ID: 919400083

View in Genome Browser
Species Human (GRCh38)
Location 1:197103281-197103303
Sequence TGCATGTGCAACAAAAGAAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919400083 Original CRISPR TGCATGTGCAACAAAAGAAG TGG (reversed) Exonic
901459415 1:9382813-9382835 TGCATGAGCAACGCAAGAGGAGG - Intergenic
903105738 1:21078289-21078311 TCCATTTGCAACAACAGAAATGG + Intronic
905623299 1:39468039-39468061 TGCCTCTGCACCAAAAGGAGAGG - Intronic
905820281 1:40984304-40984326 TGAATGTGCAACAAAAGAATGGG + Intronic
906876749 1:49547487-49547509 TTCATATGGAACCAAAGAAGGGG - Intronic
907291512 1:53416078-53416100 TCAATGTGCACCAAAAGAAAAGG + Intergenic
907579016 1:55555289-55555311 TTCCTGGGCCACAAAAGAAGAGG - Intergenic
907749940 1:57253192-57253214 TGGATGTGCATTAACAGAAGCGG + Intronic
910164695 1:84313742-84313764 CACATGTGCAAGAAAAGAAGTGG - Intronic
912148583 1:106826471-106826493 TGTAAATGCAATAAAAGAAGTGG - Intergenic
912669301 1:111609366-111609388 AGCATTTGCTACCAAAGAAGTGG - Intronic
917084307 1:171290976-171290998 TCCATGTGCCACAAAATTAGAGG - Intergenic
917823337 1:178789365-178789387 TGTATGTGAAACAAGAGTAGAGG + Intronic
918640417 1:186833950-186833972 TGCATGTGCCAAAAAAGGAGTGG - Intronic
919176579 1:194026889-194026911 TGCATGTGCAGCAAAGGAGCAGG - Intergenic
919400083 1:197103281-197103303 TGCATGTGCAACAAAAGAAGTGG - Exonic
1063505798 10:6598401-6598423 TGGATGTGCAAAAAAAGGATTGG - Intergenic
1064239499 10:13613113-13613135 TGCATATCCTAAAAAAGAAGAGG - Intronic
1067935125 10:50604322-50604344 TACATGTGCAACCCAAGCAGAGG + Intronic
1068849456 10:61720249-61720271 TGCATCACCAACAAAGGAAGAGG + Intronic
1070395566 10:76008922-76008944 TTCATCTGCAAAAAAATAAGGGG - Intronic
1070478963 10:76862245-76862267 TGCTTGTGCAATAATTGAAGAGG + Intergenic
1070532220 10:77346960-77346982 TGCATGTGGGTCTAAAGAAGAGG + Intronic
1073591534 10:104762215-104762237 AACATGTGCCACAAAAGATGAGG - Intronic
1073936576 10:108639901-108639923 TGCATGGGCAAAGAAAGAAAAGG + Intergenic
1081297894 11:41414240-41414262 TGCATTTGAGAAAAAAGAAGAGG + Intronic
1082310701 11:50644303-50644325 TGCAGATGCTACAAAAGCAGTGG - Intergenic
1082313026 11:50677916-50677938 TGCATGTTCTACAAAAAGAGTGG - Intergenic
1082920629 11:58489082-58489104 TGCTTTTGCAACAAAGGAAATGG + Intergenic
1082942955 11:58727346-58727368 GGCATGTGAAGTAAAAGAAGAGG + Intronic
1083977751 11:66137610-66137632 TGCAGGTGGCACAAAAGAGGAGG - Intronic
1086328669 11:85731241-85731263 TTCATGTGGAACCAAAAAAGAGG + Intronic
1088043082 11:105413020-105413042 TGCTTGTTCAACAAAAGATTTGG - Intergenic
1089598073 11:119594764-119594786 TACATGGTTAACAAAAGAAGGGG + Intergenic
