ID: 919388791

View in Genome Browser
Species Human (GRCh38)
Location 1:196955179-196955201
Sequence GCCCCTGCCCTGAAGATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3626
Summary {0: 1, 1: 6, 2: 141, 3: 1397, 4: 2081}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919388791 Original CRISPR GCCCCTGCCCTGAAGATGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr