ID: 919381908

View in Genome Browser
Species Human (GRCh38)
Location 1:196870486-196870508
Sequence GAGTATCTCTTCAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 153}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919381908_919381913 -6 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381913 1:196870503-196870525 ATACTCCAAAATGTTAGTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 138
919381908_919381912 -7 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381912 1:196870502-196870524 GATACTCCAAAATGTTAGTCCGG 0: 1
1: 1
2: 1
3: 8
4: 129
919381908_919381916 2 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381916 1:196870511-196870533 AAATGTTAGTCCGGGAGCATGGG 0: 1
1: 0
2: 0
3: 17
4: 177
919381908_919381920 17 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381920 1:196870526-196870548 AGCATGGGAAATGGAAGGCCAGG 0: 1
1: 0
2: 4
3: 42
4: 330
919381908_919381919 12 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381919 1:196870521-196870543 CCGGGAGCATGGGAAATGGAAGG 0: 1
1: 0
2: 0
3: 37
4: 228
919381908_919381915 1 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381915 1:196870510-196870532 AAAATGTTAGTCCGGGAGCATGG 0: 1
1: 0
2: 0
3: 6
4: 85
919381908_919381921 18 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381921 1:196870527-196870549 GCATGGGAAATGGAAGGCCAGGG 0: 1
1: 0
2: 3
3: 31
4: 368
919381908_919381917 8 Left 919381908 1:196870486-196870508 CCCTCATCCCTGAAGAGATACTC 0: 1
1: 0
2: 2
3: 14
4: 153
Right 919381917 1:196870517-196870539 TAGTCCGGGAGCATGGGAAATGG 0: 1
1: 0
2: 1
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919381908 Original CRISPR GAGTATCTCTTCAGGGATGA GGG (reversed) Intronic
902874992 1:19335719-19335741 GAGGGTCTCTCCAGGGCTGAGGG - Intergenic
904200945 1:28818716-28818738 GTGTATCTCCTCAGGAATCATGG - Intronic
907898115 1:58712027-58712049 AATTATCTCTTAATGGATGAAGG + Intergenic
908087329 1:60650079-60650101 GAGTAGGTCTTCAGAGCTGAGGG - Intergenic
911906385 1:103573607-103573629 GAATATCTCTTGAGGAATCATGG + Intronic
911909853 1:103619453-103619475 GAATATCTCTTGAGGAATCATGG + Intronic
911912953 1:103658339-103658361 GAATATCTCTTGAGGAATCATGG + Intronic
911915502 1:103693609-103693631 GAATATCTCTTGAGGAATCATGG - Intronic
911917271 1:103713622-103713644 GAATATCTCTTGAGGAATCATGG + Intronic
911920365 1:103752478-103752500 GAATATCTCTTGAGGAATCATGG + Intronic
912383165 1:109258474-109258496 GAGCATCTCATCGGTGATGATGG - Exonic
912654395 1:111472584-111472606 GAGAATGTCTTCAGAGAAGATGG - Intergenic
913956051 1:143294809-143294831 GGGTATTTCTGAAGGGATGAAGG + Intergenic
913981380 1:143520631-143520653 GGGTATTTCTGAAGGGATGAAGG - Intergenic
914075753 1:144347286-144347308 GGGTATTTCTGAAGGGATGAAGG - Intergenic
914103425 1:144619210-144619232 GGGTATTTCTGAAGGGATGAAGG + Intergenic
914359207 1:146916545-146916567 GAGGATCACTTGAGGGCTGATGG + Intergenic
914494541 1:148183331-148183353 GAGGATCACTTGAGGGCTGATGG - Intergenic
916676514 1:167068451-167068473 GAGTATCTGTTGAGGGATGGGGG + Intronic
919369349 1:196704536-196704558 GAGTATCTCTTCAGGGGTGCAGG - Intronic
919381908 1:196870486-196870508 GAGTATCTCTTCAGGGATGAGGG - Intronic
922567394 1:226609907-226609929 GAGTAACTCCCCAGGGATGAAGG - Intergenic
1066705081 10:38168790-38168812 GTTTATCTCTTTGGGGATGAGGG - Intergenic
1066985401 10:42461764-42461786 GTTTATCTCTTTGGGGATGAGGG + Intergenic
1066996955 10:42572741-42572763 CAGTAGATCTTCAGGGATCAAGG + Intergenic
1067574921 10:47403098-47403120 GAGTCACTCCTCTGGGATGAAGG + Intergenic
1068897545 10:62223914-62223936 AAGTGTCTATCCAGGGATGAAGG + Intronic
1069063031 10:63913859-63913881 CAAAATCTCTTCAGGGAAGAGGG + Intergenic
1070496354 10:77027579-77027601 GAGTGTTTCTCCAGGGAAGAGGG - Intronic
1070504243 10:77099123-77099145 GCCTCACTCTTCAGGGATGAAGG + Intronic
1071087281 10:81877459-81877481 CATTAACTCTTCAGTGATGATGG + Intronic
1076122914 10:127950546-127950568 GCGGAGCTCTTCAGGGATGCTGG - Intronic
1077871478 11:6265898-6265920 GAGCACCTCTGCAGAGATGACGG + Intronic
1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG + Intronic
1078603062 11:12750253-12750275 CAGCCTCTCTTTAGGGATGAGGG + Intronic
1085159057 11:74324298-74324320 GAGTATGAATTCAGGGAGGATGG - Intergenic
1086725613 11:90179583-90179605 GAGTATCTCTGCAGTGATGGGGG + Intronic
1086809658 11:91292625-91292647 GAGTATCTCTCCAGGAAAAACGG + Intergenic
1088067430 11:105737622-105737644 GAGTAGGTCTTAAGGGATTACGG - Intronic
1088389682 11:109300343-109300365 AAGCCTCTATTCAGGGATGATGG + Intergenic
1089053334 11:115564851-115564873 GTGGAACTTTTCAGGGATGAAGG - Intergenic
1090758091 11:129812773-129812795 GAGTATCTCTTGAGCGTTGGAGG + Intergenic
1091104131 11:132902513-132902535 GACGATCTCATCAGGGATGGGGG + Intronic
1093638055 12:21494779-21494801 GCGGAGCTCTTCAGGGATGCTGG + Intronic
1097034427 12:56113466-56113488 GAGAATCTCTTCATAAATGAAGG - Exonic
1097198283 12:57256722-57256744 GAGCCTTTCTTCAAGGATGATGG - Intronic
1099054268 12:77818552-77818574 CAGTGTCTTTGCAGGGATGAGGG + Intergenic
1100300897 12:93306936-93306958 GAAAATATCTTCAGGAATGAAGG + Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1106191426 13:27457015-27457037 GAGTATCAGTCCAGGCATGATGG + Intergenic
1106225546 13:27783676-27783698 GATAATTTCTGCAGGGATGAAGG - Intergenic
1106545907 13:30731161-30731183 GAATCTCTCTTCAGGGCTGAGGG + Intronic
1106717636 13:32407704-32407726 GATTTTTTCTTCAGGGAAGATGG - Exonic
1106961616 13:35005146-35005168 GACTATCTTTTCAGGGATTTTGG + Intronic
1110904201 13:80864712-80864734 CAGTATTTCTTCAAGGAAGATGG - Intergenic
1112164582 13:96904497-96904519 CAGTAGCTCTGCAGGGAAGAGGG + Intergenic
1115922697 14:38394138-38394160 GAGTATATAATCAGGGATCAAGG + Intergenic
1119483654 14:74974940-74974962 CTGTATCTCTTCAGGGCTGCAGG + Intergenic
1119707031 14:76789318-76789340 GAGTATCTCTTCAGAGAGAAGGG + Exonic
1121341890 14:93110411-93110433 GAGATTCTCTGCAGGGAGGAAGG - Intronic
1124631198 15:31338650-31338672 GAGTACCTCATCAGGGACCAAGG - Intronic
1126333420 15:47559223-47559245 GTGTTTCTCTTCAAGCATGACGG + Intronic
1127038960 15:54952183-54952205 TAGTATCTCTTCAACTATGATGG - Intergenic
1128649925 15:69403063-69403085 GAGTCTCACTTCAGTGCTGAGGG - Intronic
1130965817 15:88696646-88696668 TAAGATCTCTTCAGGGATGATGG - Intergenic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1133472817 16:6092039-6092061 AAGTATGTCTTCAAGGAGGACGG - Intronic
1133539225 16:6732477-6732499 GAGTATCTCTTCCAGGGGGATGG + Intronic
1133663021 16:7937230-7937252 CAGGATCTCTTCAGGGATGGAGG + Intergenic
1135231385 16:20711428-20711450 GAGTCTCACTTAAGGGATGGCGG + Intronic
1136944994 16:34638873-34638895 GGGTATTTCTGAAGGGATGAAGG - Intergenic
1138266050 16:55660428-55660450 GAGCATGTCTGAAGGGATGAGGG - Intronic
