ID: 919403259

View in Genome Browser
Species Human (GRCh38)
Location 1:197146471-197146493
Sequence CGGAGCCGCCTCGTGGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919403259_919403267 -9 Left 919403259 1:197146471-197146493 CCCGCTCCCACGAGGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 919403267 1:197146485-197146507 GCGGCTCCGGAGCGGGGATCCGG 0: 1
1: 0
2: 2
3: 15
4: 142
919403259_919403272 19 Left 919403259 1:197146471-197146493 CCCGCTCCCACGAGGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 919403272 1:197146513-197146535 ACGCTGACCGCTTCCCCTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 78
919403259_919403271 18 Left 919403259 1:197146471-197146493 CCCGCTCCCACGAGGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 919403271 1:197146512-197146534 TACGCTGACCGCTTCCCCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 42
919403259_919403274 23 Left 919403259 1:197146471-197146493 CCCGCTCCCACGAGGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 919403274 1:197146517-197146539 TGACCGCTTCCCCTCAGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 90
919403259_919403268 -8 Left 919403259 1:197146471-197146493 CCCGCTCCCACGAGGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 919403268 1:197146486-197146508 CGGCTCCGGAGCGGGGATCCGGG 0: 1
1: 0
2: 1
3: 17
4: 136
919403259_919403273 20 Left 919403259 1:197146471-197146493 CCCGCTCCCACGAGGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 110
Right 919403273 1:197146514-197146536 CGCTGACCGCTTCCCCTCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919403259 Original CRISPR CGGAGCCGCCTCGTGGGAGC GGG (reversed) Exonic
901157877 1:7152674-7152696 CAGAGGCGCCTCCTGGGAGGTGG - Intronic
902600147 1:17535443-17535465 TGGAGCTGACTGGTGGGAGCGGG + Intergenic
905107748 1:35574219-35574241 GGGAGGCTCCTCGTGGGCGCGGG - Exonic
906772607 1:48498669-48498691 CAGTGCCACCACGTGGGAGCAGG - Intergenic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
920352170 1:205344308-205344330 CGGAGCCGCCGCCGGGGAGGAGG + Exonic
920435396 1:205943730-205943752 CAGGGCCGCCTTGGGGGAGCCGG - Intergenic
921033312 1:211353070-211353092 CGGAGCCCCCTAGTGGCAGGAGG + Intronic
1065740131 10:28790205-28790227 CTCAGCTGCCTGGTGGGAGCGGG + Intergenic
1066180485 10:32957582-32957604 CAGGGCCGCCTCCTGGCAGCCGG + Intronic
1068620647 10:59177250-59177272 CGGAAACGCCTCGTCGGGGCAGG - Intronic
1073268996 10:102245696-102245718 CGGAGACGCCTCCGGGGTGCGGG + Exonic
1075792542 10:125095353-125095375 CAGAGCAGCCTGGTGGTAGCTGG - Intronic
1076506163 10:130973849-130973871 CTGAGCTGCCTCGTGGCAGAGGG + Intergenic
1077148136 11:1054995-1055017 CGGAGCAGGCAGGTGGGAGCTGG - Intergenic
1077423517 11:2463818-2463840 GGGAGCCTCCACGTGGTAGCGGG - Intronic
1082160613 11:48884625-48884647 CCGAGGCTCCTCCTGGGAGCAGG + Intergenic
1082161753 11:48895781-48895803 CCGAGGCTCCTCCTGGGAGCAGG - Intergenic
1082167337 11:48964209-48964231 CTGAGGCTCCTCCTGGGAGCAGG - Intergenic
1082236242 11:49822489-49822511 CTGAGACTCCTCCTGGGAGCAGG + Intergenic
1082239694 11:49856997-49857019 CCGAGGCTCCTCCTGGGAGCAGG + Intergenic
1084515758 11:69637323-69637345 CGGCGGCGGCTCGCGGGAGCCGG - Intergenic
1085519184 11:77128197-77128219 CGGCTCCGCCTCCTGGGAGAAGG + Intergenic
1087129026 11:94652964-94652986 CTGAGCCCCTTGGTGGGAGCAGG - Intergenic
1089243137 11:117098447-117098469 GGGAGCCGGCTCGGGGGAGGGGG + Intergenic
1090344885 11:126062347-126062369 CGGAGGCACCTCGCGGGAGGAGG - Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1096773964 12:53953075-53953097 CGGGGCCGGCTCCTGGGGGCGGG + Intergenic
1097223103 12:57461793-57461815 CGGAGCCGACTCCTGGGAGTTGG + Intronic
1100631981 12:96399412-96399434 AGGAGCCCGCGCGTGGGAGCGGG - Intronic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1113901508 13:113800739-113800761 CAGGGCTGCCTCATGGGAGCTGG - Intronic
1119171580 14:72539816-72539838 TGGTGCCGCCTCCTTGGAGCAGG - Intronic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1123676449 15:22714651-22714673 GGGAGGCGCCTCGAGGGAGCCGG + Intergenic
1124328663 15:28788911-28788933 GGGAGGCGCCTCGAGGGAGCCGG + Intergenic
1128724086 15:69975090-69975112 CAGAGCCGCCTGGTTGGAGCTGG - Intergenic
1130678810 15:85978431-85978453 TGGAGCAGCCTCTTTGGAGCCGG + Intergenic
1132309194 15:100844455-100844477 CAAAGCTGCATCGTGGGAGCGGG - Intergenic
1132512787 16:352569-352591 CGGAGCGGGCGGGTGGGAGCTGG - Exonic
1134024259 16:10942271-10942293 GGGAGGCGCCACGAGGGAGCCGG - Exonic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1141382220 16:83586661-83586683 AAGGGCTGCCTCGTGGGAGCAGG + Intronic
1143026557 17:3944873-3944895 CGGAGCCCCCTCCTAGGGGCGGG - Intronic
1144306473 17:13973295-13973317 CTGAGCCCCTTGGTGGGAGCAGG - Intergenic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146787457 17:35732035-35732057 CGGGGCCGCCACGTGAGAGCTGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150488919 17:65561355-65561377 CCGAGCCGCGGCGTGGGCGCGGG - Intronic
1151444798 17:74156232-74156254 GGGAGCTGCCTCCTGGGAGCTGG - Intergenic
1151746545 17:76014653-76014675 GGGAGCCTCCTCCTGGGGGCAGG + Intronic
1152910412 17:83002227-83002249 CTGAGCTGCCCCGTGGGGGCAGG - Intronic
1160717863 19:584547-584569 CAGCGCCGCCTGGTGGCAGCCGG - Intergenic
1162022064 19:7872558-7872580 CTGGGCCGCCTCCTGGCAGCCGG + Exonic
1163364555 19:16868784-16868806 TGGAGCAGGCTGGTGGGAGCTGG + Intronic
1164746696 19:30621689-30621711 AGGAGCAGCCGGGTGGGAGCCGG + Intronic
1166809355 19:45506639-45506661 CGGAGCCGGCGTGTGGGGGCGGG + Intronic
1167615694 19:50531675-50531697 CTGAGCAGCCTCGTGGGGGATGG + Intronic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
926062200 2:9811759-9811781 GGGAGACGCCTCGTGGGGACAGG + Intergenic
927102297 2:19797351-19797373 CCCAGCCATCTCGTGGGAGCTGG + Intergenic
928964899 2:36966576-36966598 GGGAGCAGCCTCCTGGGCGCGGG + Intergenic
932479276 2:72028897-72028919 CGGAGGGGCCTAGTGGGAGATGG + Intergenic
936457492 2:112686537-112686559 AGGAGCCGCCTGTGGGGAGCAGG - Intergenic
938273311 2:129993773-129993795 CGGTGCCGCCTGGAGGCAGCCGG + Intergenic
938442909 2:131352328-131352350 CGGTGCCGCCTGGAGGCAGCCGG - Intronic
941058336 2:160814235-160814257 CTGAGCCACCTGGTAGGAGCAGG - Intergenic
944154113 2:196593144-196593166 CGGAGCCGCCTCGAGAGCTCTGG - Intronic
1169145667 20:3250651-3250673 CGGAGCCCGCCCGTGAGAGCGGG - Exonic
1174172350 20:48625520-48625542 CGGAGCCATCCCGAGGGAGCCGG + Exonic
1175769700 20:61616015-61616037 CTGAGCCGCCTCGTGGCCACGGG + Intronic
1175777771 20:61663848-61663870 CAGGGCGGCCTCGAGGGAGCTGG - Intronic
1175928012 20:62480408-62480430 CTGAGGCGTCTCCTGGGAGCTGG - Intergenic
