ID: 919382506

View in Genome Browser
Species Human (GRCh38)
Location 1:196876229-196876251
Sequence GACTTTAAGGGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 2, 2: 25, 3: 56, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919382506_919382518 12 Left 919382506 1:196876229-196876251 CCCTCCATGATCCCCTTAAAGTC 0: 1
1: 2
2: 25
3: 56
4: 229
Right 919382518 1:196876264-196876286 CCCCTTCACAGAACAGATTTGGG 0: 1
1: 0
2: 1
3: 11
4: 139
919382506_919382516 11 Left 919382506 1:196876229-196876251 CCCTCCATGATCCCCTTAAAGTC 0: 1
1: 2
2: 25
3: 56
4: 229
Right 919382516 1:196876263-196876285 ACCCCTTCACAGAACAGATTTGG 0: 1
1: 0
2: 0
3: 7
4: 136
919382506_919382520 13 Left 919382506 1:196876229-196876251 CCCTCCATGATCCCCTTAAAGTC 0: 1
1: 2
2: 25
3: 56
4: 229
Right 919382520 1:196876265-196876287 CCCTTCACAGAACAGATTTGGGG 0: 1
1: 1
2: 4
3: 13
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919382506 Original CRISPR GACTTTAAGGGGATCATGGA GGG (reversed) Intronic
902251678 1:15157555-15157577 GACAGAAAGGGGATCTTGGAGGG - Intronic
904362563 1:29986270-29986292 GTTTTTAAGGGGACCATAGAGGG - Intergenic
905460670 1:38120849-38120871 GACCTGAAGGGGGTGATGGAGGG - Intergenic
906256871 1:44357107-44357129 GAAGTCAAGGGGACCATGGAAGG - Intergenic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
909160833 1:72147589-72147611 GACTTTAGGGGAATGTTGGAAGG - Intronic
911823796 1:102454040-102454062 GACCCTAAGGGCATCATGGATGG + Intergenic
911850383 1:102811184-102811206 GCTTTTAAGGGGTTCCTGGATGG + Intergenic
911931932 1:103915328-103915350 GACTATAAGAAGATAATGGAAGG + Intergenic
912107807 1:106303131-106303153 GACTTTAGGGGAGTCATGGGAGG - Intergenic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914414173 1:147463061-147463083 GTCTTTTGGGGGAACATGGATGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915227485 1:154421538-154421560 GACCTACAGGGGAACATGGAGGG - Intronic
915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG + Intergenic
916173287 1:162017971-162017993 GTCTTTTATGGGAACATGGATGG + Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917210099 1:172622343-172622365 GACTTCAAGGGAATGAGGGAGGG - Intergenic
918217528 1:182405628-182405650 AGTTTTAAGGGGATCATGGAGGG - Intergenic
918979482 1:191537118-191537140 GCTTTTAAGGGGATCATGGAGGG - Intergenic
919138095 1:193535852-193535874 CACTTTAAGGGGGTCAAGGTGGG - Intergenic
919250581 1:195051430-195051452 AACTTTAAGGGGTGAATGGAAGG + Intergenic
919369930 1:196710188-196710210 GACCTTAAGGGGATCATGGAGGG - Intronic
919382506 1:196876229-196876251 GACTTTAAGGGGATCATGGAGGG - Intronic
920280294 1:204838493-204838515 AACTTGCAGGGCATCATGGATGG - Intronic
920752931 1:208698616-208698638 GTTTTTAAAAGGATCATGGAGGG - Intergenic
920816349 1:209336773-209336795 GTCTTTTATGGGAACATGGATGG + Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
1062849438 10:732057-732079 GTCTTTTATGGGAACATGGATGG + Intergenic
1063790108 10:9435047-9435069 GCCGTTAATGGGAACATGGAGGG + Intergenic
1066955511 10:42166746-42166768 GAATTGAATGGAATCATGGAAGG + Intergenic
1068517444 10:58041873-58041895 GATTTTAGGAGGATTATGGAGGG + Intergenic
1069171420 10:65234535-65234557 GTTTTTATGGGGATCATGAAAGG - Intergenic
1069234194 10:66049632-66049654 GTCTTTTATGGGAACATGGATGG + Intronic
1069880733 10:71591262-71591284 GATTTTAAGTGGTGCATGGATGG + Intronic
1071338008 10:84617448-84617470 GACTTTGAGGGGATAAGAGATGG + Intergenic
1071361598 10:84851737-84851759 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1074407513 10:113191902-113191924 GAGATGAAGGGAATCATGGAGGG + Intergenic
1076304380 10:129454039-129454061 GACTTTATGGGGAGTATGGTAGG + Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1082216616 11:49578144-49578166 GTGTTTACGGGGATCATGGTGGG + Intergenic
1083740605 11:64709325-64709347 GACTTTAAGGGGAGCAGGCCTGG - Intronic
1085915509 11:80882935-80882957 AACTATAAGGGGAACTTGGAAGG + Intergenic
1087792666 11:102423382-102423404 GACTTTAAAGGGAGCTGGGAGGG - Intronic
1088338331 11:108733851-108733873 GAACTTAAGGGTAGCATGGAAGG - Intronic
1088586933 11:111367652-111367674 GACTTTAACTGGAGCAAGGAGGG - Intronic
1089687538 11:120165975-120165997 GTCTTTTATGGGAACATGGATGG - Intronic
1089965462 11:122651736-122651758 GACTTTAAGGGGATCCTTCGTGG - Intergenic
1092360020 12:7828752-7828774 GACTTTCAGGGCAACATGGAAGG + Exonic
1092372717 12:7930528-7930550 GACTTTCAGGGCAAAATGGAAGG + Exonic
1092501720 12:9053968-9053990 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1093168420 12:15832160-15832182 GACTTGAAGGTGACCATGTAAGG - Intronic
1093805037 12:23421883-23421905 ATCGCTAAGGGGATCATGGAAGG - Intergenic
1094390774 12:29947988-29948010 GCCTCTTAGAGGATCATGGAAGG - Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1098366752 12:69711777-69711799 CACTTTAATGGGATTAAGGAAGG + Intergenic
1098812927 12:75119123-75119145 GACTTAAAGGATACCATGGAAGG - Intronic
1098850939 12:75594926-75594948 GTCTTTTGGGGGAACATGGATGG + Intergenic
1098950545 12:76636481-76636503 GTTTTTCAGGGGGTCATGGAGGG + Intergenic
1103081240 12:118025638-118025660 GGCTTTAAAGGGATGAAGGAAGG - Intronic
1106680651 13:32003714-32003736 GTCTTTCATGGGAACATGGATGG + Intergenic
1107758302 13:43649911-43649933 GACTGTCAGGGAATCCTGGAGGG - Intronic
1107855029 13:44606529-44606551 GACTTTTGTGGGAACATGGATGG - Intergenic
1109849340 13:68039771-68039793 GACTTTTGGGGGATCATGGGAGG - Intergenic
1110538843 13:76684899-76684921 GACGATAAGGGGAGAATGGAAGG - Intergenic
1110807683 13:79776475-79776497 TACTTTAAGGGGAACTTGCAGGG + Intergenic
1110945322 13:81407395-81407417 GACTGCAAGGGGCTTATGGATGG - Intergenic
1111102107 13:83601837-83601859 GTTTTTAAGGGGATCATGGTGGG - Intergenic
1111638041 13:90931001-90931023 GCCTTTTACGGGAACATGGATGG + Intergenic
1112217214 13:97445247-97445269 GAGTGTAAGTGGATCATTGAGGG - Intronic
1113169119 13:107479101-107479123 GACTTTAAGGGCATCTTCTAAGG - Intronic
1115451575 14:33553867-33553889 GACTTCAAGGAGAACCTGGATGG - Intronic
1115521530 14:34237839-34237861 GACTTAGAGGGGATCACTGATGG - Intronic
1116233511 14:42248292-42248314 GTCTTTAAGGAGATTATGGAGGG + Intergenic
1116616603 14:47148396-47148418 GAATTTAACTGCATCATGGAGGG + Intronic
1117265640 14:54083627-54083649 GACTTCAAAGGGAGCATGAATGG + Intergenic
1119068147 14:71551654-71551676 GACTTTAAGAGCAACATGAAAGG - Intronic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1121155429 14:91679598-91679620 GACTTTAAGGGCAACATAGAAGG - Intronic
1124198014 15:27650221-27650243 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1124217253 15:27817607-27817629 GTTTCTAAGAGGATCATGGAGGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1125306863 15:38327224-38327246 GACTTTTAGGGAGTCATGGGAGG + Intronic
1127292603 15:57583564-57583586 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1127633998 15:60851944-60851966 GACTTGATGGGGAACATGGCCGG - Intronic
1127769668 15:62221028-62221050 GAGTTTAAGGGGAACAAGGTTGG - Intergenic
1128734010 15:70041771-70041793 AACTTTAAGGGAGTCATGAATGG + Intergenic
1130026511 15:80275466-80275488 GTTTATAAGGAGATCATGGAAGG - Intergenic
1130067450 15:80616431-80616453 GCCTTTAGGGAGATAATGGAGGG - Intergenic
1130689872 15:86072916-86072938 GTTTCTAAGCGGATCATGGAGGG - Intergenic
1133653932 16:7841148-7841170 GTCTTTTATGGGAACATGGATGG - Intergenic
1133849865 16:9492637-9492659 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1134365226 16:13570936-13570958 ATTTTTAAGGGGATCATGAAGGG + Intergenic
1135945510 16:26861374-26861396 GACTCTAAGGATATCTTGGAAGG - Intergenic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136940768 16:34574556-34574578 GACTCGAAGGGCATCATCGAAGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138416598 16:56875168-56875190 AGCTTTAAGGGGCTCTTGGATGG + Intronic
1139938661 16:70589540-70589562 GTCTTTTATGGGAACATGGATGG - Intronic
1139975201 16:70804434-70804456 GTTTTTAAGGGGATCCTGGAGGG + Intergenic
1140595457 16:76403887-76403909 GTCTTTTATGGGAACATGGATGG + Intronic
1141525221 16:84606789-84606811 GACCCTAAGAGGAACATGGAGGG - Intronic
1141819429 16:86434794-86434816 GCCTTTGTGGGGAACATGGAGGG + Intergenic
1142190892 16:88716849-88716871 GCCGTGAAGGGGATGATGGACGG + Exonic
1142317858 16:89360208-89360230 GTCTTTTATGGGAACATGGATGG - Intronic
1143267538 17:5651428-5651450 GCTTTTAAGGGGATCATGGAGGG - Intergenic
1143607433 17:7997184-7997206 GACTTTATGGGGGGCAGGGAAGG + Intergenic
1143654070 17:8283031-8283053 GACTATAAGGGGAAAATGGCAGG + Intergenic
1144052058 17:11505320-11505342 GACTTTCTTGGGTTCATGGATGG + Intronic
1144182274 17:12763327-12763349 CACTTTGATGGGATAATGGATGG + Exonic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149202866 17:54208090-54208112 GTCTTTTATGGGAACATGGATGG + Intergenic
1150518005 17:65835032-65835054 GTCTTTTATGGGAACATGGATGG + Intronic
1203187626 17_KI270729v1_random:141787-141809 GACTCGAATGGAATCATGGATGG - Intergenic
1153241099 18:3032080-3032102 GACTTTAAGCGGAGCCTTGAAGG - Intergenic
1153991379 18:10403704-10403726 GAAATTAAGGAGCTCATGGAAGG - Intergenic
1155329776 18:24703375-24703397 GTCTCTAAGGAGATCATGGAGGG - Intergenic
1155603886 18:27581611-27581633 GCTTTTAAGGAGATCATGGAGGG - Intergenic
1155851056 18:30774566-30774588 GTTTTTGAGGGGATCATGGAGGG - Intergenic
1157324924 18:46662128-46662150 GCTTTTAAGGGGACCATGGAGGG - Intergenic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1157788522 18:50508443-50508465 GTCTTTTGGGGGAACATGGATGG + Intergenic
1158194143 18:54866233-54866255 GACTCTCAGGGGATCCTGGTGGG + Intronic
1158622188 18:59042526-59042548 GACTTGGAAGGGATCAGGGAGGG - Intergenic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159020144 18:63136556-63136578 AACTCTAAGGGGAGCAGGGAAGG + Intronic
1160808464 19:1002694-1002716 GACTGTAAAGGAATCAGGGAGGG + Intronic
1162244268 19:9386315-9386337 GTTTTAAAGGGGATCAGGGAGGG + Intergenic
1162883782 19:13681000-13681022 GGTTTTAAGAGGATCATGGAGGG + Intergenic
1163045323 19:14637290-14637312 ACTTTTAAAGGGATCATGGAGGG - Intronic
1165302079 19:34976672-34976694 GATTTTAAGGGGATCATGGAAGG - Intergenic
926001100 2:9333447-9333469 AACTTGTAGGGGATTATGGAAGG + Intronic
927909546 2:26887265-26887287 GACCTTAAAGGGAACTTGGAAGG - Intronic
928372257 2:30748691-30748713 CACTTTAAGGGAATCCTGGTGGG - Intronic
928782324 2:34838974-34838996 GGCTTTTATGGGAACATGGAGGG - Intergenic
929419994 2:41780838-41780860 GTTTTTAAGGGGATCATGGAGGG - Intergenic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930117313 2:47729610-47729632 GTTTTTAAGGGGATCATGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
932035976 2:68247252-68247274 GAATTTAAAGGAATCATGGGTGG - Intronic
932232697 2:70095662-70095684 GACTTTGAGGGGAAGATGTAAGG + Intergenic
932480087 2:72033820-72033842 GACTTGAAGGAGGTCAGGGAGGG - Intergenic
932524269 2:72446462-72446484 GTCTTTTATGGGAACATGGATGG + Intronic
932841297 2:75085283-75085305 GTTTTTTAGGAGATCATGGAGGG - Intronic
933115918 2:78471296-78471318 GTCTTTAGGGGTATCATAGAAGG - Intergenic
935798826 2:106671878-106671900 GACTTTAAGGGACTGTTGGAAGG + Intergenic
936273484 2:111070344-111070366 GTCTTTTACGGGAACATGGATGG + Intronic
937493293 2:122392387-122392409 GCTTTGAAGGGGATTATGGAGGG + Intergenic
937748315 2:125442388-125442410 GATATTAAAAGGATCATGGAGGG - Intergenic
937816491 2:126256511-126256533 GCTTTTAAGGGGATCATGGAGGG - Intergenic
938089694 2:128423358-128423380 TACTTTAAAGGGCTCATGCAGGG + Intergenic
938208332 2:129442670-129442692 GTTTCTATGGGGATCATGGAGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
939236623 2:139502613-139502635 GTCTTTTATGGGAACATGGATGG + Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
942738110 2:179139808-179139830 GTTTTTAAGGGGATCATGTAGGG - Intronic
944966903 2:204945250-204945272 GTTCCTAAGGGGATCATGGAGGG + Intronic
945374278 2:209061125-209061147 GATTTTAAGGGGATGGTGCAGGG + Intergenic
947143712 2:227043901-227043923 GACATTAAGGGGATAATTGGGGG - Intronic
947308851 2:228778282-228778304 GTTTTTAAGGGGATCATGGAAGG - Intergenic
947962481 2:234251335-234251357 GAATTTAGGGGCATCAGGGATGG - Intergenic
949013039 2:241692761-241692783 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1172487386 20:35306587-35306609 GGCTTTCAGGGGATCATGAGAGG - Intronic
1173934315 20:46847870-46847892 GACATTAGTGGGATAATGGAAGG - Intergenic
1174091424 20:48051734-48051756 GACTTTAAGGGGTTAGAGGAGGG + Intergenic
1176369974 21:6056756-6056778 GACTTCCAGGGGAGCATGGTGGG - Intergenic
1177331321 21:19667444-19667466 TAAATTAAGGGGATTATGGAAGG - Intergenic
1177685685 21:24434705-24434727 GACTTTTGAGGGAACATGGATGG - Intergenic
1178019292 21:28391281-28391303 GCCTTTTACAGGATCATGGATGG + Intergenic
1178892338 21:36530637-36530659 TAGGTTGAGGGGATCATGGAGGG + Intronic
1178910820 21:36671846-36671868 GATTCTAAGGTGATCATGAATGG + Intergenic
1179753545 21:43481785-43481807 GACTTCCAGGGGAGCATGGTGGG + Intergenic
1180741434 22:18055787-18055809 GAGTTTGAGGCTATCATGGAAGG - Intergenic
1181791378 22:25269572-25269594 TTTTTTACGGGGATCATGGAGGG + Intergenic
1181827072 22:25525683-25525705 TTTTTTAAGGGGATCATGGAGGG + Intergenic
1182917756 22:34051001-34051023 AGCTTTCAGGGGATGATGGAAGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949524897 3:4893836-4893858 GTCTTTTGGGGGAACATGGATGG + Intergenic
949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG + Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950253055 3:11482937-11482959 GACTGTAAGGGGCTCAAGGGGGG - Intronic
951112195 3:18817284-18817306 GTCTTTCATGGGAACATGGATGG - Intergenic
951654611 3:24991774-24991796 GAGGTTAAGGGGAGCAGGGAGGG - Intergenic
952693133 3:36233598-36233620 GCTTTTAAGGGGATGATGGAGGG - Intergenic
955569350 3:60287627-60287649 GAATTTAAGGGGATCAAGTGTGG + Intronic
957178009 3:76838073-76838095 GTCTTTTACGGGAACATGGATGG + Intronic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958496909 3:94856545-94856567 GTCTTTTGGGGGAACATGGATGG - Intergenic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
962075290 3:132075292-132075314 GACTTTGAGGGCAGCATTGAAGG - Intronic
962095490 3:132288312-132288334 GTTTTTAAGGGGATCATGGAGGG + Intergenic
965008825 3:163059038-163059060 AACTTTAAGGTGATAATGGAAGG + Intergenic
965495621 3:169395191-169395213 GACTATAAGGGGATGAGGGCAGG + Intronic
967025382 3:185559989-185560011 AACTTTAAGGCGATCATGTCGGG - Intergenic
968312135 3:197692716-197692738 GACATTAAGGAGAACATAGAAGG + Intronic
968662663 4:1805216-1805238 GGCTGTAGGGGGAGCATGGAGGG + Intronic
968939173 4:3629156-3629178 GTTTTTAAGGGGATCATGGAAGG - Intergenic
972844745 4:42974178-42974200 GTTTTTAAGTGGATCATGGAGGG + Intronic
973886821 4:55330691-55330713 GATTTTAAGGGGACAATGAAGGG - Intergenic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974991434 4:69095255-69095277 GGTTTTAAGGAGATCATAGATGG + Intronic
975021581 4:69497334-69497356 GTTTTTAAGGGGTTAATGGAGGG - Intronic
976802181 4:89005217-89005239 GTCTTTCATGGGAACATGGATGG - Intronic
977059483 4:92239545-92239567 GTTTATAAGGGGATCATGGAAGG - Intergenic
977729815 4:100337892-100337914 GTCTTTTGGGGGAACATGGATGG + Intergenic
978211814 4:106146285-106146307 GTCTTTTATGGGAACATGGATGG + Intronic
978413864 4:108455138-108455160 GACTGTAAGGGGATGATTTATGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
980327121 4:131361001-131361023 GACTGTAAAGGAATCATGGCTGG + Intergenic
980771074 4:137373999-137374021 GATTTTAAGGAAATAATGGAGGG + Intergenic
981283414 4:142987373-142987395 GTCTTTTATGGGAACATGGATGG - Intergenic
982611753 4:157583010-157583032 GATTTGAATGAGATCATGGAGGG + Intergenic
982782804 4:159508682-159508704 GTCTTAAAGGGAATGATGGAAGG - Intergenic
983249179 4:165325880-165325902 GCTTTTAAGGGGATCCTGGAGGG + Intergenic
983451564 4:167918212-167918234 GTTTTTAAGGGGATCATGGAGGG + Intergenic
983844932 4:172506332-172506354 GTTTTTATGAGGATCATGGAGGG - Intronic
984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG + Intergenic
986920712 5:12676076-12676098 GATTTTGAGGGGATCGTGGAGGG + Intergenic
987013271 5:13790387-13790409 GTCTTTCATGGGAACATGGATGG + Intronic
987597119 5:20016151-20016173 GTCTTTTGGGGGAACATGGATGG + Intronic
987832965 5:23121931-23121953 AACTTTAAAGGGAACATAGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989700002 5:44252627-44252649 GTTTTTAAGGGGATCATTGAGGG + Intergenic
993244082 5:85429481-85429503 GACTATAGGGAGATCAAGGATGG + Intergenic
993561454 5:89416241-89416263 GACAGAAAGAGGATCATGGAGGG - Intergenic
994937549 5:106273985-106274007 GTCTTTAAGGGTATCATGGAGGG + Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996794658 5:127331955-127331977 GATTGGAAGGGGATCTTGGAAGG + Intronic
1001412895 5:171523459-171523481 GAGTTTAATGAGATGATGGATGG + Intergenic
1001434750 5:171691406-171691428 GACTTCAAGAGGCGCATGGATGG + Intergenic
1002304618 5:178275869-178275891 GTGTTTAAGGGGATCATGGAGGG - Intronic
1003663848 6:8090531-8090553 GACTTTAACATGATCATAGATGG - Intronic
1004616800 6:17298456-17298478 GCCACTTAGGGGATCATGGAGGG + Intergenic
1004972579 6:20928188-20928210 GAATGTAAAGGTATCATGGAAGG + Intronic
1005918072 6:30371544-30371566 GACTTTGCGGGGGTGATGGAGGG + Intergenic
1008771689 6:54986627-54986649 GACTTTTGTGGGAACATGGATGG + Intergenic
1012339315 6:98099834-98099856 GTCTTTCATGGGAACATGGATGG - Intergenic
1013095546 6:106941406-106941428 GACTTTAAGGAGATTTTGGAGGG + Intergenic
1014280552 6:119438362-119438384 GATTTTAATGGGATCAAGGTTGG - Intergenic
1016095123 6:140027445-140027467 GTCTTTTATGGGAACATGGATGG - Intergenic
1016790127 6:148059587-148059609 GACTTTAAGGGACTCTTGGAAGG - Intergenic
1017248929 6:152259150-152259172 GATTTTAAGGGGATGCTGGGTGG - Intronic
1017358695 6:153541317-153541339 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1017358936 6:153543202-153543224 GGTTTTAAGGGGATCATGGAGGG - Intergenic
1019553194 7:1614167-1614189 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1019553666 7:1617788-1617810 GTCTTTAAAGAGATAATGGAGGG + Intergenic
1021224743 7:18013923-18013945 GTTTTTAAGGGAATCATGGAGGG + Intergenic
1026556092 7:71409854-71409876 GCTTTGAAGGGGATCATGGAAGG + Intronic
1026597852 7:71749399-71749421 GATTTTAAGGGAATCATGAAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026811330 7:73468663-73468685 GACTGAGAGGGGATCATGTAGGG - Intronic
1028078044 7:86538951-86538973 GTCTTTAGGGGGAACATGGATGG + Intergenic
1029101825 7:98137434-98137456 GACTTTAAGGTGAGCACAGAGGG + Exonic
1029900544 7:104034763-104034785 GTTTTTAAGGGGATCATGGAAGG - Intergenic
1030518544 7:110567677-110567699 GACTTAAAGCGGATCAAGGTTGG + Intergenic
1030639221 7:111985238-111985260 GCCTTTGAGATGATCATGGAGGG - Intronic
1032297005 7:130648380-130648402 GACTTTGGGGGGATCTTGGAAGG - Intronic
1032499877 7:132392310-132392332 GAATGGAAGGGCATCATGGAGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034464603 7:151219227-151219249 GAGTTTAGGGGGATGAGGGATGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1037730848 8:21523027-21523049 GAGTTGAAGGAGATCAGGGAAGG - Intergenic
