ID: 919400116

View in Genome Browser
Species Human (GRCh38)
Location 1:197103728-197103750
Sequence CTTTTAGAGGCTATAATAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 0, 2: 10, 3: 104, 4: 705}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919400116_919400118 24 Left 919400116 1:197103728-197103750 CCTTTTATTATAGCCTCTAAAAG 0: 1
1: 0
2: 10
3: 104
4: 705
Right 919400118 1:197103775-197103797 TAGATTGTTGTTTGATTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919400116 Original CRISPR CTTTTAGAGGCTATAATAAA AGG (reversed) Exonic
900220512 1:1506620-1506642 CTTTCAGATGCTATTGTAAATGG + Intergenic
902265941 1:15264383-15264405 CTTTTTGATGCTATTGTAAATGG + Intronic
902563325 1:17292595-17292617 CTTTTTGATGCTCTTATAAATGG - Intergenic
903520735 1:23946504-23946526 CTTTTTGATGCTATTATAAATGG + Intergenic
904099139 1:28007688-28007710 CTTTTTGATGCTATCACAAAAGG - Intronic
905076757 1:35278749-35278771 CTTTTTGAGGTTATAATATTTGG - Intronic
905260034 1:36710622-36710644 CTTTGAGAGGTTAAAAAAAAGGG - Intergenic
905545505 1:38795819-38795841 CTTTTTTATGCTATTATAAATGG - Intergenic
905711933 1:40112393-40112415 CTTTTTGTGGCTATTATAAATGG - Intergenic
905712171 1:40114939-40114961 CTTTTTGATGCTATTGTAAATGG - Intergenic
906362866 1:45179054-45179076 CTTTTTCATGCTATCATAAATGG - Intronic
906815335 1:48873016-48873038 CTTTAAGAGGCCATAGTAAAGGG - Intronic
906995083 1:50784436-50784458 CTTTTTGAAGCTATTGTAAATGG - Intronic
907083447 1:51646363-51646385 CCTTTTGATGCTATTATAAATGG + Intronic
907147642 1:52250365-52250387 CTTTTTGATGCTATTGTAAATGG + Intronic
908011547 1:59783211-59783233 ATTTTTGAATCTATAATAAATGG + Intergenic
908635982 1:66165633-66165655 CTTTTTGATGCTATTATAAAGGG - Intronic
909064160 1:70913244-70913266 ATTTTTGATGCTATTATAAATGG + Intronic
909382555 1:75016288-75016310 CTTTTTGTGGCAATTATAAATGG - Intergenic
910457002 1:87408478-87408500 TTTCAAGAGGCTAGAATAAAGGG - Intergenic
910513428 1:88032606-88032628 CTTTTTGATGGTATTATAAATGG - Intergenic
910545100 1:88406969-88406991 CTTTTGGAGGCTTTTACAAATGG + Intergenic
910545987 1:88419888-88419910 ATTTTTGATGCTATCATAAACGG - Intergenic
910708230 1:90152546-90152568 TTTTTTGAAGCTATTATAAAAGG + Intergenic
910750967 1:90630072-90630094 CTTTTTGATGCTATTGTAAATGG - Intergenic
911325090 1:96461995-96462017 CTTTTATAAGTTATAAGAAAGGG + Intergenic
911343497 1:96668784-96668806 ATTTTAGTGGCTATTGTAAATGG + Intergenic
912342127 1:108927047-108927069 CTTTTTGATGCTATTTTAAATGG - Intronic
912689398 1:111793106-111793128 CTTTGAGAGGCCAAAATAGAAGG - Intronic
913041632 1:115031893-115031915 CTTTTAAAGGTTAAAATAACAGG - Intronic
913510357 1:119555605-119555627 AGTTTAGAGTCTATAGTAAATGG - Intergenic
913514171 1:119588719-119588741 AGTTTAGAGTCTATAGTAAATGG - Intergenic
914510388 1:148327503-148327525 CTTTTAAAGACTGTAATTAATGG + Intergenic
915695470 1:157737298-157737320 CTTTTTGTGGCTATTGTAAATGG + Intergenic
916323064 1:163527011-163527033 ATTTTTGTGGCTATTATAAATGG + Intergenic
916393129 1:164354660-164354682 CTTTTTGATGCTATTGTAAATGG - Intergenic
916397674 1:164409664-164409686 TTTTTTGATGCTATAATAAATGG + Intergenic
916559595 1:165922330-165922352 CTTTTAAAGACCAAAATAAATGG - Intergenic
916718424 1:167464029-167464051 CTTTTTGAGGCTGTCATTAAAGG - Intronic
917069283 1:171131932-171131954 CTTTTTGATGCTATTGTAAATGG - Intergenic
917107522 1:171507896-171507918 CTTTTTGATGCTCTAGTAAATGG + Intronic
917195296 1:172457798-172457820 CTTTTAGAAGCTTCAATAAATGG - Intronic
917260898 1:173167224-173167246 TTTTTTGATGCTATTATAAATGG + Intergenic
917832696 1:178910011-178910033 CTTTTTGTGGCTATTGTAAATGG + Intronic
917833944 1:178925435-178925457 CTTTTTGATGCTTTAGTAAATGG - Intergenic
917917459 1:179717430-179717452 CTTTTTGATGCTATAATAAACGG + Intergenic
917996281 1:180441625-180441647 CTTTTAAAGGCTATTGTAAATGG + Intronic
918249805 1:182692364-182692386 CTTTTTGTGGCTATTGTAAATGG - Intergenic
919187969 1:194179322-194179344 CTTTTTGATGCTATTGTAAATGG - Intergenic
919400116 1:197103728-197103750 CTTTTAGAGGCTATAATAAAAGG - Exonic
919704961 1:200667625-200667647 TTTTTTGATGCTATAATAGAAGG - Intronic
919927301 1:202198943-202198965 CTTTTAGAATCTATTAGAAAGGG - Intronic
920880244 1:209873183-209873205 TATTTAGAGGCTAGAATAACAGG + Intergenic
923136107 1:231120902-231120924 CTTTTGGGGGCTAGAGTAAAAGG - Intergenic
923138920 1:231143640-231143662 ATTTTTGATGCTATAGTAAATGG - Intergenic
923646427 1:235825573-235825595 CTTTTTGATGCTATTATAAATGG - Intronic
923833479 1:237583752-237583774 CTGTTTGGGGCTACAATAAAAGG - Intronic
924070215 1:240269787-240269809 TTTTTTGATGCTATTATAAATGG + Intronic
924175283 1:241385285-241385307 CTTTCAGAGATTAGAATAAAAGG + Intergenic
1062849617 10:733678-733700 GTTTTTGTGGCTATTATAAATGG - Intergenic
1065273254 10:24058636-24058658 CTTTTGGATGCTATTGTAAATGG + Intronic
1065543574 10:26795641-26795663 TTTTTGGATGCTATCATAAATGG - Intronic
1066605267 10:37160160-37160182 CTTTTAGTGGCTAGAAAAGACGG - Intronic
1066607533 10:37194806-37194828 CTTTTAGTGGCTAGAAAAGACGG - Intronic
1067000751 10:42610563-42610585 CTTTTTGATGCTATTGTAAATGG - Intronic
1067136526 10:43613091-43613113 TTTTTAAAGGCTTTAAGAAAAGG - Intronic
1067383896 10:45800831-45800853 CCTTTAAATGCTATTATAAATGG - Intergenic
1067422484 10:46166624-46166646 CTTTTAGATACTATCATAAATGG + Intergenic
1067841606 10:49684602-49684624 CTTTTAGATACTACTATAAATGG + Intronic
1067880299 10:50037942-50037964 CCTTTAAATGCTATTATAAATGG + Intergenic
1067891591 10:50141405-50141427 CCTTTAAATGCTATTATAAATGG - Intergenic
1068347797 10:55806305-55806327 CTTTTAGATACTATCATAAATGG - Intergenic
1068619880 10:59170364-59170386 CTTTTTGATGCTATTGTAAATGG + Intergenic
1069535755 10:69251726-69251748 CTTTTTGATGCTATTATAAATGG + Intronic
1069541972 10:69301611-69301633 CTTTTTGATGCTATTATACATGG - Intronic
1069852064 10:71413907-71413929 CTTTTTGATGCTATTGTAAATGG + Intronic
1070377415 10:75846759-75846781 CTTTTTGATGCTATTATAAATGG - Intronic
1070460018 10:76656477-76656499 CTTTTTGTGGCTATTGTAAATGG - Intergenic
1070646848 10:78207776-78207798 TTTGTAGAGTCTATTATAAAGGG - Intergenic
1070859949 10:79646380-79646402 CTTTTAGATACTATCATAAATGG + Intergenic
1070937389 10:80311100-80311122 CTTTTCGATGCTATTATAAATGG - Intergenic
1071799761 10:89045675-89045697 CTTTTTAAGGCTATAGTAAGTGG + Intergenic
1073365084 10:102933371-102933393 TTTTTTGATGCTATTATAAATGG + Intronic
1074013828 10:109512127-109512149 CTTTTTGTGGCAATTATAAATGG + Intergenic
1074474820 10:113761526-113761548 CTTTTGGATGCTATTGTAAATGG + Intronic
1074805906 10:117052169-117052191 CCTTTTGATGCTATTATAAAAGG - Intronic
1074955973 10:118389976-118389998 CTTTTAGATGCTATCGTAAATGG + Intergenic
1075154728 10:119965602-119965624 GTTTTAGAGGACTTAATAAATGG + Intergenic
1075283791 10:121165229-121165251 CTTTCAGATGCTATTATAAGTGG - Intergenic
1076760361 10:132602197-132602219 CTTTTCGATGCTGTTATAAATGG + Intronic
1076770591 10:132661426-132661448 ATTTTTGATGCTATTATAAATGG - Intronic
1077421934 11:2455459-2455481 CTTTTTGTGTCTATTATAAATGG - Intronic
1077448607 11:2618924-2618946 TTTTTTGATGCTATCATAAATGG + Intronic
1077731328 11:4733422-4733444 CTTTTTGATGCTATTGTAAATGG + Intronic
1077955038 11:7008826-7008848 CTTTTTGTGGCTATTGTAAATGG - Intronic
1078195002 11:9129437-9129459 CATTTTGATGCTATGATAAATGG + Intronic