1140513807 16:75528078-75528100 CAGTCTTTGTTCAGGGATGATGG + Intergenic
1143587857 17:7859912-7859934 GAGTAGTTCTACAGGGGTGAGGG + Exonic
1143667346 17:8371612-8371634 GAGTACAGCTTCATGGATGAGGG + Exonic
1147233216 17:39034858-39034880 GAGTGTTACCTCAGGGATGAGGG - Intergenic
1148173568 17:45544968-45544990 TAGCATTACTTCAGGGATGAGGG + Intergenic
1148275702 17:46300481-46300503 TAGCATTACTTCAGGGATGAGGG - Intronic
1148297812 17:46518057-46518079 TAGCATTACTTCAGGGATGAGGG - Intronic
1148362360 17:47022538-47022560 TAGCATTACTTCAGGGATGAGGG - Intronic
1150404774 17:64891883-64891905 TAGCATTACTTCAGGGATGAGGG + Intronic
1151834313 17:76573186-76573208 GACTATGTATTCAGGTATGAGGG - Exonic
1153055114 18:938200-938222 GTGTCTCTCTCCAGAGATGAAGG + Intergenic
1154363015 18:13680552-13680574 AAGTAGCTCTTCCAGGATGATGG - Intronic
1155436186 18:25815514-25815536 AAGTATCTCTACAGGGAAAAAGG - Intergenic
1158329401 18:56344896-56344918 GGGGATCTCTGCAGGGAGGAAGG + Intergenic
1159625789 18:70692363-70692385 GAGTTCATCTTCAGGAATGAGGG - Intergenic
1159911837 18:74152784-74152806 GAATACGTCTTGAGGGATGAGGG + Intronic
1162009636 19:7804415-7804437 GAATATCTGTTCTAGGATGAGGG - Intergenic
1163254506 19:16147392-16147414 GAGAATCACTTGAGGGAAGAAGG + Intronic
1164613004 19:29645942-29645964 GAATTTCTCTTTAGGGGTGAAGG - Intergenic
1164631734 19:29766269-29766291 GAGTGTCACTGCAGGGAGGAGGG - Intergenic
1167215854 19:48164256-48164278 GATTGTCTCTCCAGGGCTGATGG - Intronic
927078260 2:19601941-19601963 GAGTATATCTTCTGGCCTGAAGG + Intergenic
928748427 2:34442964-34442986 GAGCACCTCTTCAGGAAGGAGGG - Intergenic
931988572 2:67765883-67765905 AAGCTTCTCTTTAGGGATGATGG + Intergenic
933075107 2:77914635-77914657 GAGTGTGTCTTCAGAGATGCAGG + Intergenic
935783808 2:106531271-106531293 GAGTATCTCTTCAGATTTGGGGG - Intergenic
937590542 2:123607953-123607975 AAGAATATCTTCAGAGATGAAGG + Intergenic
938812920 2:134870201-134870223 GACTGGCTCCTCAGGGATGAAGG + Intronic
939862148 2:147433300-147433322 GACCATCTCTTCATGGATGAGGG - Intergenic
944973647 2:205023050-205023072 GATGATCTCTTCAGGGATAATGG - Intronic
945754429 2:213829378-213829400 GACTCGCTCTTCAGGGATGTGGG + Intronic
1173558413 20:43984428-43984450 GAGTATGTGTTTAGGGTTGATGG - Intronic
1173731557 20:45332532-45332554 GACTATCCCTGCAGGGAGGATGG + Intronic
1179006663 21:37521293-37521315 GAGTGTCTCTGCAGGGAGTAGGG - Intergenic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1180987634 22:19914676-19914698 TAGTTTCAGTTCAGGGATGATGG + Intronic
1183279887 22:36926288-36926310 GAGGGTTTCTTGAGGGATGAGGG + Intronic
952935105 3:38391312-38391334 AATGATCTCTGCAGGGATGAGGG - Intronic
959941866 3:112088823-112088845 GAGTATCACATCTGGAATGATGG + Intronic
961220467 3:125195130-125195152 GAGGATTTCTTCAGGGAAGTTGG + Intronic
961614063 3:128164784-128164806 GAGAGTCTCTTCTGGGAGGAAGG + Intronic
962317164 3:134366079-134366101 TAGGATCCCCTCAGGGATGATGG - Intronic
963842418 3:150121132-150121154 GAGTATCTCTCTAGTGTTGAAGG - Intergenic
966227123 3:177609916-177609938 GTTAATCTCTTCAGGGTTGAGGG + Intergenic
967269423 3:187720500-187720522 GAGCACCTCTGCAGGGATGGAGG + Intronic
968063613 3:195745981-195746003 GATTCTCTCTTCAGGGATTTGGG + Intergenic
968802203 4:2750632-2750654 GAGACCCTCTTCAGGGATAAAGG + Intronic
969079660 4:4608467-4608489 GAGGTTCTTTGCAGGGATGAGGG + Intergenic
973061727 4:45734780-45734802 GAGCATCTTTGCAGGGATCAGGG + Intergenic
