ID: 919401339

View in Genome Browser
Species Human (GRCh38)
Location 1:197121208-197121230
Sequence TAGTTTGTTCAACTTGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919401339 Original CRISPR TAGTTTGTTCAACTTGATCA AGG Intronic
907539860 1:55204800-55204822 TATTTTGTTAAACTGGGTCATGG + Intronic
912196792 1:107407055-107407077 TAGGTTGTGCATATTGATCACGG - Intronic
914948837 1:152091886-152091908 GAGTTTGTTCAAGATGATGATGG + Intergenic
916921121 1:169468061-169468083 TAGTATGTGTGACTTGATCAGGG - Intronic
917056348 1:170986095-170986117 TAGTTCTTGCACCTTGATCATGG + Intronic
917059704 1:171023601-171023623 TATTTTGTTCAGCTTTATTAAGG + Intronic
919163359 1:193860663-193860685 TATTTTGTTCCACATGATCGAGG + Intergenic
919401339 1:197121208-197121230 TAGTTTGTTCAACTTGATCAAGG + Intronic
923983673 1:239355118-239355140 TATTTTCTTCAACTGGATCCAGG + Intergenic
1063474610 10:6317474-6317496 TAGATTGTCCAACTCAATCAGGG + Intergenic
1066562441 10:36684860-36684882 TAGTTTTTGCATCTTTATCAGGG - Intergenic
1068125740 10:52840196-52840218 TTATTTGTTCAAATTGAACATGG + Intergenic
1068182471 10:53539082-53539104 TTGTTTGTTCATTTTGACCACGG - Intergenic
1068423908 10:56831542-56831564 TAGTTTTTTTCTCTTGATCATGG - Intergenic
1070872566 10:79769753-79769775 TAGTTTGTGCTACTTTATTATGG - Intergenic
1071036604 10:81254692-81254714 TAACTTACTCAACTTGATCAAGG + Intergenic
1073644091 10:105281734-105281756 TGCTTTGTTCAAGTTTATCAAGG + Intergenic
1074183252 10:111081081-111081103 AAGTTTGTTAACCTTGCTCAAGG + Intergenic
1078801672 11:14651018-14651040 TAGTTTGTGCTACTTTGTCATGG - Intronic
1079229866 11:18640435-18640457 TAGTTTCTTTGACTTAATCATGG - Intergenic
1085660329 11:78358973-78358995 TAATCTGTTTAACTTGACCATGG - Intronic
1087111744 11:94477358-94477380 TAGTTTCTTTCACTAGATCAAGG - Intronic
1088417675 11:109607463-109607485 AAGTTTGGTCAACTTCACCAAGG + Intergenic
1089024329 11:115253072-115253094 TTGTTTGTTTAACCTTATCAGGG - Intronic
1091950488 12:4588915-4588937 TATTTTCTTCCACTTGATCCAGG + Intronic
1093113915 12:15186090-15186112 TTGTTTGTTCAACTTTTTAATGG - Intronic
1101548974 12:105743943-105743965 TAGCTTGGTCAAGTTGATAACGG + Intergenic
1102062593 12:109944902-109944924 AAATTTGTTCAATTTGTTCAGGG - Intronic
1104869855 12:131987213-131987235 TATTTTGTTCAACTTCATTAGGG + Intronic
1108807123 13:54171840-54171862 TAGTTTGCTTAACTTTTTCAAGG - Intergenic
1112881038 13:104107050-104107072 TAATTTGTTCTATTAGATCATGG - Intergenic
1114860780 14:26518166-26518188 TACTTTCTTCATCTTGAACAGGG - Intronic
1114966045 14:27961412-27961434 TAGTTTGATCTCCTTAATCATGG + Intergenic
1115956455 14:38786003-38786025 TAGTATGTTCAACTTTATTTAGG - Intergenic
1118453164 14:65922513-65922535 TAGTTTGTTCACCTGGAAAATGG + Intergenic
1119589121 14:75868482-75868504 TAGTTTGGTAAACTTGGACATGG - Intronic
1124177968 15:27443795-27443817 AAATTTCTTCAACTTGATAAAGG - Intronic
1125106503 15:35977895-35977917 TATTTTGTTCAACTGGCTCATGG - Intergenic
1125167058 15:36719272-36719294 GAGTTTCTTCAACCTGATAAAGG - Intronic
1126419264 15:48454568-48454590 TAGATTGTTCCACTGGAGCAGGG - Intronic
1126651080 15:50921934-50921956 TAGTTTGTTGACCTTGATATTGG + Intronic
1127301225 15:57655610-57655632 TAGTTTCTTAAAACTGATCATGG - Intronic
1131341681 15:91608468-91608490 TACATTGGTCAACTTGTTCATGG - Intergenic
1140324622 16:73989768-73989790 GAGTTTATTCAACCTGATAAAGG + Intergenic
1144254054 17:13448104-13448126 TAGTTTTCTCAACTTAATAACGG - Intergenic
1144492375 17:15724568-15724590 TAGTTTGTTCAACAAGAGAAAGG - Intergenic
1144908096 17:18654619-18654641 TAGTTTGTTCAACAAGAGAAAGG + Intronic
1146193669 17:30792677-30792699 TATTTTATTGAACTTGACCATGG - Intronic
1146426881 17:32748784-32748806 TAATTTGTTCAACTTAAAAATGG - Intronic
1147347070 17:39806084-39806106 TAGTTAGTACAACTTGAACCTGG - Intronic
1153181491 18:2440103-2440125 TAGTGTGGCCAACTTCATCAAGG + Intergenic
1153894982 18:9550676-9550698 TAGTATGTTCAACTGGAACATGG + Intronic
1155859489 18:30879095-30879117 TCGTTGGTTCAGCTTGACCATGG - Intergenic
1157117751 18:44878064-44878086 AAATTTTTTCCACTTGATCAAGG + Intronic
1157409498 18:47451974-47451996 GAGTTGCTTCAACTTGATCTTGG + Intergenic
1159421994 18:68233568-68233590 TAATTTGTTCTACTTGTACAAGG + Intergenic
1160315654 18:77843446-77843468 TAGTTTCTTCCACTTCATCGGGG + Intergenic
1166711559 19:44940941-44940963 CAGTTTGTTCAACTGTAACACGG - Intergenic
925422240 2:3722154-3722176 GAGGTTATACAACTTGATCAAGG + Intronic
926008383 2:9390037-9390059 TATTTTGTTCCACTGGGTCATGG + Intronic
928072721 2:28233492-28233514 TAGTTTATTCAGCATGATCAGGG + Intronic
928076753 2:28272250-28272272 TAGTTTTTACAACTTTTTCATGG - Intronic
929679095 2:43970610-43970632 TAGATTGATCAACTTTCTCATGG - Intronic
930789799 2:55313407-55313429 TAGTTTTTGTAGCTTGATCAAGG + Intronic
932101096 2:68899972-68899994 TAGTTGGCAAAACTTGATCAGGG + Intergenic
935461652 2:103342902-103342924 TATCTTGTTCAACTTGATAAGGG - Intergenic
938748038 2:134299472-134299494 CAATTTATTCAACTTGATGAAGG - Intronic
942501863 2:176599612-176599634 AAGTTTCTTCAGCTTGTTCATGG - Intergenic
943231780 2:185263623-185263645 TTATTTTTTCAACTTGGTCAAGG + Intergenic
945549673 2:211205249-211205271 CAGTTTGTTGAACTTAATTATGG - Intergenic
946196855 2:218038048-218038070 TACTTTGTTCTTCTTGATCTTGG + Intronic
946828539 2:223704314-223704336 GAGTTTAAGCAACTTGATCAAGG + Intergenic
948059925 2:235035237-235035259 TAGTTCTTTAAACTTCATCATGG + Intronic
1170388369 20:15845468-15845490 TACTGGGTTCACCTTGATCAAGG + Intronic
1174729796 20:52904688-52904710 TAGTTTGTTCTACCTGATTTAGG - Intergenic
1177384749 21:20393982-20394004 CTGTTTGTTCAACTTTTTCAGGG + Intergenic
950385738 3:12658221-12658243 TTATATGTTAAACTTGATCATGG - Intronic
951663704 3:25098551-25098573 TAGTTTGTTAATCCTGATCTAGG - Intergenic
956472913 3:69587610-69587632 TAGTAAATTCCACTTGATCATGG - Intergenic
957688258 3:83533080-83533102 TAATTTTCTCAACTTGATAAAGG - Intergenic
958526983 3:95274653-95274675 TAGTTAGTTTATCTTGATCGAGG + Intergenic
958946970 3:100373612-100373634 CTGCTTCTTCAACTTGATCAAGG + Exonic
959529170 3:107413064-107413086 TATTTTGTTTCACTTTATCATGG - Intergenic
960775615 3:121248505-121248527 TGGTTTGTTCAAGTTCCTCATGG + Intronic
961425501 3:126843070-126843092 AAGTTTCCTCAACTTGATGAAGG - Intronic
962564930 3:136648207-136648229 TAGTCTTTTCAACTAGACCATGG + Intronic
963184100 3:142393773-142393795 TACTTTGTTCAATTTTATCTAGG + Intronic
964299267 3:155270355-155270377 TAGTTTTTTCAACTATAACACGG - Intergenic
965413748 3:168366301-168366323 TTGTTTGTTTAACTTCAGCAAGG + Intergenic
966003866 3:174983869-174983891 TAGTTTCTTCAAGATGAGCAAGG + Intronic
967536675 3:190612644-190612666 AAGATTTTTCAACTTGATCATGG + Intronic
969236468 4:5868845-5868867 CAGTTTGGTCATCTTTATCAAGG - Intronic
969408062 4:7008039-7008061 TAGTTTGTTCATCTGTAACAGGG + Intronic
971533307 4:27716519-27716541 TAGTTAGTTCAACTTCTTCAAGG - Intergenic
975964181 4:79949803-79949825 AAATTTGATCAACTTGTTCAGGG - Intronic
978506101 4:109458143-109458165 AAGGTTGGTCAACTTAATCAAGG + Intronic
978595888 4:110376733-110376755 TAATTTCTTAAACTTGATGAGGG + Intronic
979209759 4:118085598-118085620 GAGAGTGTTCAACTTGAACAAGG - Intronic
980373200 4:131906628-131906650 GAGTTTGTGCTACTTTATCATGG - Intergenic
980423601 4:132595576-132595598 TAGTTTGTTCAATATAATTAGGG - Intergenic
982504199 4:156197177-156197199 TAATCTGTTCAAATAGATCATGG - Intergenic
988622705 5:32840149-32840171 TAGTATGTTTAACTTCAGCATGG + Intergenic
990485325 5:56252741-56252763 TTGTTTGTTTAACTGGATGAAGG - Intergenic
992119983 5:73583073-73583095 TAGTCTGTTCAACTCAATGAGGG + Intronic
992713682 5:79487344-79487366 TTGTATGTTCAAGTTGATCATGG - Intronic
992935445 5:81698887-81698909 AATTTTGTTCAGATTGATCAAGG - Intronic
993651343 5:90526452-90526474 TAGATAGATCAACTTGATGATGG - Intronic
993736397 5:91481267-91481289 TAGTTTTTGCTACTTTATCAAGG - Intergenic
1000600429 5:163267573-163267595 TAGTTTGTTAAAGTTTATTACGG - Intergenic
1001688146 5:173611093-173611115 TAGTTTGTTTCCCCTGATCAGGG - Intronic
1004911158 6:20285692-20285714 TAATTTATTCAACTTGATAAAGG + Intergenic
1005591200 6:27329433-27329455 CAGTTTGTGAAACTTCATCAAGG + Intergenic
1006264405 6:32906228-32906250 TAATTTTTACAACTTCATCAAGG + Intergenic
1012028363 6:94027261-94027283 TTCTTTATTCAACTTGATAAAGG + Intergenic
1012237256 6:96833266-96833288 TTTTTTGTTCAAGTTGATCCTGG - Intronic
1017928787 6:158934430-158934452 TAGCTTTTTCTTCTTGATCATGG - Intergenic
1018405495 6:163477476-163477498 TACTTTGTTAAAATGGATCATGG + Intronic
1018493921 6:164327868-164327890 TATTATGTTCCACTTGTTCAAGG + Intergenic
1019979599 7:4611616-4611638 TTGTATGTTCAACTTGATTAAGG - Intergenic
1020771483 7:12401052-12401074 AAGTTTCCTCAACTTGATAAAGG + Intronic
1022195207 7:28058542-28058564 TAGTTTAACCAACTTGATCAGGG + Intronic
1022881824 7:34595671-34595693 TAGTCTTTTCAACTAGACCAGGG + Intergenic
1023061281 7:36329591-36329613 TACTTTATTCAACTTTTTCATGG - Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1027711144 7:81602826-81602848 TAGTTTTTTAAACATGCTCATGG - Intergenic
1028140566 7:87270088-87270110 TAGTTTAATCAACTGGCTCATGG - Intergenic
1033419168 7:141190707-141190729 TAGATTGTTCAACTTTACCATGG - Intronic
1034328459 7:150259903-150259925 TAGTATGTTCACTTTGCTCATGG + Intronic
1034659415 7:152756614-152756636 CAGTTTGTTCTACTTTGTCATGG + Intergenic
1035069816 7:156135417-156135439 TAATTTATTTAACTTGATAAGGG - Intergenic
1038881827 8:31622959-31622981 TAATTTGTTCAACCTTATTAAGG - Intergenic
1041616360 8:59911659-59911681 TAGATTGTTCATCATGACCAAGG + Intergenic
1042282990 8:67075326-67075348 TGGTTTGTTCAAGATGATCCTGG + Intronic
1043156584 8:76788840-76788862 TAAATTGTTTAACTTGATTATGG + Intronic
1044169518 8:89031751-89031773 AAGTTAGTTCATCATGATCAAGG + Intergenic
1046049100 8:109000072-109000094 TAGTTTGTTATACTTCATTATGG - Intergenic
1046743308 8:117851048-117851070 GAGATGTTTCAACTTGATCAAGG + Intronic
1047208016 8:122819015-122819037 TAGTTTGTTCTAGATGCTCAGGG + Intronic
1047822545 8:128537297-128537319 CAGTTTGACCAACTTGTTCAAGG - Intergenic
1050442188 9:5676492-5676514 TAGTTTGCTCAACTGTATGATGG - Intronic
1053638194 9:40036801-40036823 GAGTTTGTGCTACTTTATCATGG - Intergenic
1053767888 9:41428419-41428441 GAGTTTGTGCTACTTTATCATGG + Intergenic
1054318988 9:63633404-63633426 GAGTTTGTGCTACTTTATCATGG - Intergenic
1054546556 9:66339923-66339945 GAGTTTGTGCTACTTTATCATGG + Intergenic
1056231901 9:84555275-84555297 TAGGTTGATCAACTTAAGCAAGG - Intergenic
1056389191 9:86124918-86124940 GAATTTCTTCAACTTGATAAAGG + Intergenic
1056507388 9:87270144-87270166 TAATGTGTTCTACTTGATTAGGG - Intergenic
1059715728 9:116911565-116911587 TAGTTTTTACAACTGTATCATGG + Intronic
1059841365 9:118221226-118221248 TAGTTTGTTCAATTATAACATGG + Intergenic
1060124653 9:121031578-121031600 GAGGTTGTTCTGCTTGATCAGGG + Intronic
1060440807 9:123637279-123637301 AAGTTTGTTCATTTTGACCAGGG + Intronic
1060481750 9:124020346-124020368 TAATTTGCTCCACTTGTTCACGG + Intronic
1187909423 X:24097175-24097197 TAACTTCTTCAACTTGATAAAGG - Intergenic
1188906346 X:35796716-35796738 TATTTTCTTAAACTAGATCAAGG - Intergenic
1189269183 X:39738748-39738770 TCTTTTGTTCAACATTATCATGG - Intergenic
1190471748 X:50787416-50787438 TATATTGGTCTACTTGATCATGG - Intronic
1190773229 X:53532471-53532493 CAGTTTGTTCCCCTTGAGCAAGG + Exonic
1191613605 X:63143391-63143413 AAGTTTGTTGAGCTTCATCAAGG - Intergenic
1191622692 X:63235536-63235558 AAGTTTGTTGAGCTTCATCAAGG + Intergenic
1194577164 X:95627305-95627327 TAATTGGTTCACCTTGTTCATGG - Intergenic
1194649083 X:96493565-96493587 ATCTTTGTTCAACTTGTTCATGG - Intergenic
1196320098 X:114276573-114276595 TACCTTGTTCATCTTGTTCATGG + Intergenic
1196506545 X:116451059-116451081 TATATAGTTCAACTTGATGATGG + Intronic
1197327115 X:125107684-125107706 TAGTTTGTAGAAATTCATCAAGG + Intergenic
1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG + Intergenic