intronic
1049660970 8:143819591-143819613 CCTTGGGAAGTCCCTTGATGTGG - Intronic
1053418751 9:37963553-37963575 CCTTGCACAGTCCCTGGCAGGGG + Intronic
1057809676 9:98248235-98248257 CCTTGCACACTCCTTTGCATTGG - Intronic
1060536030 9:124388861-124388883 CCTTGGTCACTCCCCTCCACAGG + Intronic
1061957899 9:133973116-133973138 CCTTGGGCCCTCCGTGGCACTGG - Intronic
1062365320 9:136205451-136205473 GCCTGGGCACTGCCTTCCAGAGG - Intergenic
1062582862 9:137236125-137236147 CTTCGGGCTCTCCCTGGCAGGGG + Exonic
1203527174 Un_GL000213v1:100178-100200 CTCTAGGCACACCCTTGCAGAGG + Intergenic
1203361552 Un_KI270442v1:221661-221683 CCGTAGTCACTCGCTTGCAGGGG - Intergenic
1188898838 X:35703241-35703263 CCCAGGGCACTTCCTTGAAGTGG - Intergenic
1189482773 X:41405925-41405947 GCTTGGGCACATACTTGCAGGGG - Intergenic
1189516211 X:41715680-41715702 CCCTGGGTGCTCCCTTGAAGTGG + Intronic
1192639008 X:72845863-72845885 CCTTGGGAGCTCCCCTGCAGGGG - Exonic
1192642704 X:72874945-72874967 CCTTGGGAGCTCCCCTGCAGGGG + Exonic
1197176450 X:123491181-123491203 CCTTTGGGACTCCTTTCCAGAGG + Intergenic
1200792570 Y:7312719-7312741 CCTTGGGCTCCCCCCAGCAGGGG + Intergenic
1201933835 Y:19384938-19384960 CCTTCAGGACTGCCTTGCAGGGG - Intergenic