1091089595 11:132758287-132758309 TTCATATGGAACCAAAGAAGAGG - Intronic
1091538980 12:1441640-1441662 CGCGTGTGCACCAAAAGAATGGG + Intronic
1092923049 12:13249450-13249472 TGAATGTGCAACCCATGAAGAGG + Intergenic
1095277942 12:40311867-40311889 TACATGTCCAACAAGAGAATAGG - Intronic
1095518839 12:43037841-43037863 TGAAGGTGCAATACAAGAAGAGG - Intergenic
1099746449 12:86710209-86710231 TGAATGTGCAAAAAAAGAAGAGG - Intronic
1100927145 12:99561606-99561628 TGGATGAGCAAAAAAAAAAGTGG - Intronic
1101224805 12:102677355-102677377 TGGATGTGCAACAAATGTAGTGG - Intergenic
1106362475 13:29045297-29045319 TCCATCTGCAAACAAAGAAGAGG - Intronic
1106996003 13:35480669-35480691 TGCATTTAAAAAAAAAGAAGGGG - Intronic
1109863254 13:68227331-68227353 TGCATGTGCAACCTATAAAGGGG + Intergenic
1111004801 13:82233651-82233673 TTCATGTGGAACCAAAAAAGAGG + Intergenic
1111027095 13:82542349-82542371 TGCATGTGGAATTAAAAAAGTGG - Intergenic
1112718551 13:102215116-102215138 TGCATATGAACCAAAAGAAGAGG - Intronic
1114974978 14:28084460-28084482 TACATGGGCAAAAAAAGAACAGG - Intergenic
1116723290 14:48528294-48528316 TGCATATCCAGCAAAAGAATAGG + Intergenic
1118832723 14:69449884-69449906 TGCTTATGCAAGAAAGGAAGGGG + Intronic
1120082672 14:80233538-80233560 TGCATGTGCAAAAAAAAATATGG + Intronic
1120131783 14:80816475-80816497 TGAATGTTCTACAACAGAAGAGG + Intronic
1121999235 14:98632902-98632924 TGCATGTTCAACAACTGATGAGG + Intergenic
1123005748 14:105322775-105322797 AGAATGAGCAACAAAGGAAGTGG - Intronic
1124220001 15:27843184-27843206 TGCTTGGCCAACCAAAGAAGAGG + Intronic
1125668656 15:41453328-41453350 TGCATAAGCAAGAAAAAAAGGGG - Intronic
1126826762 15:52559118-52559140 TGAATCTGCAACATAAAAAGAGG - Intronic
1128595229 15:68939737-68939759 TGCCTGAGTAACAATAGAAGGGG + Intronic
1129100235 15:73255349-73255371 TTCATATGCAACAGAATAAGTGG + Intronic
1129528441 15:76240205-76240227 TGCATTTGGAAGAAAAGCAGGGG + Intronic
1130584877 15:85173115-85173137 TCCATGTGCATACAAAGAAGTGG + Intergenic
1131719664 15:95154119-95154141 TTCATCTGCAACAAGGGAAGAGG + Intergenic
1136857219 16:33668299-33668321 AGAAATTGCAACAAAAGAAGGGG + Intergenic
1139628831 16:68214502-68214524 TGCATGTGCTACAGAGGAGGGGG + Intronic
1140758497 16:78090118-78090140 TGCAGGAACTACAAAAGAAGAGG + Intergenic
1147655410 17:42087784-42087806 TGTATGTGCAACAAAAGGCAAGG - Intergenic
1148272547 17:46274209-46274231 TGTATGTGAAACAAAATAAATGG - Intergenic
1149007957 17:51825193-51825215 CACATGTGTAAGAAAAGAAGAGG + Intronic
1149253272 17:54794685-54794707 TGCATGTGCTAAAAAAGGAGAGG + Intergenic
1150021549 17:61620126-61620148 AGCCAGTGCAACAAAGGAAGGGG - Intergenic
1150619181 17:66796568-66796590 TGCATGACCAACACAAGCAGGGG - Intronic