973327413 4:48877676-48877698 GAGTCTCTCTTCAGGGCAGTGGG + Intergenic
978582400 4:110245185-110245207 GAGTGTCTCTTAAGGGATGAGGG + Intergenic
984611630 4:181846321-181846343 GAGCTTCTCTTCAGGACTGAAGG + Intergenic
984801243 4:183718950-183718972 CATTATCTGTTCATGGATGATGG - Intergenic
985383392 4:189419485-189419507 GAGGAGCACTTCAGGGAAGACGG + Intergenic
985604370 5:850552-850574 GAGTATGGCTTCTGGGGTGACGG + Exonic
991163101 5:63528329-63528351 GAGTATATTTTCTGGGGTGATGG + Intergenic
992037867 5:72798669-72798691 GGGCATCTCTTGAGGGATGTGGG - Intergenic
996085623 5:119301973-119301995 TAGTTTATCTTCAGGAATGAAGG + Intronic
996163606 5:120197434-120197456 GAGGATCTCTCCTGGTATGATGG + Intergenic
1002140306 5:177133814-177133836 GCGTCTCTCTTCAGGGGAGAAGG - Intronic
1008954974 6:57205582-57205604 TATTAACTGTTCAGGGATGAGGG + Intronic
1011372638 6:86654263-86654285 GTGTATCTTTTCAGGGAAGGTGG - Intergenic
1015503192 6:133953647-133953669 GGGGATCTCTTTAGGGATAACGG + Intronic
1017517069 6:155165888-155165910 GACTACCTCTTCAGGGGTGCCGG - Intronic
1019231958 6:170573921-170573943 AAGTATCTCTTCATGTATGTAGG + Intergenic
1022814610 7:33902911-33902933 GACTATCACTTGAGGGGTGATGG + Intergenic
1023323987 7:39032399-39032421 TAGTATCTTATCAGGGATGGCGG - Intronic
1025056663 7:55770874-55770896 GATTTTCTATTCTGGGATGAGGG - Intergenic
1026226533 7:68446900-68446922 GAGTATCTCTGCAGAAAAGATGG - Intergenic
1026266240 7:68798291-68798313 GGGCTTCTCTTCAGGGAAGACGG + Intergenic
1026446483 7:70488768-70488790 GCGTATCCCTTCAGGGAAGAAGG + Intronic
1028154680 7:87416336-87416358 CAGTATCTCTATAGGGAAGAAGG - Intronic
1032217643 7:129969928-129969950 GAATATCTGTTTAGGGATGGGGG - Intergenic
1035738426 8:1906758-1906780 GCGGGTCTCTTCAGGGATCAAGG + Intronic
1039670707 8:39594546-39594568 GATTATCTCTTCATTTATGAAGG + Intronic
1040015386 8:42695427-42695449 GAGTATCTTTGCAGGGAGAAAGG + Intergenic
1041380152 8:57246246-57246268 GGGTATCTTTTCAGTGGTGAAGG - Intergenic
1047718128 8:127614626-127614648 AAGTAACTCTTCCGGGATGGTGG - Intergenic
1052415118 9:28168018-28168040 AATTGTCTTTTCAGGGATGAAGG - Intronic
1052895817 9:33747561-33747583 GAGTATCTCTTGAGCGTTGGAGG + Intergenic
1053842015 9:42195850-42195872 GATTATTTCTTCTGGGATAAAGG - Intergenic
1056548408 9:87632022-87632044 GAGTATATATGTAGGGATGAAGG + Intronic
1056548506 9:87633018-87633040 GAGTATATATGTAGGGATGAAGG + Intronic
1056548518 9:87633157-87633179 GAGTATATATGTAGGGATGAAGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1060730692 9:126034973-126034995 GAGTGGCTCTTGAGGGGTGATGG + Intergenic
1061117582 9:128624345-128624367 GAACATCTCTTCAAAGATGAAGG + Exonic
1188317922 X:28698357-28698379 GAATATCTCTTCAGGGGTCAAGG - Intronic
1188403132 X:29772346-29772368 GAGTATCTGTTCAGCCATAAAGG + Intronic
1188897467 X:35686634-35686656 GAGTCTCCCTTCAGGGAAGCTGG - Intergenic
1190378074 X:49810372-49810394 GAGTCTCTTTTCAAGGTTGAAGG - Intergenic
1190885971 X:54531140-54531162 GACTGTCTCTTCATGGATTAAGG - Intronic
1191956133 X:66644250-66644272 GAATAGCTCTTCAGAGAGGATGG - Intergenic
1194386932 X:93266899-93266921 GAGTATCTCTTTAAATATGATGG - Intergenic
1195131918 X:101861641-101861663 GAGTATCTCCTCAGAGATGGAGG - Intergenic
1196538935 X:116882552-116882574 GAGTCACTCTTCAGGGCTGTGGG + Intergenic
1197005270 X:121488949-121488971 GAGGAAATCTGCAGGGATGAAGG + Intergenic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic