ID: 919400759

View in Genome Browser
Species Human (GRCh38)
Location 1:197113401-197113423
Sequence CTGAAGGTAGCATGGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919400755_919400759 29 Left 919400755 1:197113349-197113371 CCAGAATCTAAAATAGAAGTAGA 0: 1
1: 42
2: 681
3: 1633
4: 3307
Right 919400759 1:197113401-197113423 CTGAAGGTAGCATGGCAAAAGGG 0: 1
1: 0
2: 3
3: 32
4: 261
919400754_919400759 30 Left 919400754 1:197113348-197113370 CCCAGAATCTAAAATAGAAGTAG 0: 1
1: 3
2: 83
3: 815
4: 2437
Right 919400759 1:197113401-197113423 CTGAAGGTAGCATGGCAAAAGGG 0: 1
1: 0
2: 3
3: 32
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919400759 Original CRISPR CTGAAGGTAGCATGGCAAAA GGG Intronic
900851664 1:5148083-5148105 CTGAAGGCAGTTTGGCAAGATGG - Intergenic
902605748 1:17568459-17568481 ATGATGGTGACATGGCAAAAAGG + Intronic
902902616 1:19529925-19529947 CTGCAGGAAGCAGGACAAAAAGG + Intergenic
903394143 1:22986408-22986430 CAGAAGGTGGAAAGGCAAAAGGG - Intergenic
904553519 1:31341607-31341629 AGGAAGGAAGCATGGCATAATGG + Intronic
905593400 1:39184915-39184937 CTGAAGATGGCCTGGAAAAAGGG + Intronic
906745667 1:48220714-48220736 CAGAAGGTAAAAAGGCAAAAGGG + Intergenic
907183207 1:52588803-52588825 CTGCATGTAGAATGGGAAAAGGG - Intergenic
907461082 1:54606104-54606126 CTGAAGGTGTCTTTGCAAAAAGG + Intronic
907489422 1:54799626-54799648 CTGAAGGTAGCCTGGCATTCAGG + Intronic
907971463 1:59386209-59386231 CTAAATGTAACATGGTAAAAAGG - Intronic
908100679 1:60787934-60787956 CTGAATGTAGTGTGGCAAAGTGG - Intergenic
909107691 1:71433106-71433128 CAGAAGGCAGAAGGGCAAAAGGG - Intronic
909531695 1:76689212-76689234 CTGAAGGTAATATAGCATAATGG - Intergenic
910391627 1:86751307-86751329 CTGTAGGTAGCATTGAAGAAGGG - Intergenic
912359312 1:109081755-109081777 CTGAAGGTAGAAAAGCAAAGAGG + Intergenic
912485534 1:110024595-110024617 CAGAAGGTAGAAGGGCAAAAAGG + Intergenic
912547528 1:110461642-110461664 CAGAAGGTAGAAGGGCAAAAGGG + Intergenic
912811602 1:112799259-112799281 CTGATGGAAGCATGGGAGAAGGG - Intergenic
916354239 1:163886257-163886279 CTGAAGTAAGCAGGGCAAGAAGG - Intergenic
916588511 1:166167357-166167379 CTGAAGGTAGGATACTAAAAGGG - Intergenic
916629802 1:166600210-166600232 CTGAAACATGCATGGCAAAATGG + Intergenic
917050618 1:170918227-170918249 CAGAAGGTAGAAGGGCCAAAAGG - Intergenic
917671435 1:177277426-177277448 CTGAAGCCAATATGGCAAAATGG + Intronic
917707137 1:177646031-177646053 CTGATGGTAGCAAGGAAGAATGG + Intergenic
917778976 1:178370844-178370866 CTGAAGTAAGCATGGAGAAAAGG + Intronic
919400759 1:197113401-197113423 CTGAAGGTAGCATGGCAAAAGGG + Intronic
920285167 1:204873915-204873937 CTGCAAGTAGCATGGCACAGTGG + Intronic
920679361 1:208060644-208060666 CTGAAGCTCCCATGGGAAAAGGG + Intronic
921261061 1:213385451-213385473 TTGAAGGCAGCATGGCATGATGG - Intergenic
921417244 1:214903456-214903478 CAGAAGGCAGAAGGGCAAAAGGG - Intergenic
921423606 1:214976943-214976965 CTGAACCTTGCATAGCAAAAGGG - Intergenic
921507754 1:215993470-215993492 CTGAAGTTAGCCTTGCACAAAGG + Intronic
921919511 1:220650633-220650655 CTGGAGGTAGCATGGCAAGAAGG + Exonic
922047430 1:221960132-221960154 CTGTAACTAACATGGCAAAAAGG + Intergenic
922580358 1:226692721-226692743 CTGAAGGTAGCATGTCACGCAGG + Intronic
922704372 1:227781360-227781382 CTGAAAGCAGCATGGCAAAGGGG - Intergenic
1064178661 10:13097027-13097049 CTGAAGGTAGGAAGCCCAAAGGG + Intronic
1065711141 10:28519250-28519272 CAGAAGGTAAAAGGGCAAAAAGG - Intergenic
1067654704 10:48182621-48182643 ATGAAGGCAGCATTGCCAAAAGG + Intronic
1067908377 10:50318320-50318342 CTGAGGCTAGGATGGTAAAATGG - Intronic
1067972379 10:50987464-50987486 TTGAAGGTAGCAAGGTAAAAAGG + Intergenic
1071291365 10:84191733-84191755 CTGCAGGTACCATGGCAAGGAGG + Intergenic
1071762454 10:88624094-88624116 ATGATGGGAGCATGGCAGAAGGG - Intergenic
1072684825 10:97529939-97529961 CTGGAGTTAGCCAGGCAAAAGGG - Intronic
1072764719 10:98086135-98086157 GTGAAGGTACCATGGGCAAAGGG - Intergenic
1073630417 10:105142566-105142588 CTGAAGCAAGCATGGCAATGAGG + Intronic
1073852395 10:107635897-107635919 CTAAATATAGCATGGCAACATGG + Intergenic
1074281491 10:112055873-112055895 CTGCAGGCAACATGGCAAAGTGG - Intergenic
1074715328 10:116213058-116213080 CTGATGGTAGGATTGTAAAAAGG + Intronic
1075244882 10:120812008-120812030 CTGGAGGCAGAAAGGCAAAAAGG - Intergenic
1077643478 11:3902807-3902829 CTGAAGGTAGCATTGCCAGAAGG + Intronic
1078648862 11:13168499-13168521 CAGAAGGAAGCAATGCAAAAAGG + Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079490690 11:20986124-20986146 CGGAGGGTAGCATGGCAAACTGG - Intronic
1080290405 11:30664633-30664655 CTTAAGGAATCATAGCAAAAGGG + Intergenic
1081239552 11:40687255-40687277 GGGAAGGTAACATGGCATAATGG - Intronic
1081677099 11:44976687-44976709 CTGCAGGGTGGATGGCAAAATGG - Intergenic
1082876306 11:57992429-57992451 CTCACTGCAGCATGGCAAAAAGG - Intergenic
1082882917 11:58055840-58055862 TAGAAGGTAGAAGGGCAAAAGGG - Intronic
1083041897 11:59696496-59696518 CTGTAGGTAGGAATGCAAAATGG - Intergenic
1087238198 11:95744680-95744702 CAGAAGGTAGAAGGGCAAAAAGG - Intergenic
1087722826 11:101686151-101686173 CTGAAGGTTGGAAGGCAACAGGG - Intronic
1087907777 11:103719353-103719375 CTTAATGTAGCATGACATAATGG - Intergenic
1088082110 11:105931114-105931136 ATGAATGAAGCATGGCAACATGG + Intronic
1089238746 11:117055838-117055860 CAGAAGGCAGAAGGGCAAAAAGG - Intronic
1089880853 11:121771994-121772016 CTCAGGGTAGGATGGCAAAGTGG + Intergenic
1090149860 11:124372444-124372466 CAGCAGATAGAATGGCAAAAGGG - Intergenic
1091756080 12:3052707-3052729 CAGAAGGCAGAAGGGCAAAAGGG - Intergenic
1092313727 12:7387645-7387667 CCTCAGGTAGCATGGCAAAAGGG - Intronic
1093269489 12:17041760-17041782 CAGAAGGTAGAAGGGCACAAAGG - Intergenic
1094216138 12:27944740-27944762 CTGAAGGAAGCAAGGGAAAGAGG - Intergenic
1096646410 12:53039624-53039646 CTGCAGGAAAGATGGCAAAAAGG + Exonic
1096987646 12:55771770-55771792 TGTAAGGTAGCATGGCAAAAAGG + Intronic
1097754628 12:63395998-63396020 CGGAAGGCAGAAGGGCAAAAGGG + Intergenic
1098067333 12:66632492-66632514 GGGAAGGAAGCATGGGAAAAAGG - Intronic
1098214740 12:68203740-68203762 CTGAAGGTAGCATCCCAATTTGG - Intronic
1099018348 12:77372617-77372639 CTGAAGGAAGCATGACAACGAGG - Intergenic
1099419958 12:82444801-82444823 CTGTAGGTAGCATGTAAGAATGG - Intronic
1099869079 12:88323248-88323270 GAGAAGGTAGCATGGAAAATTGG + Intergenic
1099913034 12:88856753-88856775 TTGAGGGTAGCAGAGCAAAAAGG + Intergenic
1102061006 12:109931015-109931037 CTGTGAGTAGCATGGGAAAAGGG - Exonic
1102382564 12:112479943-112479965 CTGAAAGTAGGATGTCAGAAAGG - Intronic
1102441803 12:112969406-112969428 CTGAATGCAGAATGGCAAAGTGG + Intronic
1102648881 12:114422595-114422617 TAGAAGGTAGCATGGAAAATTGG - Intergenic
1102648887 12:114422640-114422662 TAGAAGGTAGCATGGAAAATGGG - Intergenic
1104541898 12:129673392-129673414 ATGAAAGTAGAATGGAAAAACGG - Intronic
1106596278 13:31142135-31142157 CTGTAGGTAGGATGGTAAAACGG + Intronic
1106847952 13:33757331-33757353 CTCAAGGAAGCATGGTCAAACGG + Intergenic
1107424124 13:40275942-40275964 CTGAAAGTAGCTTGGGAACATGG + Intergenic
1107876080 13:44791560-44791582 CAGAAGGCAGCAGGGCAAAGAGG - Intergenic
1109988389 13:70019989-70020011 CAGAAGGCAGAAGGGCAAAAAGG - Intronic
1113083736 13:106545888-106545910 CTAAATGTAGCATAGGAAAAAGG - Intronic
1113179684 13:107611238-107611260 CTGTCGGTAGGATGGTAAAATGG + Intronic
1114554377 14:23553189-23553211 CTGAAGTTCACATGACAAAAAGG + Intronic
1118492562 14:66275615-66275637 TTGGAGGTGGCATGGCATAAGGG + Intergenic
1119593021 14:75908018-75908040 CTGAACATTACATGGCAAAATGG + Intronic
1119831740 14:77708933-77708955 CTGAAGTTAGTATGGGAAAAGGG + Intronic
1124829809 15:33137283-33137305 GTGAAGGTCCCATGGCAACAGGG - Intronic
1125495964 15:40194130-40194152 CTCAAGGCAGCATGTAAAAAAGG - Intronic
1125776855 15:42223596-42223618 CAGAAGGTGGAAGGGCAAAAGGG - Intronic
1126402339 15:48285381-48285403 CAGAAGGTAGTATGGATAAACGG + Intronic
1126493714 15:49267164-49267186 CTGAATACAGCATGGCCAAATGG + Intronic
1130887525 15:88106384-88106406 CCCAAGGCTGCATGGCAAAAGGG - Intronic
1133171419 16:3984723-3984745 CAGAAGGTTGCAAGGCCAAATGG - Intronic
1136393986 16:29982994-29983016 ATGGAGGTAGCATGGGAAGATGG - Intronic
1138331767 16:56221100-56221122 CAGAAGGTAGAAGGGCAAAAGGG - Intronic
1140162285 16:72509863-72509885 CTGTAGCAAGCATGACAAAATGG + Intergenic
1141568368 16:84918803-84918825 CTGATGGCAGCATGGAAAATGGG + Intronic
1143105188 17:4526246-4526268 GTGAAGGTAGCATGGGCAGAGGG + Intronic
1143452811 17:7046170-7046192 CTGATGGGAGGCTGGCAAAAGGG - Intergenic
1146531838 17:33614051-33614073 CTGTTGGTAGAAAGGCAAAATGG - Intronic
1146964666 17:37015484-37015506 CAGAAGGTGGAAAGGCAAAAGGG + Intronic
1148257750 17:46150704-46150726 CAGAGGGCAGCATGGCAAAGTGG + Intronic
1148524485 17:48318193-48318215 GTCAGGGCAGCATGGCAAAAGGG - Intronic
1151733126 17:75922652-75922674 CTGAAGGCAGGAAGGCACAAGGG - Intronic
1154287654 18:13075185-13075207 CAGAAGGCAGAAGGGCAAAAAGG - Intronic
1155865564 18:30960574-30960596 TTGAAGATAGTATGGCAAAAGGG - Intergenic
1156323928 18:36055902-36055924 CTTAAGGTAGCATTTCAAATGGG + Intronic
1157373164 18:47137075-47137097 TTGAAGGTGGCAGGGCAGAATGG + Intronic
1160342836 18:78104221-78104243 CTGAAGGTCTCATGGCAACGCGG - Intergenic
1164961647 19:32436117-32436139 CTGCAGGTTGCATGGCAGGAGGG + Intronic
1165205900 19:34185587-34185609 CTGAAGGTAGCATGGTAGAAAGG - Intronic
1165929127 19:39344671-39344693 CTGAAGGGATAATGGGAAAAGGG - Intronic
1167131754 19:47591285-47591307 CTGAAGGAAGCCTGTCATAAGGG + Intergenic
1167733245 19:51274559-51274581 CTGAAGGCAGCCTGGCATACCGG + Intergenic
925236204 2:2279744-2279766 ATGAACATAGAATGGCAAAATGG - Intronic
925571574 2:5317888-5317910 CTGGATGTAGCACTGCAAAATGG - Intergenic
928544301 2:32314875-32314897 ATGAAGGTAGCATGTCAAATTGG + Exonic
929754489 2:44752787-44752809 CAGAAGGCAGGAGGGCAAAAAGG + Intronic
930578092 2:53176953-53176975 CAGAAGGTAGAAAGGCAAGAGGG - Intergenic
932098911 2:68878537-68878559 CAGAAAGTTGCATGCCAAAAGGG + Intergenic
935359012 2:102231961-102231983 CTGAGGGTAACATGGGTAAATGG + Intronic
935583596 2:104781218-104781240 CTGCTGGTAGGATTGCAAAATGG + Intergenic
936596886 2:113856683-113856705 CAGAAGGCAGCAGGACAAAAAGG - Intergenic
939244372 2:139604346-139604368 CTGAAGGAAACATGGACAAATGG - Intergenic
939668251 2:144977357-144977379 CTGTACATAGTATGGCAAAAGGG + Intergenic
940478726 2:154200638-154200660 CAGAAGGTAGAAGGGCAAGAGGG + Intronic
940962474 2:159800637-159800659 CTGTAGTTAGGAGGGCAAAAGGG - Intronic
942340572 2:174941165-174941187 CTGATGGAAACATGTCAAAAAGG - Intronic
942484708 2:176426798-176426820 CTGAAGATGGCTTGGCAGAAAGG - Intergenic
943651406 2:190461648-190461670 CAGAAGGCAGAAGGGCAAAAGGG + Intronic
944568346 2:201015256-201015278 CTGTAGGAAGCAAGGTAAAAAGG - Intronic
945196644 2:207243167-207243189 CTGATGGTAGGAAGGCAAATGGG - Intergenic
946049098 2:216846856-216846878 GAGAAGGTAGAAGGGCAAAAAGG + Intergenic
947689313 2:232120269-232120291 CTGAAGGTAGTGTGGCAGCATGG + Intronic
947900864 2:233720344-233720366 GTGATGGTTGCATGTCAAAAGGG + Intronic
1169311833 20:4549207-4549229 ATGAAGGCAGTATGGCAAAGTGG - Intergenic
1170298948 20:14860636-14860658 CTGAAAGCAGCAGGACAAAATGG + Intronic
1170899320 20:20445338-20445360 CTGAATTTTGCATGGCAGAAAGG + Intronic
1172890920 20:38263542-38263564 ATGCAGGTAGCATAGCAAAGTGG - Intronic
1172934484 20:38609887-38609909 CTGAAGGTAGGATGACAATCTGG + Intronic
1173607122 20:44339294-44339316 CTCAGGGTAGCAAGGCAACAAGG - Intronic
1173638090 20:44578568-44578590 CGGAATGTTGCATGGCAAGATGG - Intronic
1173759576 20:45547625-45547647 CTGAAGGTAGCCTGGAAAGTGGG - Intronic
1176272769 20:64245037-64245059 CTGAAGGTCACATGGCCATACGG + Intergenic
1179520951 21:41944183-41944205 CAGAAGGTAGCAAGGGAAGAGGG - Intronic
1180045894 21:45304993-45305015 CAGAAGGCAGGAGGGCAAAAGGG - Intergenic
1180689478 22:17699957-17699979 CTGAAGATAGCATGCCAAATAGG + Intronic
1181537242 22:23552819-23552841 CTGAAGGATGGATGGAAAAATGG - Intergenic
1181875179 22:25935163-25935185 CTGAAGCTAGCTTGGGAGAAGGG + Intronic
1183439268 22:37814080-37814102 CTCAAGGCACCATGGCACAATGG - Intronic
1183496954 22:38151997-38152019 TTGAAGGTAGCCTGGAACAAAGG + Intronic
1184921075 22:47606250-47606272 CTGAGGGTAGCAGAGCACAAAGG - Intergenic
950018625 3:9770618-9770640 CTGAAGGAAACAGGCCAAAAAGG + Intronic
951283039 3:20776210-20776232 ATGCAGGTGGCCTGGCAAAATGG - Intergenic
951598770 3:24348562-24348584 CAGAAGGCCGCATGGGAAAAGGG - Intronic
954999453 3:54913575-54913597 CTGAAGGAGCCAAGGCAAAATGG - Intronic
955369003 3:58334399-58334421 CTAAAGGGAGTATGGCATAAGGG + Intronic
956815737 3:72906675-72906697 CTGAAGTTAGCAAGGAAAAGAGG + Intronic
957521271 3:81321369-81321391 ATGGAGGTAGCATGGCTTAATGG + Intergenic
958196484 3:90247475-90247497 GAGAAGGTAGTAAGGCAAAAGGG + Intergenic
958419677 3:93916109-93916131 CAGAAGGTAGTAAGGCAAAAGGG + Intronic
960299514 3:115985049-115985071 CTGAAGGTATCAGAGCCAAAAGG + Intronic
962540505 3:136376720-136376742 CTGAAGGTAAGATGATAAAAGGG + Intronic
963716212 3:148807367-148807389 CTGAAGTTCGCATTTCAAAAGGG + Intronic
964093995 3:152910434-152910456 CAGAAGGTAGAAGGGCAAAACGG + Intergenic
965117696 3:164513547-164513569 CTCAGGGAAGCAAGGCAAAATGG - Intergenic
965616488 3:170598298-170598320 CTCAAGGTTGCATGGCAAATTGG - Intronic
967090438 3:186130350-186130372 CAGAAGTTAACATGACAAAATGG + Intronic
969909354 4:10429014-10429036 CAGAAGGTAGCAGGATAAAAAGG - Intergenic
970030388 4:11667377-11667399 CTGCAGGGAGCATGGTAAAAAGG + Intergenic
970404267 4:15747316-15747338 ATAAAGGCAGCATGGCAAACAGG - Intergenic
970653756 4:18207452-18207474 CTGTTGGTAGGATTGCAAAATGG + Intergenic
971248904 4:24955259-24955281 CAGAAGGCAGAAGGGCAAAAAGG + Intronic
971302744 4:25455467-25455489 CAGAAGGCAGAAGGGCAAAAGGG + Intergenic
971574825 4:28258991-28259013 CAGAAGGCAGAAAGGCAAAAAGG - Intergenic
972854620 4:43091628-43091650 CTGAAGGTAGCAGGGAGAAAAGG + Intergenic
974198590 4:58610116-58610138 CTGAAGGTAAAAGGGCAAAAGGG - Intergenic
976876780 4:89862811-89862833 CTGAGAGTAGCATCTCAAAAGGG - Intergenic
976881792 4:89934023-89934045 CTAAATGTAGCATGAAAAAAAGG - Intronic
977559611 4:98519040-98519062 CTGCAGGTAGCAAGACAAATTGG + Intronic
978964440 4:114724588-114724610 CAGAAGGGAGGAGGGCAAAAGGG - Intergenic
979471195 4:121099173-121099195 CTGAAGGTACCACAGTAAAATGG - Intergenic
979583186 4:122384365-122384387 CCTAAGGTAGCATAGCAAATAGG + Intronic
980021377 4:127714341-127714363 ATGAAGGAAGCAGGGGAAAAAGG - Intronic
981750666 4:148090323-148090345 CTGAAGGTCGCATGGCCATTGGG + Intronic
984166446 4:176308129-176308151 GTGAAGGTAACAAGGCAATATGG - Intergenic
984385799 4:179056036-179056058 CAGAAGGTAAAATGGCAAAAAGG - Intergenic
984719924 4:182960730-182960752 CTGAAGGGAGCAAGGCAAAGTGG - Intergenic
985375308 4:189330904-189330926 CTGAAGGGAGCATTAAAAAAGGG - Intergenic
986291551 5:6403620-6403642 GGAAGGGTAGCATGGCAAAAAGG + Intergenic
987500325 5:18700730-18700752 CTGAAGGTGGAAAGGAAAAAGGG + Intergenic
988222421 5:28365991-28366013 ATGTAGATAGCATGGCCAAATGG + Intergenic
988334333 5:29886458-29886480 TTTAAGCTACCATGGCAAAATGG + Intergenic
991948466 5:71925010-71925032 CTGAAGGAATCAAGCCAAAAAGG + Intergenic
993185050 5:84606650-84606672 CTCAAGTTTGCATGGGAAAAAGG + Intergenic
993335097 5:86647037-86647059 TTGTAGGTGGAATGGCAAAATGG + Intergenic
995730490 5:115235121-115235143 ATGAGGGTAACATGTCAAAAGGG + Intronic
995947693 5:117669654-117669676 CTGAAGGGAGAATGGGTAAAGGG - Intergenic
996260079 5:121456557-121456579 CTGAACCTTGAATGGCAAAATGG + Intergenic
998662506 5:144255430-144255452 CTGTTGGTAGGATTGCAAAATGG - Intronic
1000337848 5:160254693-160254715 CTGCAGGGAGCAAGGCAAACAGG - Intronic
1002124871 5:177035404-177035426 GTGCAGATATCATGGCAAAAAGG + Intronic
1003135084 6:3428793-3428815 TTGAAGGCAGCATGCCTAAAAGG + Intronic
1004313618 6:14567158-14567180 CTGATGGAAGCATGACAAATGGG + Intergenic
1005287347 6:24342202-24342224 CTGAAGGTAGCATAGCACCCTGG - Intronic
1005762311 6:28978389-28978411 CTGAATATAGCATGGGCAAATGG - Intergenic
1006587498 6:35126338-35126360 CTGACAGAAGCATGGCAAACAGG - Intronic
1009658790 6:66582003-66582025 CAGAAGGCAGAAGGGCAAAAAGG + Intergenic
1010446262 6:75952024-75952046 CCCAAGGTAGCAATGCAAAATGG - Intronic
1010850090 6:80764259-80764281 CTCAAGGAAGAATGGGAAAAGGG + Intergenic
1012227403 6:96719927-96719949 CTGAAGGTATCATAGATAAAGGG - Intergenic
1012583349 6:100894458-100894480 TTGAAAGTGGCAAGGCAAAACGG - Intergenic
1012874270 6:104707702-104707724 TAGAAGGTAGAAGGGCAAAAAGG + Intergenic
1013320837 6:108987415-108987437 CTAAAGGAATCATGGCACAATGG + Exonic
1013342057 6:109224529-109224551 CTGCAGGTGGCCTGGGAAAAAGG - Intergenic
1015186257 6:130419965-130419987 TGGAAGGTAGAAAGGCAAAAGGG + Intronic
1015204322 6:130617811-130617833 CAGAAGGTGGCAAGGCAAAAGGG + Intergenic
1015301825 6:131661319-131661341 CTGTTGGTAGAAAGGCAAAACGG - Intronic
1018167092 6:161108342-161108364 CTGGAGGTAGGATGGGGAAAGGG + Intronic
1018398616 6:163400754-163400776 CTCATGGTAGCATGATAAAATGG + Intergenic
1018692118 6:166354872-166354894 CTGCAGGTAGACCGGCAAAAGGG + Intergenic
1021022647 7:15622928-15622950 ATCAAGGTAGAATGGAAAAATGG + Intronic
1021209146 7:17823754-17823776 ATGGAGTTAGCATGGCAACAAGG + Intronic
1021973041 7:25984074-25984096 CTGAAGTTAGAATGGCTGAAGGG + Intergenic
1022186458 7:27974214-27974236 CTGAAGGAAGCATGGGACTAGGG + Intronic
1022945468 7:35279610-35279632 CTTAAAGTAGCCTGGCAAAAGGG - Intergenic
1023312169 7:38898729-38898751 CTGAAGGAAACAAAGCAAAAAGG + Intronic
1023342756 7:39239269-39239291 CTCAATGTAGAATGGCCAAATGG + Intronic
1028761210 7:94498255-94498277 AAAAAGGTAGCTTGGCAAAAAGG + Intergenic
1031099008 7:117455572-117455594 ATGAAGGTAGAAAGGCAAAATGG + Intergenic
1031458271 7:122011507-122011529 CTGAAGGAAGCAGAGGAAAATGG - Exonic
1032463248 7:132127111-132127133 CTTAAGGTAGCAGGGAAGAAGGG - Exonic
1033521528 7:142165962-142165984 CTGAATATCTCATGGCAAAATGG + Intronic
1034824384 7:154248350-154248372 ATGAAGGAAGCCAGGCAAAAAGG + Intronic
1036171582 8:6491105-6491127 TTCAAAGTAGTATGGCAAAAAGG + Intronic
1037698775 8:21252773-21252795 CTGAGGGAAGCAAGGCAATAGGG + Intergenic
1040853835 8:51928535-51928557 GTGAAGGAAGCATGGCCACATGG + Intergenic
1041110023 8:54475307-54475329 CTGAAGAGAGCTTGGGAAAAAGG + Intergenic
1042215004 8:66422311-66422333 TTGAAGGCTGCATGGCAACAAGG + Intergenic
1043864237 8:85357591-85357613 TTGAAGGTAGCAGGGAAAAGGGG + Intronic
1044025291 8:87162772-87162794 CAGAAGGCAGAAGGGCAAAAGGG + Intronic
1044593953 8:93940693-93940715 CTGTAGGTAGTATTGGAAAAGGG + Intergenic
1044899716 8:96931203-96931225 TTGAAGCTAGCATGGCTATAAGG - Intronic
1045444135 8:102242539-102242561 TTGAAGGTGGCAGGGCAGAATGG - Intergenic
1045801117 8:106102762-106102784 CTTAAAGTAGCTTGGCCAAATGG + Intergenic
1046089634 8:109485665-109485687 ATGAAGGTACCATGCCAAATGGG - Intronic
1047014639 8:120710644-120710666 CAGAAGGCAGAAGGGCAAAAAGG - Intronic
