ID: 919401642

View in Genome Browser
Species Human (GRCh38)
Location 1:197125918-197125940
Sequence TGGGTTGGTCTACAATTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919401642 Original CRISPR TGGGTTGGTCTACAATTGAC TGG (reversed) Intronic
901088544 1:6626487-6626509 TGATTTGTTCTACAATTGAAGGG + Intronic
905155094 1:35970935-35970957 TGGGTTGGTTTAAAATTCCCTGG + Intronic
910062879 1:83114613-83114635 TGGATCAGTGTACAATTGACAGG + Intergenic
912689821 1:111796380-111796402 TGGTCTGGTCTACCATTGATAGG - Intronic
917074131 1:171186015-171186037 TGGGTTGGGTTAGTATTGACTGG - Intronic
919401642 1:197125918-197125940 TGGGTTGGTCTACAATTGACTGG - Intronic
922931914 1:229396729-229396751 TGGGTTGGTTTGCATTTGAAAGG - Intergenic
1064341445 10:14489276-14489298 TGGGTTGGTCTACAGATTACAGG - Intergenic
1069103251 10:64350762-64350784 TGAGTTGGTTAAAAATTGACTGG - Intergenic
1080659709 11:34285878-34285900 TGGGATGGTCTAAACTTGATGGG + Intronic
1086535888 11:87845193-87845215 TGAGTTGGGCTACATTTGCCTGG - Intergenic
1089485984 11:118846532-118846554 TAGGTTGGTCCCTAATTGACTGG - Intergenic
1091982449 12:4877385-4877407 TTGGTTGGTTTGCATTTGACAGG - Intergenic
1092460132 12:8679094-8679116 TGGTTTGCTCTTCAATTCACCGG - Intergenic
1095384419 12:41633773-41633795 TTGGTTTGTCTAAAAATGACTGG - Intergenic
1102597710 12:114005568-114005590 TCGGTTGGTTTACACATGACAGG + Intergenic
1112285978 13:98104705-98104727 TGGGTTGGTTTGCATTTGAAAGG + Intergenic
1113460131 13:110476518-110476540 TGGGTTGGTCCAAGACTGACCGG + Intronic
1126171727 15:45700864-45700886 TGGGCTGGTTTACAAATGAGGGG - Intergenic
1133243489 16:4430641-4430663 TGGGTTGTTCTAAAAAGGACAGG + Intronic
1133542994 16:6774221-6774243 TGGTTTTGTCTACATTTGAAAGG + Intronic
1142990594 17:3728160-3728182 ATGGATGGTCTGCAATTGACAGG + Exonic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144327404 17:14195061-14195083 TGGTTTGATCTGCAATTAACTGG - Intronic
1154143222 18:11844106-11844128 TGGGTTAGACTAGAATTGAAGGG + Intronic
1156050203 18:32923612-32923634 TGCATTGGTGTACTATTGACTGG - Intergenic
1156980712 18:43285322-43285344 TCGGTTGGTGTACAATAGATAGG - Intergenic
1159287157 18:66369313-66369335 TGGGTTGGTATAAAATAAACAGG + Intergenic
925707320 2:6698823-6698845 TCAGTCAGTCTACAATTGACTGG + Intergenic
930020432 2:46998541-46998563 TGGGTTTGGCTACAAATGATGGG + Intronic
942777620 2:179603066-179603088 TGGATTTCTCTAAAATTGACTGG + Intronic
943314797 2:186373927-186373949 TGAGTTGGTCTCCAAGTCACAGG - Intergenic
1171536496 20:25897302-25897324 TGAGTTGTTGTACAATTGAATGG - Intergenic
1171804611 20:29663856-29663878 TGAGTTGTTGTACAATTGAATGG + Intergenic
1171839439 20:30192570-30192592 TGAGTTGTTGTACAATTGAATGG - Intergenic
1179157296 21:38861739-38861761 TGGCTTGGTCTACCACTGACTGG - Intergenic
1181120073 22:20660772-20660794 TGTGTTTTTCTTCAATTGACAGG + Intergenic
950559532 3:13713734-13713756 GAGGCTGGTCTACAATTGAGGGG + Intergenic
950559952 3:13715543-13715565 GAGGCTGGTCTACCATTGACAGG + Intergenic
971712381 4:30131322-30131344 TGGGTTTTTCTATAATTGAGAGG + Intergenic
978519437 4:109600718-109600740 TAGGTTGGGCTAGAATTGAGAGG + Intronic
981426900 4:144614038-144614060 TTGGTTGGGCTACAGTTGATTGG - Intergenic
983070153 4:163257902-163257924 AGGGTTGGTTTACAAGTGATGGG + Intergenic
984721101 4:182973970-182973992 TGAGGTGGTTTACAATGGACTGG + Intergenic
986937396 5:12906157-12906179 TGTCTTTGTCTACAATTTACAGG + Intergenic
988926467 5:35995403-35995425 AGGGTTGGTAGACAATTGGCAGG - Intergenic
991207584 5:64067013-64067035 TGGGTGGGTCTGCAATGGATGGG - Intergenic
994314287 5:98314237-98314259 TGGTTTAGACTACAATTGAGTGG + Intergenic
1002075504 5:176705969-176705991 TGGGGTGGAATACGATTGACTGG - Intergenic
1004051927 6:12090937-12090959 TGGATTGGGCTACAGTTGGCAGG + Intronic
1005977427 6:30810815-30810837 TTGGTTGATCTACATATGACAGG - Intergenic
1006734568 6:36263868-36263890 AGGGTTGGTCTCTAGTTGACTGG - Intronic
1008000607 6:46356136-46356158 TCAGTTGGTCTCCAATTTACTGG - Intronic
1010560592 6:77344235-77344257 TGGGTTGGCCTAGAATTCTCTGG + Intergenic
1011221700 6:85061588-85061610 TGGGTGAGTCTAAAGTTGACAGG - Intergenic
1031239495 7:119219666-119219688 TGGGTTGGTTTATAACTGCCGGG + Intergenic
1031985797 7:128164038-128164060 TGGGCTGGAGTACAATTGAGGGG - Intergenic
1032884159 7:136120305-136120327 TGGGGTGGTCCAGAATTGAAGGG - Intergenic
1050426777 9:5519316-5519338 TGGGTTGGTTTGCATTTGAAAGG + Intronic
1059912340 9:119059075-119059097 TGTGTTGGGCTAAAATTTACAGG - Intergenic
1203726985 Un_GL000216v2:57900-57922 TGGATTGGACTACAATGGAACGG - Intergenic
1192226086 X:69228992-69229014 TGGGTTGGACTCCAATAGGCTGG + Intergenic
1199700143 X:150369635-150369657 TGGGTTGGTATACAGATAACGGG + Intronic