1038525881 8:28272885-28272907 GTTTTTAGGGGGATCATGGAGGG + Intergenic
1040936911 8:52791003-52791025 GTTTTTAAGGAAATCATGGAGGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1040985572 8:53290630-53290652 GTTTTTAAGGAGATCATGAAGGG + Intergenic
1041936763 8:63340612-63340634 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1043263481 8:78231515-78231537 GAGTTTAAGTGGATCAAGGCAGG - Intergenic
1043968324 8:86504186-86504208 GACTTTCAGGGCAAAATGGAAGG - Intronic
1045797192 8:106060056-106060078 GTTTTTAATGGGATCATGGAGGG - Intergenic
1045803960 8:106135041-106135063 GGTTTTAAGAGAATCATGGAGGG + Intergenic
1046470138 8:114661912-114661934 GTTTTTAAGGGGATCATGGAGGG - Intergenic
1048893825 8:138970878-138970900 GTTTTTAAGGGGACCATGGAGGG + Intergenic
1049864109 8:144922504-144922526 GTTTTTAAGGGGATCATGGAGGG + Intergenic
1052240162 9:26261957-26261979 GTTTTTAAGGAGATCATGGAGGG + Intergenic
1053162919 9:35825956-35825978 GCCTCTAAGGGGATCTGGGAAGG + Exonic
1053163589 9:35829556-35829578 GACTGGAAGGGGGTCCTGGATGG - Exonic
1053948017 9:43334836-43334858 GACTCTAATGGAATCATTGAAGG - Intergenic
1055295336 9:74827538-74827560 ATCTTTGGGGGGATCATGGAAGG + Intronic
1055912396 9:81367620-81367642 GTCTTTTATGGGAACATGGATGG + Intergenic
1056495681 9:87152806-87152828 GATTTTAGTGGGATCTTGGAAGG + Intronic
1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG + Intergenic
1058327702 9:103718757-103718779 ATTTTTAAGGGGATCATTGAGGG + Intergenic
1059691928 9:116693655-116693677 GACATTCAAGGGATCATGAAGGG + Intronic
1059912606 9:119062567-119062589 GTCTTTCATGGGAACATGGATGG - Intergenic
1060803412 9:126558736-126558758 GGATTTAAAGGGATCCTGGAGGG + Intergenic
1061863968 9:133482582-133482604 GCTTTTAAGGGGATCATGGAGGG + Intergenic
1203591198 Un_KI270747v1:63035-63057 GACTCTAATGGAATCATTGAAGG - Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1189284407 X:39841141-39841163 GACTTTCAGGGCTTCAGGGAAGG - Intergenic
1189326906 X:40118127-40118149 GACTTTAAGGGTAGCACTGAGGG + Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1190336794 X:49267458-49267480 GACTTGAAGGAGATGAGGGAGGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1193030732 X:76895928-76895950 GTCTTTTAGGGGAACATGAATGG + Intergenic
1194094029 X:89614470-89614492 GTCTTTTATGGGAACATGGATGG + Intergenic
1195332030 X:103810439-103810461 GACTTTAAGCAGGTCATGGTGGG + Intergenic
1195472962 X:105253852-105253874 GTCTTTTATGGGAACATGGATGG - Intronic
1195954432 X:110314454-110314476 GACTTGAATGGGGTCTTGGATGG - Intronic
1196741433 X:119029286-119029308 GTCATTCAGGTGATCATGGAAGG + Intergenic
1197618260 X:128718552-128718574 GACAGTTTGGGGATCATGGAAGG - Intergenic
1198413406 X:136394532-136394554 GACTTGGAGGGGATCAGGAAAGG - Intronic
1198602961 X:138304614-138304636 GACTTTAAGGGGAGCAAGAGTGG + Intergenic
1198986303 X:142458016-142458038 GAAGTTAAGGGGATCAGGAAGGG - Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1200446649 Y:3270614-3270636 GTCTTTTATGGGAACATGGATGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic