ID: 919405306

View in Genome Browser
Species Human (GRCh38)
Location 1:197173787-197173809
Sequence CCATGGGCACATAGAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919405297_919405306 30 Left 919405297 1:197173734-197173756 CCTTATTCCATTCATATCCATGG 0: 1
1: 0
2: 0
3: 16
4: 158
Right 919405306 1:197173787-197173809 CCATGGGCACATAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 28
4: 265
919405300_919405306 13 Left 919405300 1:197173751-197173773 CCATGGTAAATATAAACAGAGAT 0: 1
1: 0
2: 1
3: 28
4: 331
Right 919405306 1:197173787-197173809 CCATGGGCACATAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 28
4: 265
919405299_919405306 23 Left 919405299 1:197173741-197173763 CCATTCATATCCATGGTAAATAT 0: 1
1: 0
2: 1
3: 26
4: 411
Right 919405306 1:197173787-197173809 CCATGGGCACATAGAGAAAGAGG 0: 1
1: 0
2: 3
3: 28
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919405306 Original CRISPR CCATGGGCACATAGAGAAAG AGG Intronic
900533111 1:3164457-3164479 CCATGGCCACGTACAGAAAGAGG + Intronic
901648296 1:10728276-10728298 CCATGGGCCCTTAGAGTAAATGG - Intronic
902840343 1:19070287-19070309 CCAAGGGCACCAAGAGAAGGCGG + Intergenic
903009400 1:20319395-20319417 CCATGTCCTGATAGAGAAAGGGG + Exonic
907807745 1:57838164-57838186 CCATGGGCACAGGGATAAGGCGG - Intronic
907865598 1:58396637-58396659 TCATGGCGACAGAGAGAAAGAGG + Intronic
908031845 1:60008949-60008971 CTAAGGGAACATAGAGGAAGGGG - Intronic
909039810 1:70635714-70635736 CCATGGGCACAGAGTGACACTGG - Intergenic
909070777 1:70991225-70991247 CCAAGGAAACATGGAGAAAGAGG + Intronic
909585770 1:77286042-77286064 CCATGGGAACACAGAAGAAGGGG + Intronic
910964386 1:92793759-92793781 TGGTGGGAACATAGAGAAAGGGG + Intergenic
914238410 1:145833426-145833448 CCATTGGCACATAGAGCCAGGGG + Intronic
915962332 1:160277596-160277618 CCTTGGGAACAAAGATAAAGTGG + Exonic
916447729 1:164889334-164889356 CAATGGGCACATAAACAAAATGG + Intronic
916926873 1:169530973-169530995 CCATGGGCATGTAGAGAATACGG + Exonic
917506516 1:175632280-175632302 CCTTGGGAACAGAGAGAAACTGG - Intronic
918245373 1:182654896-182654918 CAATTGGGACATAGAGGAAGAGG + Intronic
918774610 1:188611587-188611609 CCATGGGCCCATGAACAAAGTGG + Intergenic
919405306 1:197173787-197173809 CCATGGGCACATAGAGAAAGAGG + Intronic
920244461 1:204577276-204577298 CCAAGGGCACATAGTGCACGAGG - Intergenic
920491482 1:206419075-206419097 CAATGGGAACATAGAGATGGAGG - Intronic
921176020 1:212595338-212595360 CCATGGGCAACTGGAGAAAAAGG - Intronic
921922474 1:220685227-220685249 TCATGGGTATTTAGAGAAAGGGG + Intergenic
923215974 1:231848061-231848083 CCCTGGGCAAAGAGAGAAACAGG + Intronic
923760117 1:236834505-236834527 CCAAGGCCACATAGAGAAAAAGG - Intronic