1078960938 11:16269722-16269744 CAATTAGAGGATATAATTAATGG - Intronic
1079119299 11:17670032-17670054 ATTTTTGATGCTATTATAAATGG + Intergenic
1080751029 11:35150514-35150536 GTGTCAGAGGCTATAATATAAGG + Intronic
1080841689 11:35989653-35989675 TTTTTTGTGGCTATTATAAATGG + Intronic
1080951498 11:37038763-37038785 CTTATAGAGACTTTAATGAAAGG - Intergenic
1080961447 11:37165563-37165585 CTTTTAAAGGATGCAATAAAAGG + Intergenic
1081035466 11:38138962-38138984 CTTTTTGAGGCTATTATAAGTGG - Intergenic
1081035858 11:38145430-38145452 ATTTTTGTGGCTATTATAAATGG + Intergenic
1081242731 11:40726997-40727019 CTTTTTGTGGCTATTGTAAATGG - Intronic
1081791094 11:45785832-45785854 CTTTTTGATGCTATTGTAAATGG + Intergenic
1082635940 11:55593828-55593850 ATTTTTGATGCTATACTAAATGG + Intergenic
1082702922 11:56455734-56455756 CTTTTGGTGGCTATTGTAAATGG + Intergenic
1082703101 11:56458235-56458257 TTTTTAGTGGCTATTGTAAATGG - Intergenic
1083015943 11:59454205-59454227 CTTGTAGACACTCTAATAAAAGG + Intergenic
1083568159 11:63738204-63738226 CTTTTTGAGGTTATAAAACATGG + Intronic
1084071033 11:66735017-66735039 ATTTTAAAGGGTCTAATAAAGGG - Intergenic
1084886688 11:72214092-72214114 CTTTTTGATGCTATTATGAATGG - Intergenic
1085766151 11:79283945-79283967 CTTTTTGATGCTATTATAAATGG - Intronic
1086076085 11:82854395-82854417 CTTTTTGTGGCTATTGTAAATGG - Intronic
1086285228 11:85241143-85241165 TTTTTTGATGCTATAATAAATGG + Intronic
1086646315 11:89225724-89225746 GTTTCAGAGGATATAATAAAAGG - Intronic
1086733588 11:90279235-90279257 CTTTTTGATGCTATTGTAAATGG + Intergenic
1086797354 11:91123844-91123866 ATTTTTGATGCTATTATAAATGG + Intergenic
1086877698 11:92116736-92116758 ATTTTTGAGGCTATCATAAAAGG - Intergenic
1087310138 11:96531985-96532007 CTTTTAGTGGCAATTATGAATGG - Intergenic
1087378446 11:97373492-97373514 CTTTTTGATGCTATTTTAAATGG - Intergenic
1087578420 11:100020812-100020834 CTTTTTGATGCTATTGTAAATGG - Intronic
1087634674 11:100688507-100688529 CTGTTATAGTCTATAATATAGGG + Intronic
1087690862 11:101319290-101319312 GTACAAGAGGCTATAATAAACGG - Intergenic
1088296258 11:108298927-108298949 CTTTTAGATGCTATCGTAAATGG - Intronic
1089371774 11:117965501-117965523 TTTTTTGATGCTATTATAAATGG - Intergenic
1090310007 11:125728004-125728026 CCTTTAGTGGCTCTAGTAAAGGG + Intergenic
1090515334 11:127419274-127419296 CTTTTTGTGGCTATTGTAAATGG + Intergenic
1090722245 11:129486544-129486566 TTTTTGGATGCTATTATAAATGG + Intergenic
1090789575 11:130079509-130079531 CTTTTTTATGCTATTATAAATGG + Intronic
1092579657 12:9824860-9824882 GTTTTTGTGGCTATCATAAATGG - Intergenic
1092605564 12:10114757-10114779 CTTTTAGAGACTATATTCTACGG + Intergenic
1092674803 12:10903915-10903937 TTTTTTGAGGCTATTGTAAATGG - Intronic
1093586955 12:20849805-20849827 TTTTGAGATGCTATGATAAATGG - Intronic
1093738552 12:22653601-22653623 CTTTTCGATGCTATCGTAAATGG + Intronic
1093796458 12:23318926-23318948 CTTTTTGATGCTATTATAAATGG - Intergenic
1093917961 12:24826886-24826908 CTTTTTGTGGCTATTATAAATGG + Intronic
1094311599 12:29090043-29090065 CTTTTTGATGCTATTGTAAATGG - Intergenic
1094457029 12:30646714-30646736 CTTTTTGACGCTATTGTAAATGG - Intronic
1095543914 12:43343225-43343247 CTTGAAGAGGCTCTAATCAAAGG - Intergenic
1095646118 12:44549658-44549680 CTTTTTGATGCTATTGTAAATGG - Intronic
1095765939 12:45895840-45895862 CTTTTTGATGCTATTGTAAATGG - Intronic
1095881639 12:47143474-47143496 ATTTTTGATGCTATTATAAATGG - Intronic
1096293973 12:50367833-50367855 ATTTTTGATGCTATTATAAATGG - Intronic
1096325065 12:50652864-50652886 CTTTTTGATGTTATTATAAATGG + Intronic
1097374625 12:58826708-58826730 CTTTTTGTGGCTATTACAAATGG - Intergenic
1098055859 12:66504315-66504337 CTTGTAGAGGGTGTAAAAAATGG + Intronic
1098125253 12:67285114-67285136 CTTTCTGTTGCTATAATAAATGG - Intronic
1098658319 12:73060841-73060863 CCTTTAGATGCTATTGTAAAAGG + Intergenic
1098870075 12:75807540-75807562 CTTTTGGATGCTATTGTAAATGG + Intergenic
1098962956 12:76758154-76758176 CTTTTTGATGCTACTATAAATGG - Intergenic
1099254125 12:80294841-80294863 CTTTGGGAGGCTAAAATGAATGG + Intronic
1099363391 12:81736298-81736320 ATTTTAGATGCTATTATAGATGG + Intronic
1099572706 12:84345041-84345063 CTTTTAGCAGCTATTGTAAATGG + Intergenic
1099598576 12:84701516-84701538 CTTATTGAGGCTATAGCAAAAGG - Intergenic
1099696800 12:86033508-86033530 CTTTTTGTGGCTATTGTAAATGG + Intronic
1100413722 12:94349898-94349920 CTTTTTGATGCTATTGTAAATGG - Intronic
1100684191 12:96968054-96968076 CTTTTAAAGTCTAATATAAATGG + Intergenic
1101121814 12:101589465-101589487 CTCTTGGATGCTATAGTAAATGG - Intronic
1101763010 12:107674544-107674566 CTTTTTGAGGCTATATCATAAGG + Intergenic
1101945874 12:109136588-109136610 CTTTTGAATGCTATTATAAATGG + Intronic
1102739027 12:115189703-115189725 CTTTTAAAGGCCAAAAGAAAAGG - Intergenic
1103584827 12:121944629-121944651 TTTTTTGATGCTATTATAAATGG + Intronic
1103729198 12:123014930-123014952 CTTTCAGAGGCTATTATAAATGG - Intronic
1104740793 12:131171789-131171811 CCTTTAGATGCTATTATGAATGG - Intergenic
1104800292 12:131550648-131550670 CTTTTTGATGCTATTATAAATGG + Intergenic
1104832520 12:131763440-131763462 CTTTCAGATGCTGTGATAAATGG - Intronic
1105637948 13:22234032-22234054 CTCTTTGTGGCTATAATAAACGG - Intergenic
1106299064 13:28446542-28446564 CTTTTTGATGCTGTTATAAATGG - Intronic
1106333186 13:28758719-28758741 CTTTTTGATGCTATTGTAAATGG + Intergenic
1107334180 13:39335740-39335762 CATTTAAAGGCCATAGTAAAAGG + Intergenic
1107740909 13:43449439-43449461 CTTTTTAAGGTAATAATAAATGG + Intronic
1108191321 13:47942126-47942148 CCTTTAGAGGATATACTAGATGG + Intronic
1108260681 13:48652641-48652663 CATTTTGATGCTATTATAAATGG + Intergenic
1108426333 13:50305576-50305598 CTTTTTGTGGCTATTGTAAATGG + Intronic
1109571176 13:64192220-64192242 CTTTTAAAGGCTGTAATTATAGG - Intergenic
1109732956 13:66439868-66439890 CTGTTAGAGGAGTTAATAAAGGG + Intronic
1111010573 13:82308718-82308740 CTTTTTGTAGCTATTATAAAAGG + Intergenic
1111166735 13:84467619-84467641 CTTTTCGATGCTATTGTAAATGG - Intergenic
1111708981 13:91786954-91786976 TTTTTTGAGGCTATTGTAAATGG + Intronic
1112049007 13:95626763-95626785 CTTTGGGATGCTATTATAAATGG - Intronic
1112564249 13:100538968-100538990 CTTTTTGATGCTATCATAAATGG + Intronic
1112670972 13:101638112-101638134 TTTTGAGAGGCTCTAATGAAAGG + Intronic
1113227284 13:108173165-108173187 CTTTTTGTGGCTATCATAAATGG - Intergenic
1113270265 13:108665832-108665854 CTTATAGTGGTTATAATAATAGG + Intronic
1113363984 13:109659152-109659174 GTTTTTGATGCTATCATAAATGG - Intergenic
1114180223 14:20360394-20360416 CTTTCTGACGCTATTATAAATGG - Intergenic
1114593178 14:23887973-23887995 GTTTTCGATGCTATTATAAATGG - Intergenic
1115419575 14:33178571-33178593 CTTTTAGATGCTGTTATAAATGG + Intronic
1115657142 14:35454242-35454264 TTTTTTGATGCTATCATAAATGG + Intergenic
1116004012 14:39272897-39272919 CTTTTTGATGCTATTATAGATGG + Intronic
1116382164 14:44283496-44283518 ATTTTAGAACATATAATAAATGG - Intergenic
1116528174 14:45933505-45933527 CTTTTTGTGGCTATTGTAAATGG + Intergenic
1117477615 14:56112659-56112681 CTTTTTGATGCTATTGTAAATGG - Intergenic
1118313849 14:64712567-64712589 CTTTTTGCTGCTATTATAAATGG + Intronic
1118491137 14:66261689-66261711 CTTTTTGGTGCTATCATAAATGG + Intergenic
1118648453 14:67864599-67864621 ATTTAAGAGTCTTTAATAAATGG - Intronic