1047165739 8:122436426-122436448 GTAAAGGTAGCATGGAAATAAGG - Intergenic
1047307468 8:123664543-123664565 CTGAAAGGGGCATGGCAAAGTGG + Intergenic
1048367072 8:133747360-133747382 CAGAAGGCAGAAGGGCAAAAGGG - Intergenic
1048841969 8:138574548-138574570 CAGAAAGTAGAAGGGCAAAAAGG + Intergenic
1051375737 9:16400548-16400570 CTGAAGGTGGAAGGGCAAGAGGG + Intergenic
1051572328 9:18573426-18573448 CTTAAGGCAGCATGGCAGAATGG - Intronic
1051605690 9:18916038-18916060 CAGAAGGTAGAAGGGCAGAAAGG - Intergenic
1051809955 9:21037267-21037289 AAAAAGGAAGCATGGCAAAATGG - Intergenic
1051963958 9:22803210-22803232 CAGAAGGCAGAAGGGCAAAAAGG + Intergenic
1052031516 9:23634761-23634783 CAGAAGGTAGCAAGGGAAGAGGG + Intergenic
1053604372 9:39641864-39641886 CAGAAGGTAGCACGGCAAGAGGG + Intergenic
1053862191 9:42397905-42397927 CAGAAGGTAGCATGGCAAGAGGG + Intergenic
1054249168 9:62700550-62700572 CAGAAGGTAGCACGGCAAGAGGG - Intergenic
1056743643 9:89282023-89282045 CAGAAGATAGAAGGGCAAAAGGG - Intergenic
1058109577 9:101017717-101017739 GTGAAGGCAGAAGGGCAAAAAGG + Intergenic
1058603854 9:106699940-106699962 CTGAAGGGAGCATGGGAAGAGGG - Intergenic
1060801349 9:126547705-126547727 CTGAAGGGGGCATGGCACAAAGG - Intergenic
1061471938 9:130834187-130834209 ATGAAGGTAACATGGCACATAGG + Intronic
1061650294 9:132042416-132042438 CTGCAGGTCACAAGGCAAAAAGG + Intronic
1186398558 X:9235135-9235157 ATGAAGGCTGCATGGCAGAATGG + Intergenic
1189124772 X:38434818-38434840 CAGAAGGCAGAAGGGCAAAAGGG + Intronic
1189666345 X:43358894-43358916 CAGAAGGTAGAAGGGCAAAAGGG + Intergenic
1192204026 X:69084304-69084326 CTGAGGGTAGGTTGGCAAAGTGG + Intergenic
1192405898 X:70885983-70886005 CTGTTGGTAGGATGGTAAAATGG + Intronic
1193294721 X:79820913-79820935 CAGTAGGTGGCATGGCAAGAAGG + Intergenic
1193553474 X:82927794-82927816 CTAAAGGTAGCATAGCTACAAGG + Intergenic
1195265923 X:103179652-103179674 CAGAAGGTGGAAGGGCAAAAGGG + Intergenic
1195577228 X:106464854-106464876 CTGAAGGTAGACTGGCAATCAGG - Intergenic
1196247845 X:113421759-113421781 CTGAAGGTTGCTTGGCAAGCAGG - Intergenic
1196270276 X:113702439-113702461 CTGGTGGTAGGATAGCAAAATGG - Intergenic
1197000794 X:121437287-121437309 CAGAAGCTAGCATGATAAAAAGG - Intergenic
1197820873 X:130539479-130539501 CTGAAGCAAATATGGCAAAATGG + Intergenic
1197995082 X:132364366-132364388 ATGATGGTAGCCAGGCAAAAAGG + Intergenic
1198450621 X:136763940-136763962 ATAAAGGTAGCTTGGCACAAGGG + Intronic
1198484436 X:137072714-137072736 CTGAAGGCAGCCTAGCAAGAGGG + Intergenic
1198840656 X:140853807-140853829 CTGAAGGTAGCAGTGTAAAGTGG - Intergenic
1199117785 X:144012871-144012893 CTGAAGGCAAGAAGGCAAAAGGG - Intergenic
1201406350 Y:13653876-13653898 CTGGGAGAAGCATGGCAAAATGG - Intergenic