1155555303 18:27011975-27011997 GGCCTGTGCACCAAAAGAGGAGG - Intronic
1155606501 18:27612299-27612321 TGCATGTGTAAAAATAAAAGGGG + Intergenic
1157583041 18:48784368-48784390 ATCATGTACAGCAAAAGAAGGGG + Intronic
1157855737 18:51103948-51103970 TGCATATGAATCAAAAGAAATGG - Intergenic
1162772874 19:12960479-12960501 ATAATGTGCAACAAAGGAAGAGG + Intergenic
1163300883 19:16445442-16445464 TGCATATGCAAAAGCAGAAGGGG + Intronic
1163988468 19:20974643-20974665 GACATGTGCAAAAAAAAAAGTGG + Intergenic
1164769095 19:30794625-30794647 TCCAGGTGCAGCAAAAGAAGCGG + Intergenic
1167234407 19:48305141-48305163 AGCATTTGGAGCAAAAGAAGAGG + Intronic
1168323460 19:55524520-55524542 TGAATGAGCACCAAAAAAAGTGG - Intergenic
925074355 2:1001773-1001795 TCCATGTGGAACTAAAAAAGAGG + Intronic
928486919 2:31741645-31741667 TGCATATGGAACCAAAAAAGAGG - Intergenic
928739172 2:34329553-34329575 TGCATGTGGAAAAAAAAAAGGGG + Intergenic
931183820 2:59930421-59930443 TGCATGTGGAGTAGAAGAAGGGG + Intergenic
931450407 2:62363424-62363446 TTCAGGTGCACCAAAAGATGAGG - Intergenic
931503215 2:62894489-62894511 TACATGAGCAAAGAAAGAAGGGG + Intronic
934055844 2:88250903-88250925 TGCATGTGCAGGAAAAGAGTAGG + Intergenic
936557123 2:113505677-113505699 TGCAAGGGAAACAAAAAAAGAGG - Intergenic
937488240 2:122338489-122338511 TGCATGTGAAATAAGAGAACTGG - Intergenic
938141122 2:128795368-128795390 GGCATGTGAAACAGAAGAAGAGG + Intergenic
939787786 2:146538334-146538356 TCCATGTGCAACAAAAGTGGAGG + Intergenic
940084627 2:149845099-149845121 TGCCTGTGCATACAAAGAAGAGG - Intergenic
941845738 2:170130569-170130591 TTCATGTGGAACCAAAGAAAGGG + Intergenic
943146765 2:184055633-184055655 TGCATTTGGAAAAGAAGAAGTGG - Intergenic
944820703 2:203427789-203427811 TACAAGTGGAAGAAAAGAAGGGG - Exonic
945524911 2:210876496-210876518 CATATGTGCAACAAAAGCAGTGG - Intergenic
946286552 2:218708092-218708114 TGCATATGCAACCCATGAAGAGG - Intergenic
946773437 2:223112759-223112781 TGCATGTTCAGCATAAGGAGGGG + Intronic
947261192 2:228224187-228224209 TGCAAATGCCACTAAAGAAGAGG - Intergenic
948170542 2:235898295-235898317 TGCAAGGGGAAAAAAAGAAGGGG - Intronic
1169717814 20:8640313-8640335 TGTATGTGAAACAGAAAAAGGGG - Intronic
1169929869 20:10820968-10820990 TTCATGTGGAACCAAAAAAGAGG + Intergenic
1170430339 20:16269939-16269961 TTCATGTTAAATAAAAGAAGGGG - Intergenic
1171241925 20:23577007-23577029 TGCATATGGAACCAAAAAAGAGG - Intergenic
1177025069 21:15912731-15912753 TGCATATGGAACCAAAAAAGAGG - Intergenic
1177215231 21:18119503-18119525 GGAATGTGCCACAAAGGAAGAGG + Intronic
1177937438 21:27367186-27367208 TCAATGTGGAACAAGAGAAGTGG - Intergenic
1180737544 22:18029181-18029203 TGCATGTGAAACAGAAGATAGGG + Intergenic
1184250137 22:43255451-43255473 TGCAAGTACGACAAAGGAAGTGG + Intronic
951406699 3:22308975-22308997 TGCTTCTGCAATAAAATAAGAGG + Intronic
951467474 3:23017807-23017829 TGGATGTGGAACAACAGAGGAGG - Intergenic
952809419 3:37387864-37387886 TGGAGGTGCAAGAACAGAAGTGG + Intronic
953586189 3:44203162-44203184 TTCCTGTGGAACCAAAGAAGTGG + Intergenic
954011043 3:47638441-47638463 TGAATTTCCCACAAAAGAAGAGG - Intronic
954343159 3:49972127-49972149 TGAAGATGCCACAAAAGAAGAGG + Exonic
956608944 3:71102341-71102363 TGCTTGTGTAACAAAAGATCGGG - Intronic
957872399 3:86106389-86106411 TGCATTTCCAAAAGAAGAAGGGG - Intergenic
958461886 3:94408302-94408324 TAAATGTGCAATAAAAGGAGAGG - Intergenic
959114212 3:102156811-102156833 TGCATGTTCAGCAAGAGAGGTGG - Intronic
959247681 3:103895832-103895854 GGCATGTGCAACAACATAGGTGG + Intergenic
960202708 3:114857043-114857065 GGAATGTGAAACAAAAGAACTGG - Intronic
960615188 3:119589976-119589998 TGCATATTGAACAACAGAAGAGG + Intergenic
961311651 3:126005823-126005845 TGCATGGGGACCAGAAGAAGGGG - Intergenic
961570051 3:127791099-127791121 GGCATTTGCACCAAAGGAAGAGG - Intronic
962048423 3:131786051-131786073 TTCATGTAAAACAAGAGAAGAGG - Intronic
962253744 3:133856218-133856240 TGCATGTGCTGACAAAGAAGTGG + Intronic
963661833 3:148136082-148136104 AGCATGTATGACAAAAGAAGAGG - Intergenic
967659142 3:192084240-192084262 TGGATGTGAAACAATACAAGTGG - Intergenic
967682211 3:192377376-192377398 TCTATGTGCCAGAAAAGAAGAGG - Intronic
967898856 3:194426185-194426207 TGCACATGCAAAAAAAAAAGAGG - Intronic
970117282 4:12711334-12711356 TAAATGTTGAACAAAAGAAGTGG + Intergenic
971935381 4:33140840-33140862 TACATGTCCATCAATAGAAGGGG + Intergenic
972159121 4:36200553-36200575 TCCATGTGCTAGAAAAGAGGAGG - Intronic
973237945 4:47926271-47926293 TGTGTGTGCATAAAAAGAAGTGG - Intronic
975879193 4:78882880-78882902 TGAATTTGCTACAAAAGATGAGG - Intronic
975990854 4:80258501-80258523 AGCATGAGCAACAAAAGACTAGG + Intergenic
976025366 4:80681563-80681585 TTCCTGGGCAACTAAAGAAGTGG - Intronic
976688525 4:87843085-87843107 TGCTTGGGCACCAGAAGAAGGGG + Intronic
976937168 4:90650513-90650535 TGCTTGTGCAATAAAAGAAAGGG + Intronic
977780866 4:100979120-100979142 AGCATGTGCAAAAGCAGAAGAGG - Intergenic
978630330 4:110736625-110736647 TCCTTGTGCCACAAAAGTAGTGG - Intergenic
981846361 4:149174796-149174818 TGCATGTGCTCCAAAAAAGGAGG + Intergenic
982173339 4:152682474-152682496 TCCATGGGCCATAAAAGAAGAGG + Intergenic
982198683 4:152938692-152938714 GGCATGTGCCACAGAAGAGGTGG - Intronic
986416580 5:7534962-7534984 GGAATGTGCAACAGAAGGAGAGG - Intronic
987744953 5:21958776-21958798 TTCATGTGGAACCAAAAAAGAGG - Intronic
987934653 5:24448615-24448637 TGCTTGTGACACAAAAGAGGGGG - Intergenic
991765162 5:69968905-69968927 TTCATGTGGAACCAAAAAAGAGG - Intergenic
991782163 5:70149248-70149270 TTCATGTGGAACCAAAAAAGAGG + Intergenic
991844394 5:70843976-70843998 TTCATGTGGAACCAAAAAAGAGG - Intergenic
991874606 5:71149563-71149585 TTCATGTGGAACCAAAAAAGAGG + Intergenic
993629268 5:90264663-90264685 TGTGTGTGCAAAAATAGAAGGGG - Intergenic
998826527 5:146107215-146107237 TACATGAGCAAGGAAAGAAGAGG + Intergenic
999195004 5:149775824-149775846 TGCATGTGGAGAAAGAGAAGGGG - Intronic
1000139949 5:158393233-158393255 AGCCTCTGCAACAAAAGAAATGG + Intergenic
1001374933 5:171247280-171247302 TGAATCTGCAACAATACAAGAGG - Intronic
1002337250 5:178488421-178488443 TTCATGTGCCACAAAGGGAGAGG - Intronic
1003263104 6:4541118-4541140 AGCATGTGCAAAAGAACAAGAGG - Intergenic
1003865711 6:10360661-10360683 TGCATCTGGAACAAATGAAAAGG + Intergenic
1004483519 6:16043760-16043782 TGCATGTGTCACAACACAAGAGG + Intergenic
1005112874 6:22303895-22303917 TGCAAGGGAAACAAAAGAAAAGG - Intergenic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1008201406 6:48595234-48595256 TGAATATGCAAGAAAAGAATAGG - Intergenic
1009486150 6:64224944-64224966 TGCCTGTGCAAGAGAAGGAGAGG - Intronic
1010771093 6:79831960-79831982 GGCAGGTGAAACAAAAGAACCGG + Intergenic
1011246020 6:85322144-85322166 TGCATGGGGAACAACAGGAGGGG - Intergenic
1011782706 6:90808229-90808251 TGGCTGTTCAACACAAGAAGTGG - Intergenic
1011876508 6:91968559-91968581 TTCATGAGTAACAAAAGAACGGG - Intergenic
1011988562 6:93482538-93482560 TTCATGTGGAACCAAAAAAGAGG + Intergenic
1012197308 6:96359595-96359617 TATATCTGCAACAAAAGAAATGG - Intergenic
1013038965 6:106415001-106415023 TTTATGTGAAAAAAAAGAAGAGG - Intergenic
1014108536 6:117594187-117594209 GGTATGTGTAACAAGAGAAGAGG - Intronic
1015567258 6:134586318-134586340 AGCAAGTGCTACAAAAGAATTGG - Intergenic
1017016314 6:150103065-150103087 TGCATGTGAACCAAAAGCACAGG + Intergenic
1017567743 6:155706527-155706549 CCCATGTGGAACAAAGGAAGAGG + Intergenic
1020711851 7:11616350-11616372 TGTATGTCCAACACAGGAAGAGG - Intronic
1021431732 7:20567532-20567554 TCCAGGTGGAATAAAAGAAGTGG + Intergenic
1022459499 7:30591796-30591818 TGGATGTTTCACAAAAGAAGAGG + Intergenic
1025036151 7:55593596-55593618 TGCATGTGTAGCACAGGAAGGGG + Intergenic
1026151499 7:67791530-67791552 TTCATGTGCAACAAAAGTCTTGG - Intergenic
1028715236 7:93957916-93957938 TGAATGTGAAACAGAAGATGGGG + Intergenic
1030846092 7:114413758-114413780 TAAATGTGCAACAAAAGTAGTGG + Intronic
1030977562 7:116145461-116145483 TGTGTGTGCACCAAAGGAAGTGG - Intronic