1119089598 14:71769108-71769130 CTTTTTGATGCTATGATAAATGG - Intergenic
1119106122 14:71925904-71925926 CTTTTTGATGCTATCATAAATGG - Intergenic
1119367771 14:74109700-74109722 CTTTTTGATGCTATTATAAATGG + Intronic
1119493352 14:75057243-75057265 CTTTTTGATGCTATTATAAATGG - Intronic
1120329805 14:83077585-83077607 TTTTTAGTGGCTGTTATAAATGG + Intergenic
1120584163 14:86290405-86290427 CTCCTAGAGGCTACAGTAAAAGG - Intergenic
1121074204 14:91053583-91053605 TTTTTTGATGCTATAGTAAAAGG - Intronic
1121313334 14:92946835-92946857 GTTTTAGAGGCTAAAAAATATGG - Intronic
1121316844 14:92966352-92966374 CTTTTTGATGCTTTTATAAATGG - Intronic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1124123801 15:26916820-26916842 CTTTTTGATGCTATAATAAGTGG + Intronic
1124178147 15:27446631-27446653 CTTTTTGAGGCTATTGTAACTGG + Intronic
1124219155 15:27834404-27834426 ATTTTAAAGGGTATTATAAAGGG - Intronic
1124237094 15:27999859-27999881 CTTTTTGATGCTATTATAGATGG - Intronic
1124243159 15:28048011-28048033 CTTTTGGATGCTATTGTAAATGG - Intronic
1124378707 15:29146051-29146073 CTTCTTGATGCTATCATAAATGG - Intronic
1125141349 15:36411399-36411421 CTTTTAGTGGCTGAGATAAAAGG - Intergenic
1125890611 15:43263115-43263137 CTTTTTGATGCTGTTATAAATGG - Intronic
1126200919 15:45985047-45985069 CTTTTTGATGCTATTGTAAATGG + Intergenic
1126728198 15:51654656-51654678 TTTTAAGAGACTTTAATAAATGG - Intergenic
1126871312 15:52991316-52991338 CTTTTTGTGGCAATTATAAATGG + Intergenic
1127116082 15:55728985-55729007 CTTTTAGATGCTATTGTAAATGG - Intronic
1127929734 15:63585454-63585476 CTTTTTGATGCTACTATAAATGG + Intronic
1128035916 15:64526197-64526219 CTTTTAGATGTTATTTTAAATGG + Intronic
1128070763 15:64795381-64795403 CTTTTTGATGCTATTGTAAATGG + Intergenic
1128627135 15:69221486-69221508 CTTTTTGATGCTATAATAAATGG + Intronic
1128696506 15:69768113-69768135 CTTTTTGATGCTATTGTAAATGG + Intergenic
1128837507 15:70822221-70822243 CTTTTTGGAGCTATTATAAATGG + Intergenic
1129012546 15:72435528-72435550 CTTTTTGATGCTATTGTAAATGG + Intergenic
1129492322 15:75940234-75940256 CTTTTTGACGCTATGGTAAATGG - Exonic
1131404993 15:92157104-92157126 CTATTAGAGGGAATATTAAAAGG - Intronic
1134088668 16:11376917-11376939 CTTTTTGATGCTATTGTAAATGG + Intronic
1134121898 16:11589982-11590004 CCTTTTGAGGCTATTGTAAATGG - Intronic
1134437431 16:14274057-14274079 ATTTTTGATGCTATTATAAATGG - Intergenic
1136013241 16:27378436-27378458 ATTTTAGGGGCCATAAAAAATGG + Intergenic
1136717375 16:32291959-32291981 CTTTTTTTGGCTATTATAAATGG + Intergenic
1136835750 16:33498213-33498235 CTTTTTTTGGCTATTATAAATGG + Intergenic
1136994037 16:35175756-35175778 CTTTTTGAAGTTTTAATAAATGG - Intergenic
1137261987 16:46838484-46838506 CTTTTTGATGATATTATAAATGG - Intergenic
1137293068 16:47065452-47065474 CTTCTAGAGGCATTAAAAAAGGG - Intergenic
1137358462 16:47790107-47790129 TTTTTTGATGCTATCATAAATGG + Intergenic
1137880585 16:52042777-52042799 CTTTTTGATGCTATCATAAATGG + Intronic
1138485262 16:57337863-57337885 CTTTTTGATGCTATTGTAAATGG + Intergenic
1138557047 16:57777092-57777114 CTTTTTGATGCTATTGTAAATGG - Intronic
1139140152 16:64252372-64252394 CTTTTTGACTCTATTATAAATGG + Intergenic
1139333085 16:66209313-66209335 CTTTGAGAGGCTATACTGAGAGG + Intergenic
1139609477 16:68045101-68045123 CTTTTAGATGTTATTACAAATGG + Intronic
1140654774 16:77128655-77128677 CTTTTTGATGCTATTGTAAATGG - Intergenic
1140858722 16:79000772-79000794 CTTTTAGAGGGTATATTATAGGG - Intronic
1141239880 16:82255836-82255858 CTTCAAGAGGCTACAATAGATGG - Intergenic
1142055381 16:87991642-87991664 CTTACAGATGCTATCATAAATGG + Intronic
1203009054 16_KI270728v1_random:225815-225837 CTTTTTTTGGCTATTATAAATGG - Intergenic
1203145928 16_KI270728v1_random:1798550-1798572 CTTTTTTTGGCTATTATAAATGG + Intergenic
1143738571 17:8934315-8934337 CTTTTTGATGCTATTATGAATGG - Intronic
1143936173 17:10486076-10486098 TTTTTAGATGCTATTGTAAATGG + Intergenic
1144037832 17:11383245-11383267 CCTCTAGAGCCTATAAAAAAGGG - Intronic
1144449786 17:15367070-15367092 CTTTTGGATGCTATCATAAATGG - Intergenic
1144799808 17:17918099-17918121 TTTTTAGAGGCTAGTGTAAATGG + Intronic
1146099160 17:29962429-29962451 CTTTTAGCTGCTTTTATAAATGG + Intronic
1149273391 17:55007872-55007894 TTTTTACAGTCTAGAATAAATGG + Intronic
1150203198 17:63378130-63378152 TTCTTAGAGGCCATAACAAATGG + Intronic
1150480924 17:65509896-65509918 TTTTTAGATGTTATTATAAATGG - Intergenic
1153127010 18:1805646-1805668 CTTTTAGTGGCTATTGTAAACGG + Intergenic
1153540900 18:6153463-6153485 CTTTTTGATGCTATTGTAAATGG + Intronic
1153916086 18:9746153-9746175 CTTCTAAATGCTATTATAAATGG - Intronic
1154026465 18:10711852-10711874 CTTTTAAATTCTAAAATAAAAGG - Intronic
1154282813 18:13021853-13021875 CTTTTAGATGCTATTGTAAATGG + Intronic
1154413695 18:14160213-14160235 CTTTTTGATGCTATCATAAGTGG - Intergenic
1154982230 18:21512423-21512445 CTTTTTGATGCTATTGTAAATGG + Intronic
1155465988 18:26135674-26135696 GTTTTAGAGCCTAAAATAAAGGG + Intronic
1155583191 18:27335500-27335522 CTTTTTGTAGCTATTATAAATGG + Intergenic
1155630948 18:27891534-27891556 CGTTTTGATGCTATCATAAATGG + Intergenic
1155886500 18:31215227-31215249 CTCTTTGATGCTATCATAAATGG - Intergenic
1156255701 18:35394329-35394351 ATTTTTGAGGCTATTGTAAATGG + Intergenic
1156288913 18:35727765-35727787 CTTTTTGTTGCTATTATAAATGG - Intergenic
1156293333 18:35769226-35769248 TTTTTTGATGCTATCATAAATGG + Intergenic
1156363643 18:36406147-36406169 CTTTTAGAGGCAATGAGAAATGG + Intronic
1156434292 18:37110086-37110108 TTTTTCGAGGCTCCAATAAATGG + Intronic
1156574718 18:38301921-38301943 ATTTTAGAGTCTATAAAATATGG + Intergenic
1156738174 18:40289613-40289635 CTTTTTGATGCTATCATAAATGG - Intergenic
1156891756 18:42198408-42198430 CATTTATAGGCTATAATTGAGGG - Intergenic
1158052469 18:53239856-53239878 CTTTTACATGCTAAGATAAAAGG - Intronic
1158119346 18:54030886-54030908 CTCACAGAGGGTATAATAAAAGG - Intergenic
1158844362 18:61425964-61425986 CTTTTTGATGCTATTACAAATGG + Intronic
1158928049 18:62290601-62290623 GCTTTACAGGCTAGAATAAAGGG + Intronic
1159201025 18:65184240-65184262 GTATTAGAGGTTATAATAAACGG + Intergenic
1159278664 18:66254551-66254573 TTTCTAATGGCTATAATAAATGG + Intergenic
1159427366 18:68307321-68307343 TTTTTTAAGGCTATAATAAAGGG - Intergenic
1160547667 18:79671572-79671594 CTTTTTGGTGCTATTATAAACGG + Intergenic
1160589285 18:79933628-79933650 CTTTTTGATGCTATTGTAAATGG - Intronic
1164946590 19:32299002-32299024 CTTTTTGATGCTGTCATAAAAGG + Intergenic
1165100019 19:33433619-33433641 CTATTAGAAGCAATTATAAAAGG - Intronic
1165254801 19:34569589-34569611 CTTTTAGAATCTATAAAAACTGG - Intergenic
1165475419 19:36027354-36027376 CTTTTAGAGCCTCTAATGCAGGG + Intronic
1165548634 19:36563534-36563556 CTTTTAGTGGCAATTGTAAATGG - Intronic
1167398443 19:49247548-49247570 ATTTTTGAGGCTATTGTAAATGG + Intergenic
924997001 2:370731-370753 CTTTTTGAGGCTATCATAAATGG + Intergenic
925206285 2:2009449-2009471 TTTTTTGATGCTATCATAAATGG + Intronic
925321920 2:2977327-2977349 CTTTTTGATGCTATTATGAATGG - Intergenic
925830694 2:7891808-7891830 ATTTTAGTTGCTATTATAAATGG + Intergenic
927494901 2:23545778-23545800 CCTTCAGGGGCTAGAATAAAAGG - Intronic
927544051 2:23937641-23937663 CTTTTTGATGCTATTGTAAAAGG - Intronic
927839144 2:26427013-26427035 CTTTTTGGTGCTATAGTAAATGG + Intronic
928059141 2:28092465-28092487 CTTTTTGATGCTATTTTAAATGG - Intronic
928814783 2:35279831-35279853 CTTTTAGTGGTTATTATGAATGG + Intergenic
929217611 2:39432488-39432510 CTATTAGAGTCTATCCTAAATGG + Intronic
930303489 2:49647668-49647690 TTTTTTGTGGCTATTATAAATGG + Intergenic
930524745 2:52514063-52514085 CTTTTTGATACTATTATAAATGG - Intergenic
930593772 2:53360572-53360594 ATTTTTGATGCTATTATAAATGG + Intergenic
931045483 2:58347196-58347218 TTTTTTGTGGCTATCATAAATGG - Intergenic
931479651 2:62628328-62628350 CTTTTTGATGCTATTATAAATGG + Intergenic
931941254 2:67254354-67254376 CTTTGAGAGGTTATAATATAAGG - Intergenic
932069425 2:68602881-68602903 CTTTTTGATGCTATTGTAAATGG - Intronic
932382197 2:71294905-71294927 CTTTTTGATGCTATTACAAATGG + Intronic
932915873 2:75857136-75857158 CATTCAGAGGCTAAAGTAAAAGG + Intergenic
934911408 2:98258585-98258607 CTTTTGGGTGCTATTATAAATGG + Intronic
934996824 2:98970160-98970182 CCTTTACAAGCTATTATAAATGG + Intergenic
935241763 2:101184852-101184874 ATTTTAGATGCTATCCTAAATGG + Intronic
935382754 2:102469173-102469195 TTTTTTGATGCTATTATAAATGG + Intergenic
935752616 2:106250761-106250783 TTTTTAGATGCTATTGTAAATGG + Intergenic
935913033 2:107918309-107918331 TTTTTAGATGCTATTGTAAATGG + Intergenic
935953937 2:108355722-108355744 CTTTTCAATGCTATAATAAATGG + Intergenic
935991827 2:108725959-108725981 CTTTTAGATGCGATTGTAAATGG + Intronic
936120149 2:109734376-109734398 TTTTTAGATGCTATTGTAAATGG - Intergenic
936127254 2:109799475-109799497 CTTTTAGATGCGATTGTAAATGG + Intronic
936217443 2:110572010-110572032 CTTTTAGATGCGATTGTAAATGG - Intronic
936395687 2:112127010-112127032 CTTTTTGATGCTATTGTAAATGG - Intergenic
936426585 2:112426587-112426609 CTTTTAGATGCGATTGTAAATGG - Intronic
937020887 2:118653764-118653786 CTTTTGGATGCTATTGTAAATGG - Intergenic
937180277 2:119989518-119989540 CTTTTTGATGCTATTGTAAATGG - Intergenic
937535161 2:122877226-122877248 CTTTAAGAGGCCATAGTAAAAGG + Intergenic
938147195 2:128845902-128845924 CTTTTTGATGCTATTACAAATGG + Intergenic
938371923 2:130775251-130775273 CTTTTTAACGCTATTATAAATGG - Intergenic
938553957 2:132406870-132406892 CTTTTTGATGCTACTATAAATGG + Intergenic
939921527 2:148120531-148120553 CTTTTACATGCTATTGTAAATGG + Intronic
940091254 2:149921057-149921079 CTTTTTGATGCTATTGTAAATGG - Intergenic
940420151 2:153471512-153471534 CATTTAGAGGGCTTAATAAAAGG - Intergenic
940598221 2:155821640-155821662 GTTTTTGAAGCTATAATACATGG - Intergenic
941055288 2:160780807-160780829 CTTTTTGTGGCTGTCATAAACGG - Intergenic
941493242 2:166168558-166168580 TTTTTTGTGGCTATTATAAATGG - Intergenic
941742082 2:169045863-169045885 CTTTTTGATGCTGTTATAAATGG - Intergenic
942378475 2:175361645-175361667 CTTTTAGAGTTCATAATAAATGG + Intergenic
942437416 2:175995461-175995483 CTATTCAAGGCTATAATCAAAGG + Intronic
942713821 2:178868477-178868499 AATTTAGAGGCTATTTTAAAGGG + Intronic
943141569 2:183989482-183989504 CTTTTTGTGGCTATTGTAAATGG + Intergenic
943170965 2:184398897-184398919 CTTCTAGAGGTTATTGTAAATGG + Intergenic
943275290 2:185859087-185859109 TTTTTAGATGCTATTGTAAATGG - Intergenic
943627032 2:190213116-190213138 CCTTTATTGTCTATAATAAATGG + Intronic
943911816 2:193578804-193578826 CTTTTTGATGCTATTGTAAATGG - Intergenic
944331540 2:198472954-198472976 CTTTTAGAAGCTATTTTAAGTGG - Intronic
944333003 2:198494457-198494479 GTATTAGAGGCTGTAATTAAAGG - Intronic
944471680 2:200060046-200060068 CTTTTTGTGGCTATTATGAATGG - Intergenic
944974166 2:205028921-205028943 CTTTTTGATGCTATTGTAAATGG - Intronic
945103974 2:206290596-206290618 CTTTTTGATGCTATTGTAAATGG + Intronic
945385718 2:209198269-209198291 CCTTTTGATGCTATTATAAATGG - Intergenic
945403002 2:209410469-209410491 CTTTTTGATGCTATAGTAAAAGG - Intergenic
945459999 2:210095271-210095293 ATTTTAAAGGCTATAATAAAAGG - Intronic
945671214 2:212804792-212804814 CTTATAGAGACTTTAGTAAATGG - Intergenic
946469268 2:219941439-219941461 CTTTTTGATGCTATTGTAAATGG + Intergenic
946755175 2:222937176-222937198 CTTTTTGATGCTACATTAAATGG + Intronic
946815433 2:223572849-223572871 CTTTTTGATGCTATTGTAAATGG - Intergenic
947110598 2:226715219-226715241 TTTTTAGAAGCTATTTTAAATGG + Intergenic
947358425 2:229321152-229321174 CATTTAGAAGCTAAAATCAATGG - Intergenic
1168909143 20:1432351-1432373 CTTTTGGATGCTGTTATAAATGG + Intergenic
1169031556 20:2412772-2412794 CTTTTTGATGCTATTGTAAATGG - Intronic
1169238752 20:3955878-3955900 CTTTTGGATGCTATTGTAAATGG + Intronic
1169322698 20:4646779-4646801 CTTTTTGATGCTACTATAAATGG - Intergenic
1169408028 20:5341787-5341809 CTTTTTGATGCTATTGTAAATGG - Intergenic
1169505969 20:6212212-6212234 CTTTTAGTGGTTATCCTAAATGG - Intergenic
1169533448 20:6510479-6510501 CTTTTTGATGCTATCATATATGG + Intergenic
1169583421 20:7052282-7052304 ATTTTTAAGGCTATTATAAAAGG + Intergenic
1169850993 20:10050543-10050565 TTATTATAGGCTTTAATAAAGGG - Intronic
1170178946 20:13507158-13507180 CTTTTTGATGCTATTATAAATGG - Intronic
1170183801 20:13564327-13564349 CTTTTCGATGCTATTGTAAATGG - Intronic
1170492520 20:16892998-16893020 CTTTTTGTGGCAATTATAAATGG - Intergenic
1170559519 20:17544822-17544844 CTTTTAGCAGCTGTAATAATAGG + Intronic
1170752216 20:19160451-19160473 TTTTTAGATGCTATTATAATTGG + Intergenic
1171176681 20:23055925-23055947 CTTTTTGATGCTATTATAAATGG - Intergenic
1171176684 20:23056028-23056050 CTTTAAAAGGCTTAAATAAATGG + Intergenic
1172384649 20:34525380-34525402 TTTTTAGAGTCTCTAAGAAATGG + Intronic
1172750022 20:37244234-37244256 CTTTTAGGGGCTGTGGTAAAGGG + Intergenic
1173200755 20:40953426-40953448 TTCTGAGAGTCTATAATAAAAGG + Intergenic
1173717997 20:45227644-45227666 CTTTTCGATGCTATTGTAAATGG + Intergenic
1173776366 20:45710754-45710776 CTTTTTGATGCTATTGTAAATGG - Intergenic
1174341220 20:49897221-49897243 CTTTTTGATGCTATTATAAATGG - Intergenic
1175982751 20:62748198-62748220 CTTTTTGATGCTATTGTAAATGG - Intronic
1176717182 21:10362904-10362926 CTATTTGTGGCTATGATAAATGG + Intergenic
1176785199 21:13248022-13248044 ATTTTAAAGTGTATAATAAATGG - Intergenic
1176898432 21:14411346-14411368 CTTTTTGTGGCTATCATGAATGG + Intergenic
1176900111 21:14430704-14430726 CTTTTTGATTCTATAGTAAAAGG - Intergenic
1176977279 21:15336175-15336197 CTTTATGATGCTATTATAAATGG - Intergenic
1177397499 21:20556557-20556579 CTTTTTTGGTCTATAATAAAGGG - Intergenic
1177591673 21:23178391-23178413 GTTTTGGAGTCTATGATAAAAGG - Intergenic
1177679399 21:24345741-24345763 CTTTTTGATGCTATACAAAATGG + Intergenic
1178628471 21:34238730-34238752 CTTTTAGAAGATCTAATTAAGGG + Intergenic
1179004504 21:37499664-37499686 TTTTTAGATGCTATTTTAAATGG + Intronic
1180601155 22:17017070-17017092 CTATTTGTGGCTATGATAAATGG - Intergenic
1181158887 22:20944718-20944740 ATTTTAGATGCTATTGTAAATGG + Intronic
1181600025 22:23945488-23945510 CTTTTTGATGCCATTATAAATGG - Intergenic
1181608479 22:23995831-23995853 CTTTTTGATGGTATTATAAATGG + Intergenic
1182934085 22:34204403-34204425 CTTTTTGATGCTATCATAAGTGG - Intergenic
1183766720 22:39883883-39883905 CTTTTTGAAGCTCTAGTAAATGG - Intronic
1184051600 22:42010053-42010075 CTTTTTGATGCTATTGTAAATGG + Intronic
1184315036 22:43680697-43680719 CTTTTTGATGCTATTGTAAATGG + Intronic
1184542503 22:45136937-45136959 AAATAAGAGGCTATAATAAAAGG + Intergenic
1184635802 22:45829619-45829641 ATTTTTGATGCTATTATAAAAGG - Intronic
1185412412 22:50690850-50690872 CTTCTGGATGCTATTATAAATGG + Intergenic
1203290708 22_KI270735v1_random:35471-35493 CTTTTCGAGGATGAAATAAATGG - Intergenic
949446339 3:4138053-4138075 TTTTTTGATGCTATTATAAATGG - Intronic
950997112 3:17513745-17513767 CTTTCAGAGTCGATTATAAAAGG + Intronic
951515413 3:23553790-23553812 TTTTTAAATGCTATCATAAATGG - Intronic
951716553 3:25654327-25654349 CTTTTTGATGCTATAGTAAATGG - Intronic
951966672 3:28394165-28394187 CTTTTTGATGCTATTGTAAATGG - Intronic
952310865 3:32188721-32188743 CTTTTTGATACTATTATAAATGG + Intergenic
952563278 3:34621572-34621594 CTTTTGGATGCTATTGTAAATGG + Intergenic
952572125 3:34730509-34730531 CTTTTAGTGGCTATTATGAATGG - Intergenic
952692195 3:36222262-36222284 GTTTTTGATGCTATGATAAATGG + Intergenic
953283816 3:41584896-41584918 CTTTTTGATGCTATTGTAAATGG - Intronic
953509461 3:43520902-43520924 CTTTTTGATGCTACAATAAATGG + Intronic
953900812 3:46842054-46842076 CTTTTTGATGCTATTGTAAATGG - Intergenic
953988529 3:47465009-47465031 CTTTTTGATGCTATTATAAATGG - Intronic
953997647 3:47532527-47532549 CTTTTTGATGCTATTGTAAATGG + Intergenic
954503896 3:51049952-51049974 CTTTTTGATGCTATTGTAAATGG - Intronic
954522817 3:51244434-51244456 CTTTTTGATGCTATTGTAAATGG + Intronic
954591171 3:51783734-51783756 CTTTTTGATGCTATTACAAATGG + Intergenic
955014422 3:55055788-55055810 TTTTTTGTGGCTATTATAAATGG + Intronic
955704283 3:61712192-61712214 TTTTTAAAGACTATAATAACAGG - Intronic
956318703 3:67970011-67970033 CTTTTTGATACTATCATAAATGG - Intergenic
957112780 3:75987291-75987313 CTTTTTGATGCTATAATCAATGG + Intronic
957284422 3:78199598-78199620 CTTTTTGATTCTATTATAAATGG - Intergenic
957352431 3:79043041-79043063 TTTTTTGAGACTATCATAAAAGG + Intronic
957572215 3:81961513-81961535 CATTCACAGACTATAATAAATGG + Intergenic
957692301 3:83588011-83588033 TTTTTTGTGGCTACAATAAATGG + Intergenic
958590133 3:96146713-96146735 CTTTTTGTTGCTATGATAAATGG + Intergenic
958698987 3:97564508-97564530 ATTTTAGATGCTAAATTAAAGGG + Intronic
958763533 3:98337523-98337545 CTTTTATATGCTATTATGAATGG - Intergenic
958770438 3:98419693-98419715 CTTTTTGAAGCTATTGTAAATGG - Intergenic
959561323 3:107786071-107786093 CTTTTTGATGCTATTGTAAATGG - Intronic
959782461 3:110252009-110252031 TTTTTTGATGCTATTATAAATGG + Intergenic
960886010 3:122395453-122395475 CTTTTTGATGCTATTATAAATGG - Intronic
961113740 3:124310157-124310179 CTTTTTTATGCTATTATAAATGG - Intronic
961251259 3:125507964-125507986 CTTTTTGATGCTATTGTAAATGG - Intronic
961317068 3:126046498-126046520 CCTTTTGATGCTATTATAAATGG - Intronic
962300387 3:134236346-134236368 CTTTTGGATGCTATTGTAAATGG - Intronic
962700519 3:137994472-137994494 CTTTTTGATGCTATTACAAACGG + Intergenic
962838474 3:139211428-139211450 CTTTTTGGTGCTATTATAAATGG + Intronic
963805790 3:149720868-149720890 ATTTTTGATGCTATTATAAATGG + Intronic
963824885 3:149942441-149942463 CTTTTTGTTGCTATAGTAAATGG + Intronic
964329043 3:155580848-155580870 TTTTGAGAGTCTATGATAAAAGG - Intronic
965183595 3:165435452-165435474 ATTATAGAGGCAATAATAACAGG + Intergenic
965413607 3:168364252-168364274 CTTTTAGAAAACATAATAAATGG - Intergenic
965636163 3:170783235-170783257 CTTTTGGTGGCTATTGTAAATGG - Intronic
966008274 3:175044114-175044136 CTTTTTGATGCTATTGTAAATGG + Intronic
966091147 3:176138157-176138179 CTTTTTGTGGCTATTTTAAATGG + Intergenic
966579871 3:181548760-181548782 CTTTTAGATGCTATTTTAAATGG + Intergenic
966997970 3:185302583-185302605 CTTTTTGATGCTATTATAAATGG + Intronic
967475683 3:189914299-189914321 CTATCAGAGGCAATAATGAAGGG - Intergenic
967795183 3:193592201-193592223 TTTTTAGGGACTAAAATAAAAGG - Intronic
970339585 4:15091192-15091214 CTTTTAGAGGTTAGGATAATAGG - Intergenic
970667102 4:18349647-18349669 CTTTTTGATGCTATTGTAAATGG + Intergenic
971432854 4:26586713-26586735 GTTTTTGACGCTATTATAAATGG + Intronic
972064909 4:34929592-34929614 ATTTTAGTGGCTATTATAAATGG - Intergenic
972214989 4:36887350-36887372 CATTTTGTGGCTATTATAAATGG + Intergenic
972497027 4:39643602-39643624 CTTTTTGATGATATTATAAATGG + Intergenic
972582630 4:40408157-40408179 CTTTTTGATGCTATTGTAAATGG - Intergenic
972983334 4:44732331-44732353 CTTTTTGATGCTATTGTAAAGGG + Intergenic
973033599 4:45376255-45376277 CTTTCTGATGCTATAGTAAATGG + Intergenic
973196348 4:47447076-47447098 CTTTTTGATGCTATTGTAAATGG - Intergenic
974126478 4:57702768-57702790 CTTTTTGTGGCTATTGTAAATGG + Intergenic
974297146 4:60015284-60015306 CTTTTTGTGGCTATAGTGAATGG + Intergenic
974498540 4:62666008-62666030 CTCTAAGAGGCAACAATAAATGG - Intergenic
974908735 4:68088795-68088817 CTTTTTGTGGCTATTGTAAATGG - Intronic
975286267 4:72624745-72624767 CTTTTTGTGGCTATCATGAATGG - Intergenic
975641890 4:76509178-76509200 CTTTTTGAAGCTATTATAAATGG + Intronic
975828377 4:78343254-78343276 CTGTAAGAGGCTATAATAAAGGG - Intronic
975939583 4:79626493-79626515 GTTGTAGATGCTATAATAGAAGG - Intergenic
977020419 4:91752231-91752253 CTTTTAAAGGGGATTATAAATGG + Intergenic
977025842 4:91818455-91818477 ATTTTTGATGCTATTATAAATGG + Intergenic
977180951 4:93873101-93873123 ATTTTATAGGCTGCAATAAAGGG - Intergenic
977385291 4:96331592-96331614 CTTTTTGTGGCTATTGTAAATGG - Intergenic
978046218 4:104131649-104131671 ATTTTAGAAACTATAATAATAGG + Intergenic
978079954 4:104580076-104580098 CTTTCAGAGATTTTAATAAATGG + Intergenic
978940560 4:114431247-114431269 CTTTTTGTGGCTATTATAAATGG + Intergenic
978969343 4:114783995-114784017 TTGTCAGAGTCTATAATAAAGGG - Intergenic
979216207 4:118167302-118167324 CTTTTTTATGCTATTATAAATGG - Intronic
979301256 4:119090129-119090151 CTTTTTGTGGCTATAGTGAATGG + Intergenic
979301989 4:119096734-119096756 CATTTTGAGGCTGTAATAATGGG - Intergenic
979747706 4:124238520-124238542 CTTTTAGAAGATATATTAATTGG - Intergenic
979816170 4:125107571-125107593 CTTTTAGATGCTACTGTAAATGG - Intergenic
980199628 4:129639054-129639076 CATTTTGATGCTATCATAAATGG + Intergenic
980505067 4:133708345-133708367 CTTTTAGATGCTATTGTGAATGG + Intergenic
980752001 4:137102811-137102833 CTTTTTGATGCTATTATAAGTGG - Intergenic
981105801 4:140879475-140879497 TTTTTTGATGCTATCATAAATGG + Intronic
981705070 4:147650416-147650438 TTTTTAGATGCTATTATAAATGG - Intronic
982883866 4:160753165-160753187 TTTTTTGAAGCTATTATAAATGG + Intergenic
982950691 4:161691768-161691790 CTTTTAGATACTATCATGAATGG + Intronic
983176986 4:164601427-164601449 CTTTTTGTGGCTATTATAAATGG - Intergenic
983655319 4:170077441-170077463 CTTTTGGATGCTATTACAAATGG + Intronic
983665270 4:170174632-170174654 TTTTTTGATGCTATTATAAATGG + Intergenic
984000077 4:174229720-174229742 CTTTTAGAGAGGACAATAAAAGG - Intergenic
984116618 4:175689458-175689480 CTTTTTGAAGCTATTGTAAATGG + Intronic
984122119 4:175758604-175758626 CTTTTAGCATCTATAAAAAACGG - Intronic
984129641 4:175857954-175857976 TTTTTTGATGCTATTATAAATGG - Intronic
984161344 4:176256039-176256061 CTTTTAGGGGCTGTCATATATGG + Intronic
984222775 4:176998182-176998204 ATTTTTGATGCTATTATAAATGG - Intergenic
984240250 4:177210112-177210134 CTTTTCGTGGCTATTGTAAATGG + Intergenic
984967660 4:185154480-185154502 TTCTTTGTGGCTATAATAAATGG - Intergenic
985479453 5:99489-99511 CTTTTAGATGCTATTGTGAATGG + Intergenic
986122280 5:4851923-4851945 TTTTTTGATGCTATTATAAATGG - Intergenic
986209429 5:5656745-5656767 CTTTTAGAGGCTGTAATACTAGG - Intergenic
986500545 5:8394444-8394466 CTTTTTGATGTTATTATAAATGG - Intergenic
986565964 5:9114877-9114899 CTTTCTGAGGTTACAATAAAAGG - Intronic
986620768 5:9671530-9671552 CTTTTTGTGGCTATCATGAATGG - Intronic
987755149 5:22091452-22091474 CTTTCAGACACTATTATAAATGG - Intronic
988637453 5:33000685-33000707 TTTTTGGTGGCTATTATAAATGG + Intergenic
988820933 5:34884677-34884699 CTTTTTGATGCTATTGTAAATGG - Intronic
989409111 5:41096978-41097000 CATTAAGAGGCTATAAAAAGGGG + Intergenic
989416822 5:41188022-41188044 CTTTGAGAGGCTATTATAAATGG - Intronic
989765932 5:45083534-45083556 CTTTTTGATGCTATTATTAATGG - Intergenic
990224555 5:53634826-53634848 TTTTCAGAAGCTATAATAAAAGG - Intronic
990275277 5:54189061-54189083 CTTTTACGTGCTATTATAAATGG - Intronic
990443872 5:55874622-55874644 CTTTTAAATGCTATTGTAAATGG + Intronic
990918347 5:60935286-60935308 TTTTTTGAAGCTATTATAAAAGG + Intronic
991677695 5:69105018-69105040 AGCTTAGAAGCTATAATAAAAGG + Intronic
992065935 5:73108320-73108342 CTTTTTGGTGCTATTATAAATGG + Intergenic
992342406 5:75838539-75838561 CTTTTTGATTCTATCATAAATGG + Intergenic
992516292 5:77496505-77496527 ATTTTAGATGCTATTGTAAATGG - Intronic
992848481 5:80779515-80779537 TTTTTAGATGTAATAATAAATGG - Intronic
993625332 5:90217456-90217478 CTTTTTGAAGCTATTGTAAATGG - Intergenic
993823376 5:92649097-92649119 CCTTTTGATGCTATTATAAATGG - Intergenic
993933903 5:93976994-93977016 TTTTTAGTGGCTATTGTAAATGG - Intronic
994071365 5:95606543-95606565 CTCTTAGAGGATATAATGGAAGG - Intergenic
994081728 5:95714823-95714845 TTTTTAGATGTTATTATAAAGGG - Intronic
994614208 5:102082814-102082836 CTTTTTGTGGCTATTATGAATGG - Intergenic
994651151 5:102530578-102530600 CTTTTGGAGGCAACAACAAAAGG + Intergenic
994880102 5:105480259-105480281 ATTTTTGAGGCTATGATAAATGG - Intergenic
995105761 5:108376474-108376496 CTTTTTGATGCTATTATAAATGG - Intronic
995599338 5:113778661-113778683 TTTCTAGAGGCTGTACTAAAAGG + Intergenic
995691147 5:114827158-114827180 ATTTTAAATGCTATTATAAATGG - Intergenic
995814864 5:116156732-116156754 CTTTTAGAGACATTAACAAAGGG + Intronic
996245529 5:121259422-121259444 CTTTTTGTGGCTATAATGAATGG + Intergenic
996521658 5:124434152-124434174 CTTTTTGATGCTATTGTAAATGG - Intergenic
996686673 5:126289951-126289973 CTTTTTGATGCTTTTATAAATGG - Intergenic
996933646 5:128922219-128922241 CTTTTTGGTGCTATTATAAATGG - Intronic
996959333 5:129226671-129226693 TTTTTAGATGATATGATAAATGG + Intergenic
997086053 5:130800881-130800903 CTTTTTGAAGCTATTATAAATGG - Intergenic
997497490 5:134342208-134342230 CTTTTTGATGCTATCATGAATGG - Intronic
997620171 5:135283693-135283715 CTTTTTGTGGCTATCATAAGTGG + Intronic
997620467 5:135287546-135287568 CTTTTTGATGCTATCATACATGG + Intronic
997810882 5:136967732-136967754 CTTTTTGTTGCTATAGTAAATGG + Intergenic
998181272 5:139945854-139945876 CTTTTTGATGCTATTATAAATGG - Intronic
998727602 5:145035736-145035758 ATTTTTGATGCTATGATAAATGG - Intergenic
998922873 5:147089199-147089221 CTTTTTGTGGCTATTGTAAATGG + Intergenic
999416521 5:151401763-151401785 CTTTTTGTGGCTATTGTAAATGG + Intergenic
1001358218 5:171053471-171053493 CTTTTGAATGCTATTATAAATGG + Intronic
1001996391 5:176163250-176163272 TTTTTAGATGCTATTATAAATGG - Intergenic
1002767041 6:250491-250513 CTTTTTGATACTATTATAAATGG + Intergenic
1002768229 6:262523-262545 CTTTTAGAAGTTGTTATAAATGG + Intergenic
1002768841 6:269930-269952 CTTTTAAGCGCTATTATAAATGG + Intergenic
1003609189 6:7593040-7593062 CTTTTAGTGTCTTTAATATACGG + Intronic
1003780735 6:9422743-9422765 ATTTTTGTGGCCATAATAAATGG - Intergenic
1004191661 6:13469296-13469318 TTTGAAGAGGCTAAAATAAATGG - Intronic
1004968746 6:20884755-20884777 CTTTCAGATGCTATTGTAAACGG - Intronic
1005089335 6:22040324-22040346 GTTTTTGATGCTATTATAAATGG + Intergenic
1005159366 6:22841202-22841224 TTTTTTGATGCTATAATAAATGG - Intergenic
1005369765 6:25119946-25119968 CTTTTTGATGCTATTGTAAATGG - Intergenic
1005518842 6:26580535-26580557 CTTTTTGTGGCTATTGTAAATGG + Intergenic
1005523456 6:26622014-26622036 ATTTTAGATGTTATTATAAATGG + Intergenic
1005746667 6:28844561-28844583 CTTTTTGGTGCTATAGTAAATGG - Intergenic
1007868948 6:45010085-45010107 CTTTTTGATGCTATTGTAAATGG + Intronic
1008532147 6:52472522-52472544 ATTTTTGATGCTATAGTAAATGG - Intronic
1008795498 6:55297970-55297992 CTTTTTGTAGCTATTATAAATGG + Intergenic
1009273353 6:61643696-61643718 CTTTTTGTGGCTATTATGAATGG - Intergenic
1009479365 6:64137528-64137550 CACTTAGAGGCCATAATAATAGG + Intronic
1009859388 6:69306938-69306960 GTGTTAGGGGCTATAATAAGAGG - Intronic
1010322711 6:74531276-74531298 CTTTTTGTGGCTATTATAAATGG - Intergenic
1010367979 6:75074768-75074790 CCGTTAGTGGGTATAATAAATGG + Intergenic
1010459326 6:76096197-76096219 CTTTTTGTGGCTACTATAAATGG - Intergenic
1010598627 6:77796605-77796627 ATTTTTGATGCTATTATAAATGG - Intronic
1012811982 6:103970463-103970485 TTTTTTGTGGCTATCATAAATGG - Intergenic
1012830374 6:104197146-104197168 CTTTTTGTGACTATTATAAATGG - Intergenic
1012847073 6:104403954-104403976 CTTTTTGATGCTATTTTAAATGG - Intergenic
1013376527 6:109520856-109520878 CTTTTGGTGGCTATTGTAAATGG + Intronic
1013471019 6:110465530-110465552 GTTTGTGTGGCTATAATAAATGG - Intronic
1013548745 6:111186475-111186497 CCTTGTGAGGCTATACTAAATGG + Intronic
1014124766 6:117763951-117763973 CTTTTTGTGGCTATTGTAAATGG - Intergenic
1014207174 6:118668703-118668725 CTGTTCAAGGCTAAAATAAAGGG + Intronic
1014275923 6:119388739-119388761 ATTTTTGATGCTATTATAAATGG - Intergenic
1014286104 6:119500380-119500402 GTTTTTGATGCTATAATAAATGG + Intergenic
1015482858 6:133733204-133733226 CTTTTTGATGCTATTATAAATGG - Intergenic
1015898855 6:138043863-138043885 ATTTTTGATGCTATTATAAATGG + Intergenic
1016108403 6:140190682-140190704 CTTTTTCTGGCTATGATAAATGG - Intergenic
1016625397 6:146161217-146161239 TTTTTTGAGGATATTATAAAAGG - Intronic
1016982520 6:149865614-149865636 ATTTTTGAGGCTAAAAGAAATGG + Intergenic
1018881603 6:167887876-167887898 CCCTTAGAGCTTATAATAAAGGG + Intronic
1019948758 7:4352947-4352969 CTTTTTGATGCTGTTATAAATGG + Intergenic
1020551269 7:9608057-9608079 CCTTTCGTGGCTATTATAAATGG - Intergenic
1020738402 7:11982734-11982756 CTTTTTGGTGCTATGATAAATGG - Intergenic
1020797583 7:12695387-12695409 CTTTTAGTGGCAGGAATAAAGGG + Intergenic
1020916650 7:14201951-14201973 CTATAAGAGGCTCCAATAAAGGG + Intronic
1020976165 7:15009786-15009808 CTTTTAGAGTTTAGAATAATAGG + Intergenic
1021272790 7:18612201-18612223 CATATAGAGGCTATTACAAAAGG + Intronic
1021483820 7:21146200-21146222 CTATTACAGGCTATAGAAAAAGG - Intergenic
1022135735 7:27446594-27446616 CTTTTAGGTACTATTATAAATGG + Intergenic
1022261485 7:28709251-28709273 CTTTTAGGGTCTTTAATGAAAGG + Intronic
1022387076 7:29911156-29911178 CTTTTCTATGCTATCATAAATGG - Intronic
1022742053 7:33131453-33131475 CTTTTGAAGGCAATAATACAAGG - Intronic
1023191005 7:37582918-37582940 CTTTTTGATGCTATTATAAATGG + Intergenic
1023235128 7:38078155-38078177 TTTTTTAAGGCTATAATAAATGG - Intergenic
1023541145 7:41267470-41267492 CTAGAAGAGGCTATAATAACAGG + Intergenic
1023597611 7:41848469-41848491 CTTTTAGATGCTATTGTAAATGG + Intergenic
1023781118 7:43656245-43656267 CTTTTAGAAGATATTGTAAAAGG - Intronic
1024115005 7:46184532-46184554 CTTTTTGAGCCTTAAATAAATGG - Intergenic
1024310896 7:47967916-47967938 CTTTCAGAGGCTAAAATGATAGG + Exonic
1025068865 7:55881399-55881421 TTTTTAGATGCTATGGTAAATGG + Intergenic
1025195892 7:56932818-56932840 CTTTTTGATGCTACTATAAATGG + Intergenic
1025676056 7:63644117-63644139 CTTTTTGATGCTACTATAAATGG - Intergenic
1025718369 7:63984959-63984981 CTTTGGGAGGCTATTATTAAAGG - Intergenic
1025773672 7:64538574-64538596 CTTATAGTGGCTATTATAATGGG - Intronic
1026591968 7:71704261-71704283 CTTTTTGATGCTATTGTAAATGG - Intronic
1026782209 7:73276146-73276168 CTTTTTGATGCTATTGTAAATGG - Intergenic
1026792023 7:73340159-73340181 CTTTTTGATGCTATTGTAAATGG + Intronic
1026908242 7:74076339-74076361 CTTTTTGATGCTATTATAAATGG - Intergenic
1027022970 7:74828991-74829013 CTTTTTGATGCTATTGTAAATGG - Intronic
1027064955 7:75116319-75116341 CTTTTTGATGCTATTGTAAATGG + Intronic
1027429919 7:78100942-78100964 CTTTTTGATGCTATTGTAAATGG - Intronic
1028043324 7:86086425-86086447 TTTTTAGATGCTATTGTAAATGG + Intergenic
1029325592 7:99805444-99805466 CTTTTTGATGCTATTGTAAATGG - Intergenic
1029858463 7:103543330-103543352 ATTTAATAGGCAATAATAAATGG - Intronic
1030410372 7:109170314-109170336 CTTTTTGATGCTATTGTAAATGG - Intergenic
1030731017 7:112989077-112989099 CTTTTAGGGGCTATGTTAATTGG - Intergenic
1031079458 7:117244035-117244057 CTTTTTGATGCTACTATAAATGG - Intergenic
1031395365 7:121267463-121267485 CCTTTAAAGGCTATATTAAAAGG + Intronic
1031846514 7:126811613-126811635 TTTTCTGTGGCTATAATAAATGG + Intronic
1032124634 7:129184296-129184318 ATTTTAGATGCTATTGTAAATGG + Intergenic
1033409654 7:141105778-141105800 TTTTTAAAGGCTCTATTAAAAGG - Intronic
1033709026 7:143919274-143919296 CTTTTTGTGGCTATTGTAAATGG + Intergenic
1034138495 7:148794804-148794826 CTTTTTGATGCTATTATAAATGG + Intronic
1034249832 7:149680213-149680235 CTTTTTGAAACTATTATAAATGG + Intergenic
1034354377 7:150441142-150441164 CTTTTTGGTGCTATTATAAATGG + Intergenic
1034712880 7:153210710-153210732 CTTTTAGATGTTATTTTAAATGG + Intergenic
1035172563 7:157026457-157026479 CTTTTTGATGCTATTGTAAATGG + Intergenic
1035940512 8:3895604-3895626 CTTTTTGAGACTTTACTAAATGG - Intronic
1035988593 8:4462241-4462263 TTTTTAGATGCTATGGTAAAGGG - Intronic
1036024194 8:4885082-4885104 CTTTTAGAAGCTACTGTAAATGG + Intronic
1037168036 8:15854702-15854724 CTTTTACATCCTAAAATAAAGGG - Intergenic
1037851032 8:22328680-22328702 CTTTTGGATGCTATTGTAAATGG + Intronic
1038116206 8:24558520-24558542 CTTTTTGTGGCTATTATGAATGG - Intergenic
1039075659 8:33688667-33688689 CTTTTAGTTCCCATAATAAATGG - Intergenic
1039206049 8:35156310-35156332 CTTTTTGTGGCTATTATAAATGG - Intergenic
1039236332 8:35506724-35506746 CTTTTAGGGAATGTAATAAAAGG + Intronic
1039398843 8:37250528-37250550 CTTTTAGATGCCATTATAAATGG - Intergenic
1039654332 8:39383482-39383504 CTTTTTGATGCTATCATAAATGG + Intergenic
1040012829 8:42676581-42676603 CTGTTAGAGCCTATATTAGATGG + Intergenic
1040509346 8:48080473-48080495 CTTTTTGATGCTATTGTAAATGG - Intergenic
1040547928 8:48415597-48415619 CTTTTGGATGCTATTGTAAATGG - Intergenic
1040886947 8:52274783-52274805 GTTTTGGAGTCTATAAAAAACGG + Intronic
1040986557 8:53300517-53300539 CTTTTTGTGGCTATCATAAATGG + Intergenic
1041170173 8:55133223-55133245 TTTTAAGAGTCTACAATAAAGGG + Intronic
1041336576 8:56791555-56791577 ATTTTAGATGCTATTATAAATGG - Intergenic
1041476124 8:58268354-58268376 TTTTTTGTGGCTATTATAAATGG - Intergenic
1041560341 8:59210613-59210635 TTTTTTGTGGCTATTATAAATGG + Intergenic
1041722880 8:60992142-60992164 CTTTGAGAGCATATAGTAAAGGG - Intergenic
1041843594 8:62300503-62300525 ATTTTAAAGGTGATAATAAAAGG - Intronic
1041923545 8:63211537-63211559 CTATTAGAGAATATTATAAAAGG + Intronic
1042286678 8:67120610-67120632 CTTTTGGATGCTTTCATAAATGG + Intronic
1042583533 8:70309166-70309188 CTGTCAGGGGCTATAATAGATGG - Intronic
1042587442 8:70357256-70357278 CTTTTGGATGCTATGGTAAATGG - Intronic
1043216636 8:77599666-77599688 CTTTTTGATGGTATTATAAATGG - Intergenic
1043818451 8:84833302-84833324 TTTTTAGTGTCTATAAAAAAAGG - Intronic
1044334762 8:90967815-90967837 CTTTTTGATGCTATTGTAAATGG - Intronic
1044407272 8:91842684-91842706 CTTTTAGAAGCTTTAATTCAAGG + Intergenic
1044501483 8:92963977-92963999 CTTTAAGAGGTTATGATCAAAGG + Intronic
1044509996 8:93064777-93064799 CTTTTTAAGGCTATTGTAAATGG - Intergenic
1044768346 8:95601764-95601786 CTTTTTGTGGCTATTGTAAATGG - Intergenic
1044895443 8:96886694-96886716 CTCTTAGAGGTTAAAAGAAATGG - Intronic
1045042900 8:98244015-98244037 CTTTAAGAAGTGATAATAAAGGG - Intronic
1045072582 8:98524594-98524616 CTTTTTGATGCTATTATCAATGG + Intronic
1045076638 8:98576635-98576657 CTTTTGGATGCTATTATAAATGG + Intronic
1045157618 8:99494448-99494470 ATTTTAGATGCTATTGTAAAGGG + Intronic
1045284718 8:100780460-100780482 CTTTCAGAAAGTATAATAAATGG - Intergenic
1045847232 8:106652005-106652027 CTTTTTGATGCTACTATAAATGG + Intronic
1045857877 8:106784875-106784897 CATTTAGAAGATATAATGAAAGG + Intergenic
1046199722 8:110909086-110909108 TTTTTTGTGGCTATAGTAAACGG - Intergenic
1046200486 8:110921347-110921369 TTTTCAGAGGCTTTAACAAAAGG - Intergenic
1046249432 8:111610732-111610754 CTTTTAGATGCTAAAATATGTGG + Intergenic
1046682807 8:117191069-117191091 CTTTTTGATGCTATAACAAATGG - Intergenic
1047466766 8:125124295-125124317 CTTTTTGATTCTATTATAAATGG + Intronic
1047699957 8:127439285-127439307 CTTTTTGTGGCTATGATAAGTGG - Intergenic
1047935541 8:129773805-129773827 ATTTTTGATGCTATTATAAACGG - Intronic
1048463987 8:134647750-134647772 TTTTTCGACGCTATTATAAATGG - Intronic
1048617050 8:136087307-136087329 CTTTTTGATGCCATTATAAATGG + Intergenic
1048737098 8:137514050-137514072 CTTTAAGTGGCTAGAATAAAGGG - Intergenic
1049739990 8:144234455-144234477 CTTTTTGATGCTATTGTAAATGG + Intronic
1050059895 9:1696638-1696660 CCTTTTGATGCTATTATAAAAGG - Intergenic
1050241920 9:3645601-3645623 CTGTTAGAGACTATAGGAAAAGG + Intergenic
1050440641 9:5659760-5659782 CTTTTTGATGCTATTGTAAATGG + Intronic
1050444560 9:5705403-5705425 CTTTTTGATGCTATTGTAAATGG + Intronic
1050624276 9:7486810-7486832 CTTGCAGAGGGTTTAATAAAGGG + Intergenic
1050659022 9:7862783-7862805 CATTTTCATGCTATAATAAAAGG - Intronic
1050698315 9:8304660-8304682 CTTTTCGATGCTATTGTAAATGG + Intergenic
1050951102 9:11595282-11595304 ATTTTAGGTGCTATATTAAATGG + Intergenic
1050977988 9:11966459-11966481 CTTTTAGAGATTATATTAGATGG - Intergenic
1051096574 9:13473056-13473078 CTTTTTGTGGCTATTGTAAATGG + Intergenic
1051107831 9:13600646-13600668 CTTTTCCAGGATATCATAAAAGG + Intergenic
1051168040 9:14286812-14286834 CTTTTAAATGCCATCATAAAGGG + Intronic
1051293315 9:15567982-15568004 CTTTTTGATGCTGTTATAAATGG + Intronic
1051704038 9:19857610-19857632 CTTTTTGAAGCTATTATAAATGG + Intergenic
1051713064 9:19952072-19952094 ATTTTTGATGCTATTATAAATGG + Intergenic
1051815604 9:21102007-21102029 CTTTTTGATGTTATTATAAATGG + Intergenic
1052128592 9:24811552-24811574 CTTTTTGATGCTACTATAAATGG - Intergenic
1052281583 9:26739296-26739318 CTTTTAGTGGCCATTATGAATGG - Intergenic
1052749427 9:32474237-32474259 TTTTTTGATGCTATTATAAATGG - Intronic
1052751577 9:32497287-32497309 CTTTTTAATGCTATTATAAATGG + Intronic
1053493989 9:38535721-38535743 ATTTTGGATGCTATTATAAAAGG + Intergenic
1053730437 9:41050274-41050296 TTTTTTGATGCTATCATAAATGG + Intergenic
1054698061 9:68381792-68381814 TTTTTTGATGCTATCATAAATGG - Intronic
1055083078 9:72286679-72286701 CTTTTTGGTGCTATTATAAATGG + Intergenic
1055140092 9:72867276-72867298 CTTTTTGATGCTATGGTAAATGG + Intergenic