1176120569 20:63452820-63452842 GGGACCCTCCTCGTGGGAACTGG + Intronic
1181005039 22:20009289-20009311 CGGGCCAGCCTAGTGGGAGCTGG - Intronic
1182278710 22:29206080-29206102 CAGCGCCGCCTCCCGGGAGCAGG - Exonic
1183343732 22:37295734-37295756 CGGAGCTGCCGTGTGGGAGAAGG - Intronic
1183662204 22:39227844-39227866 GAGAGCTGCCTCGTGGGAGCTGG - Intronic
1185413355 22:50697343-50697365 CAGGGCAGCCTAGTGGGAGCGGG - Intergenic
967028646 3:185586025-185586047 CGGAGCCGGCCCGTGGGACAAGG - Intronic
968084701 3:195869095-195869117 CGGAGCCGCCTCCTGCCATCAGG + Intronic
970460620 4:16271120-16271142 CAGAGTCGCCTCCTGGGGGCAGG - Intergenic
976184110 4:82428981-82429003 CGCAGGCGCCGCGTGGGACCCGG - Intronic
976750281 4:88445971-88445993 TGGAGCCCCTTGGTGGGAGCAGG - Intergenic
981043172 4:140241894-140241916 AGGAGCCACATCCTGGGAGCTGG - Intergenic
985125836 4:186693552-186693574 CCCAGCCACCTCCTGGGAGCAGG + Intronic
985674339 5:1223057-1223079 CGGAGCAGCCTCTCGGAAGCCGG + Exonic
991054372 5:62306074-62306096 CGGGGCCGCCTGGAGGCAGCGGG + Intergenic
998568637 5:143237846-143237868 AGGAGGGGCCTCGTGGGAGGCGG + Intergenic
998568651 5:143237892-143237914 AGGAGGGGCCTCGTGGGAGGCGG + Intergenic
1000116130 5:158155005-158155027 GGGAACCGCCTCCTGGGAACAGG + Intergenic
1000911700 5:167030621-167030643 CGGAGCTGGCTCCTGGAAGCGGG - Intergenic
1002400789 5:178990738-178990760 AGGACCCGCCTGGTAGGAGCAGG + Exonic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1006369165 6:33633692-33633714 CGGCGGCGCGTCGTGGGAGACGG + Intronic
1011553880 6:88554822-88554844 CAGAGCCGCCTCGTGGGCCCTGG - Intergenic
1012062873 6:94511080-94511102 CGGAGCCTCCACCTGGGAGTGGG - Intergenic
1012506348 6:99951053-99951075 CTGGGCTGCCTGGTGGGAGCTGG - Intronic
1013619324 6:111873023-111873045 CGGAGCCGCCTCGGCCGCGCCGG - Exonic
1017436226 6:154418151-154418173 CGGAGCTGCCTCGCCCGAGCAGG + Intronic
1019733228 7:2638619-2638641 AGCAGCGGCCACGTGGGAGCCGG - Intronic
1023678090 7:42651778-42651800 CAGAGCAGGCTTGTGGGAGCTGG - Intergenic
1025239136 7:57256878-57256900 CGGAGGCGCCTGGTCGGAACCGG - Intergenic
1026667626 7:72357355-72357377 CGGAGAGGCCTCGTGGGACCAGG + Intronic
1029366416 7:100119351-100119373 CCCCGCCCCCTCGTGGGAGCAGG + Intronic
1032693952 7:134317042-134317064 CGGAGCTGCCTGGCGGAAGCGGG - Exonic
1034174557 7:149090614-149090636 CGGAGCCGCCTCGGGTAAGCGGG - Exonic
1035225062 7:157428258-157428280 CGTGGGAGCCTCGTGGGAGCTGG + Intergenic
1037899001 8:22676656-22676678 CGGAACAGCCGCGTGGGAGGAGG + Intergenic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1043592249 8:81845198-81845220 CTGAGCCCCTTGGTGGGAGCGGG - Intergenic
1049415124 8:142491580-142491602 CGGAGCCGCATGTTGGGACCCGG - Intronic
1049419579 8:142510843-142510865 CGGAGCCGCCGCTCGGGGGCCGG + Intronic
1049689573 8:143952791-143952813 CGGAGCCGGCTTGGGGGAGGCGG - Intronic
1049862761 8:144911301-144911323 GGGAGCAACCTGGTGGGAGCTGG + Intergenic
1052861375 9:33439825-33439847 CAGACACGCCTCTTGGGAGCTGG + Intergenic
1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG + Intergenic
1062031151 9:134362604-134362626 CAGAGCCTACTCCTGGGAGCTGG + Intronic
1062452950 9:136623175-136623197 AGGAGCTGCCTGGTGGGAACCGG - Intergenic
1187276059 X:17817531-17817553 GGGAGCTGCCTCCAGGGAGCAGG + Intronic
1190194312 X:48304403-48304425 TGGAGCCGCCTCCTGTGTGCTGG + Intergenic