1033034766 7:137863888-137863910 TGCATGTGCAAAAAAAAATTAGG - Intergenic
1033296264 7:140139604-140139626 TGCATCTGCTAGAAAAAAAGAGG + Intronic
1037396662 8:18450840-18450862 TTCTTGTGAAACAAAGGAAGAGG + Intergenic
1038065676 8:23961485-23961507 TGCATTTACATAAAAAGAAGAGG - Intergenic
1039320580 8:36425982-36426004 TGCATATATCACAAAAGAAGTGG - Intergenic
1040063590 8:43125997-43126019 TTCAAGAGCAACAAAAGAGGTGG - Intergenic
1041334048 8:56759762-56759784 TGCTTTTGGAACAAAAGAGGAGG - Intergenic
1042354392 8:67810269-67810291 TGCACTTGCAACAAAAGTATGGG - Intergenic
1047871478 8:129087509-129087531 TGCATGTGCAAGAACAAAATTGG - Intergenic
1049895874 9:111624-111646 TGCAAGGGAAACAAAAAAAGAGG + Intergenic
1052520353 9:29539557-29539579 TACATATGCCAGAAAAGAAGGGG - Intergenic
1053162500 9:35823204-35823226 TGCATGAGCAGAAAAAAAAGGGG - Intronic
1053739055 9:41121807-41121829 TGCAAGGGAAACAAAAAAAGAGG + Intergenic
1054689295 9:68309515-68309537 TGCAAGGGAAACAAAAAAAGAGG - Intergenic
1054938431 9:70713905-70713927 CGAATGTGCAACCAAAGATGCGG + Intronic
1054940122 9:70731898-70731920 CGAATGTGCAACCAAAGATGCGG + Intronic
1055234521 9:74104467-74104489 AGCAATTGCAACAAAAGTAGAGG + Intergenic
1057839018 9:98470100-98470122 GGCAAGTGCAACAAAGGAACAGG + Intronic
1058602617 9:106686794-106686816 GGTAAGTGCAACAAAAGAAGGGG + Intergenic
1059007164 9:110415784-110415806 TCCATGTGCCAGAAATGAAGAGG + Intronic
1059823211 9:117997171-117997193 TGAATGTGAAGAAAAAGAAGAGG - Intergenic
1060137265 9:121169528-121169550 TGCATCTGCCACAAGGGAAGGGG + Intronic
1061344010 9:130007365-130007387 TGGATGTGCAACAAATGGAAGGG + Intronic
1186795005 X:13038474-13038496 TTCAAGAGCAACAAAAGAGGTGG - Exonic
1188356886 X:29202812-29202834 TACATGTGGAAAGAAAGAAGGGG + Intronic
1188996710 X:36895496-36895518 AGCATGTTCAACTAAATAAGAGG - Intergenic
1190944574 X:55079136-55079158 TGCATGTGCTAAAAACGAGGAGG - Intergenic
1190945817 X:55093069-55093091 TGCATGTGCTAAAAACGAGGAGG - Intronic
1190964369 X:55284450-55284472 TGCATGTGCTAAAAACGAGGAGG - Intronic
1192159479 X:68772795-68772817 CGTATGTGTAACAAAAGAAGTGG + Intergenic
1194110787 X:89831716-89831738 TCCATTTGCAACAAAATGAGTGG + Intergenic
1194137926 X:90170714-90170736 TCCATGAGCAACAAATGAAGTGG - Intergenic
1195862832 X:109399825-109399847 AGCATGTGCAAAAGAACAAGAGG + Intronic
1196097546 X:111816156-111816178 TGCATGGGTAACAATAAAAGTGG + Intronic
1197694271 X:129534016-129534038 TGCAGGTGTCACAAAGGAAGGGG - Intergenic
1198371597 X:135994722-135994744 TGCGTGGGGTACAAAAGAAGTGG + Intronic
1200463449 Y:3486454-3486476 TCCATTTGCAACAAAATGAGTGG + Intergenic
1200483719 Y:3740971-3740993 TCCATGAGCAACAAATGAAGTGG - Intergenic