1055311609 9:74988228-74988250 CTTTTAGTGGCCATAACAGAAGG + Intronic
1055820631 9:80258203-80258225 CTTTTAGAGGCTATTCCAAGAGG + Intergenic
1055870644 9:80875192-80875214 CATTTAGAAGCAATAATATATGG - Intergenic
1056102684 9:83314872-83314894 CTTTGAGAGGCCCTAATAAATGG + Intronic
1056159687 9:83876310-83876332 CTTTTAGATGCTATTATAAATGG - Intronic
1056163083 9:83917218-83917240 CTTTTTGATGCTATTGTAAATGG - Intronic
1056350891 9:85747618-85747640 CTTTTAGATGCTATTATAAATGG + Intergenic
1057002599 9:91526084-91526106 CTTTTTGATGCTATTTTAAATGG - Intergenic
1057258749 9:93571906-93571928 CTTTTTGATGCTACTATAAATGG - Intergenic
1057410495 9:94813008-94813030 TTTTTAGAGGCAAAAAAAAAGGG + Intronic
1057438705 9:95065682-95065704 CTTTTATAGGGTAAAATACAAGG + Intronic
1057756229 9:97839059-97839081 CTTTTTGATGCTATTGTAAATGG - Intergenic
1057940778 9:99281782-99281804 CTTTGAGAGGCCAGAATAAGAGG - Intergenic
1058145545 9:101407114-101407136 CTTTTAAAAACAATAATAAAGGG - Intronic
1058666758 9:107325492-107325514 CTTTTTGATGCTGTTATAAATGG + Intronic
1059066086 9:111085783-111085805 CTTTTCGGTGCTATCATAAATGG + Intergenic
1059264726 9:113016169-113016191 CTTTTTGATGCTATTGTAAATGG + Intergenic
1059336359 9:113571176-113571198 CAGTTTGAGGCTATAATGAATGG + Intronic
1059439439 9:114297958-114297980 CTCTTTGATGCTATTATAAATGG - Intronic
1059887492 9:118762434-118762456 CTTTTAGAGGACATATTAAGGGG + Intergenic
1060257134 9:122041663-122041685 CTTTTTGATGCTATTATAAATGG - Intronic
1061685502 9:132273561-132273583 CTTTTTGATGCTATTGTAAATGG + Intronic
1185949532 X:4416139-4416161 CTTTGTGATGCTATAATGAAGGG - Intergenic
1186150938 X:6673949-6673971 CTGTTAGAAGATCTAATAAAAGG + Intergenic
1186631963 X:11359490-11359512 CTTATTTAGCCTATAATAAAAGG + Intronic
1186945955 X:14567867-14567889 CTTTTACATACTATTATAAATGG - Intronic
1187099155 X:16174093-16174115 CTTTTTGATGCTATTATAAATGG - Intergenic
1187118550 X:16380453-16380475 CTTTTTGATGCTATTATAAATGG - Intergenic
1187600113 X:20819829-20819851 ATTTTTGAGGCTATTGTAAATGG - Intergenic
1188273157 X:28167540-28167562 CTGTAAAAGGCTATAATAACAGG + Intergenic
1188306402 X:28564822-28564844 ATTTTTGAGACTATTATAAAGGG + Intergenic
1188867673 X:35333647-35333669 CTTCTTGATGCTATCATAAATGG + Intergenic
1189108990 X:38267361-38267383 CTTTTAGAGCCTCTTAGAAAGGG + Intronic
1189191259 X:39108852-39108874 CTTTTTGATGCTATAGTAATTGG + Intergenic
1189596807 X:42575232-42575254 CTTTTTGATGCTCTTATAAATGG + Intergenic
1190065290 X:47236801-47236823 TTTTTGGATGCTATCATAAATGG - Intronic
1190238834 X:48640518-48640540 CTTTTTGATGCTATTGTAAATGG - Intergenic
1190451997 X:50591641-50591663 CTTTTTGATGCTATTGTAAATGG + Exonic
1190471980 X:50791201-50791223 ATTTTAGGTGCTATAGTAAATGG - Intronic
1190490469 X:50977945-50977967 CTTTTTGATGCTATTATAAGTGG - Intergenic
1190500454 X:51072036-51072058 CTTTTGGATGCTATTTTAAATGG - Intergenic
1190993252 X:55575663-55575685 CTTTTTGATACTATCATAAATGG - Intergenic
1191040616 X:56075190-56075212 CTTTTTGATGCTATTGTAAAAGG + Intergenic
1191076803 X:56462412-56462434 ATTTTACAAGTTATAATAAATGG + Intergenic
1191708748 X:64124002-64124024 TTTTTTGTTGCTATAATAAATGG - Intergenic
1191709032 X:64128823-64128845 CTTTTAGATCCTATTGTAAATGG - Intergenic
1192064492 X:67866449-67866471 TTTTTTGTGGCTATTATAAATGG + Intergenic
1192279211 X:69666055-69666077 GTTTTCGATGCTATCATAAATGG + Intronic
1192375511 X:70557136-70557158 CTTTTTGATGCTGTTATAAAGGG - Intronic
1192456074 X:71277020-71277042 CTTTCTGATGCTATTATAAATGG + Intergenic
1192617137 X:72637984-72638006 CTTTTTGATGCTATTATAAATGG + Intronic
1192886479 X:75340103-75340125 CTTTTTGATGCTATTGTAAATGG + Intergenic
1193066577 X:77266789-77266811 CTTTTCGTGGCTATTGTAAATGG - Intergenic
1193321629 X:80129629-80129651 GTTTTTGAGGCTTTCATAAAAGG - Intergenic
1193355658 X:80517703-80517725 CTTTTTGAGGCTATTGTGAATGG - Intergenic
1193368418 X:80662421-80662443 CTTTTTGATGCTATTGTAAAGGG + Intergenic
1193435398 X:81469312-81469334 ATTTTTGATGCTATTATAAATGG - Intergenic
1193741040 X:85217273-85217295 CTTTTGGTGGCTATAATTAAGGG - Intergenic
1193742107 X:85229822-85229844 CTTTTAGACGCTATTGTAATTGG - Intergenic
1193908487 X:87272228-87272250 TTTTTCCAGGCTATTATAAAAGG + Intergenic
1194012439 X:88579229-88579251 CTTTTTGTGGCTATTTTAAATGG - Intergenic
1194070032 X:89311196-89311218 CTTTTTGATGCTATTGTAAATGG + Intergenic
1194073551 X:89359459-89359481 CTTTTTGATGCTATCGTAAATGG + Intergenic
1194126557 X:90025147-90025169 CTTTTTGTGGCTATCATGAATGG - Intergenic
1194133892 X:90114664-90114686 GATTTAGAAGCCATAATAAAAGG - Intergenic
1194797762 X:98234133-98234155 CTTTTTGTGGCTATCGTAAATGG + Intergenic
1194799715 X:98257390-98257412 TTTTTAGTAGCTATTATAAATGG - Intergenic
1194983850 X:100468785-100468807 TTTTTTGATGCTATTATAAATGG + Intergenic
1195206784 X:102608555-102608577 CTTTTATATGCTATTGTAAATGG + Intergenic
1195247924 X:103013225-103013247 CTCACAGAGACTATAATAAACGG - Intergenic
1195303122 X:103551506-103551528 CTTTTTGATGCTATTATAAATGG - Intergenic
1195334761 X:103841289-103841311 CCTTTTGATGCTATTATAAATGG - Intergenic
1195556328 X:106229001-106229023 CTTTTTGATGCTATTGTAAATGG + Intergenic
1196233974 X:113257650-113257672 CTTTTTGTGGCAATTATAAATGG + Intergenic
1196316598 X:114233175-114233197 CTTTTGGATGCTATTATAAATGG + Intergenic
1196329431 X:114453070-114453092 ATTTAAGAGGATAAAATAAAGGG + Intergenic
1197027522 X:121772319-121772341 CTTTTTGATGCTATTGTAAATGG + Intergenic
1197042197 X:121950447-121950469 CTTTTTGATGCTATTTTAAAAGG - Intergenic
1197428797 X:126332680-126332702 CTTTTTGTGGCTGTAGTAAATGG + Intergenic
1197580949 X:128283123-128283145 CTTTTACAGGTTATTTTAAAAGG + Intergenic
1197616722 X:128700285-128700307 CTTTTAGTGGCCATTATGAATGG - Intergenic
1197704587 X:129624746-129624768 CTTTTTTTGGCTATTATAAATGG - Intergenic
1197723629 X:129761311-129761333 TTCATAGAGGGTATAATAAAAGG - Intronic
1198308859 X:135409865-135409887 CTTTGTGATGCTATTATAAATGG - Intergenic
1198652742 X:138881174-138881196 CTTTTAGATGTTATAATAAATGG + Intronic
1198771344 X:140133686-140133708 CTTTTTGATGCTATTGTAAATGG + Intergenic
1199006246 X:142700289-142700311 CTTTGTGATGCCATAATAAATGG + Intergenic
1199118419 X:144020656-144020678 ATCTTAGAGGCAATAATATATGG - Intergenic
1199300071 X:146203103-146203125 CTTTTTGATGCTATCGTAAATGG + Intergenic
1199358161 X:146885601-146885623 ATTTGAAAGGCTATATTAAATGG + Intergenic
1199422910 X:147666524-147666546 CTTTTTAAGGCTAAAACAAAAGG + Intergenic
1199432996 X:147781633-147781655 TTTCTAGAGCATATAATAAAAGG + Intergenic
1199796983 X:151208427-151208449 CTTTCTGTGGCTATTATAAATGG + Intergenic
1199923485 X:152435911-152435933 CTTTTTGATGCTATTATAAATGG - Intronic
1199925841 X:152462869-152462891 GTTTTAGATGCTATTGTAAATGG - Intergenic
1199931318 X:152525918-152525940 CATTTAGAAGGTATAATGAATGG - Intergenic
1200128060 X:153826774-153826796 CTTTATGATGCTATCATAAATGG - Intronic
1200278930 X:154760486-154760508 CTTTTTGAGGTGATAAAAAAAGG - Intergenic
1200373537 X:155754833-155754855 CTTTTAGATGCTATTGTAAATGG + Intergenic
1200390219 X:155936855-155936877 CTTTTTGATGCTATCATAAATGG - Intronic
1200479666 Y:3684777-3684799 GATTTAGATGCCATAATAAAAGG - Intergenic
1200724270 Y:6646829-6646851 CTTTTTGATGCTATTGTAAAGGG + Intergenic
1200728932 Y:6711023-6711045 CTTTTTGATGCTATCGTAAATGG + Intergenic