924016863 1:239736101-239736123 ACATGTGCACATAGGGAAAGTGG - Intronic
1065300818 10:24319590-24319612 CCACGTGCACGTAGAGCAAGAGG + Intronic
1065624719 10:27618800-27618822 CCAAGGGAACAAAGACAAAGAGG - Intergenic
1066068358 10:31778775-31778797 AGCTGGGCACAGAGAGAAAGTGG - Intergenic
1066496798 10:35950062-35950084 GCATTAGCACATAGAGAAAAGGG - Intergenic
1066624440 10:37391936-37391958 GCATTAGCACATAGAGAAAAGGG - Intergenic
1067333256 10:45341059-45341081 CAATGGGCCCATAAACAAAGTGG + Intergenic
1069632327 10:69904497-69904519 CCATGGGCAGAAGGAGACAGAGG + Intronic
1069964046 10:72099132-72099154 ACATGGGCACAAAGAGAAGAAGG - Intronic
1070582509 10:77732872-77732894 CCGTGGGCATAAGGAGAAAGGGG + Intergenic
1070929559 10:80251568-80251590 CCATGGGCACAAAGAGCTATGGG - Intergenic
1071364365 10:84883683-84883705 CAATGGGCACATGAACAAAGTGG - Intergenic
1072360580 10:94654984-94655006 CCATGAGCCCATAAACAAAGTGG + Intergenic
1075701817 10:124474836-124474858 CCAGGGGCACCTTTAGAAAGAGG - Intronic
1075934436 10:126327358-126327380 CCATGGGAACCTAAAGAAAGGGG - Intronic
1077361337 11:2141442-2141464 AATTGGGAACATAGAGAAAGAGG + Intronic
1078357942 11:10646857-10646879 ACATGGACACATTGAGGAAGGGG - Intronic
1079138149 11:17788151-17788173 CCATGGACAAAGAGAGAAACTGG - Exonic
1079347640 11:19667063-19667085 CAATGGGAACATACAGAGAGGGG - Intronic
1080967258 11:37227261-37227283 CAATTGGCAGATAAAGAAAGGGG - Intergenic
1081168381 11:39835394-39835416 ACATGGACACATAGAGAGAGGGG + Intergenic
1081913245 11:46714252-46714274 CCATGACCACATAGAGACATGGG + Intergenic
1082205587 11:49430146-49430168 CCTTGGGAAAAAAGAGAAAGAGG + Intergenic
1082691692 11:56312712-56312734 CAATGGGCTCACAAAGAAAGTGG + Intergenic
1083620023 11:64044625-64044647 CCAAGGTCACACAGAGGAAGGGG + Intronic
1084491311 11:69480133-69480155 CCCTGGGCACCAAGACAAAGAGG + Intergenic
1084564700 11:69922271-69922293 CCTTAGCCACGTAGAGAAAGTGG - Intergenic
1086649512 11:89270372-89270394 CCTTGGGAAAAAAGAGAAAGAGG - Intronic
1088486221 11:110343227-110343249 CCAAGAGGACAGAGAGAAAGAGG + Intergenic
1089181999 11:116589695-116589717 CCATGGGCATAAAGAGAAGCAGG + Intergenic
1090627671 11:128620242-128620264 CCAGGGGCACATAGAAAGGGAGG - Intergenic
1090944994 11:131421578-131421600 CCATGGGCCCTTAGGGAAACCGG - Intronic
1091261659 11:134239329-134239351 AGATGGGCAAATAGAGAAATGGG - Intronic
1091391712 12:130009-130031 CCATGGGCACAGAGAGCACCAGG + Intronic
1093823382 12:23650580-23650602 TCATGGGCTGATAGAGAAATTGG + Intronic
1095319244 12:40806004-40806026 CAAAGGGCACATAGAGTCAGCGG - Intronic
1095497648 12:42802150-42802172 CAATGGTCACATAGAGTGAGTGG + Intergenic
1096229082 12:49887584-49887606 CCCTGGGCACACAGAGAATCAGG - Intronic
1099911354 12:88838392-88838414 CCATGGGCTCATAGGGAGAAGGG - Intergenic
1101010403 12:100443744-100443766 CCATGGGGGCAGAGAGGAAGGGG - Intergenic
1101063405 12:100995099-100995121 CTATGGGAACAGAGAAAAAGAGG + Intronic
1101329570 12:103746559-103746581 CCATGGGTACAGAATGAAAGTGG + Intronic
1101599376 12:106195733-106195755 CCTTGGGCCCACAGAGAATGGGG - Intergenic
1102100569 12:110275315-110275337 TCATGGGCATGTAGAAAAAGTGG + Intergenic
1106695950 13:32172596-32172618 CAATGAGCAGATGGAGAAAGGGG + Intronic
1107723555 13:43274973-43274995 TCATGGGCACATAGAGATTAAGG + Intronic
1108841730 13:54626140-54626162 GCAAGGGTACAGAGAGAAAGAGG + Intergenic
1111275820 13:85945714-85945736 CAATGGGCTCATAGACAAAGTGG - Intergenic
1112429751 13:99341129-99341151 CCATGGGCAGTGAGAGAAGGAGG + Intronic
1112780824 13:102898831-102898853 AGATTGGCACATAGAGAAAGAGG - Intergenic
1113246598 13:108403225-108403247 TCTTGGCCACATAAAGAAAGAGG + Intergenic
1117058242 14:51934672-51934694 CAATGTTCACATAGAGAACGTGG - Intronic
1117245394 14:53879816-53879838 AGAGGGGCACATAGGGAAAGGGG + Intergenic
1119504997 14:75164826-75164848 GCATGGAAACAGAGAGAAAGGGG + Intronic
1121563487 14:94891955-94891977 CCAGGGTCACAGAGAGTAAGTGG + Intergenic
1122448412 14:101783906-101783928 CCAGGGGCACCCAGAGAAGGCGG + Intronic
1123922548 15:25080654-25080676 ACATGGGCACATAGGCACAGAGG - Intergenic
1124203314 15:27696977-27696999 GCATGGGCACACAGAGGACGTGG - Intergenic
1124621509 15:31276658-31276680 CCATGGGCCCATGGAGATACTGG + Intergenic
1125515392 15:40316451-40316473 CAATGGGCACATGAATAAAGTGG - Intergenic
1127365340 15:58284279-58284301 CCTTGGGCACAGGGAGAAGGAGG + Intronic
1127612751 15:60652926-60652948 CCATGGGCTCAGACAGCAAGAGG - Intronic
1128161342 15:65424584-65424606 CCAAGGCCACAGTGAGAAAGTGG - Intergenic
1128944250 15:71810642-71810664 ACAGGGGCACAGAGAGACAGAGG + Exonic
1129272546 15:74427045-74427067 CCATGTGCACAGAGAAAAGGAGG - Intronic
1132310375 15:100853134-100853156 CCATGGGCACCTCCTGAAAGGGG + Intergenic
1133761367 16:8801180-8801202 CTATGGGCACATATACAAATAGG - Intronic
1135714958 16:24755584-24755606 CCATGGTCACACAGTGTAAGTGG + Intronic
1137032189 16:35533407-35533429 CCAGGGGCAGATGGACAAAGGGG - Intergenic
1138336171 16:56254790-56254812 CTATGGGAACATAGAGAATATGG - Intronic
1139154045 16:64419414-64419436 ACATGGTCAAACAGAGAAAGGGG + Intergenic
1139339965 16:66262095-66262117 CCATGGGCTGTTAAAGAAAGTGG + Intergenic
1139355430 16:66364638-66364660 CCATGGGCACGTAGACCATGAGG + Intergenic
1139382676 16:66543522-66543544 CCAGGGGCACACACAGAGAGGGG + Intronic
1141927708 16:87179915-87179937 CCATGGGCACCTGCAGCAAGGGG + Intronic
1143579814 17:7818884-7818906 CCAGAGGCACATGGAGCAAGGGG - Intronic
1146946820 17:36878827-36878849 CCATGGACAGAGAGAGAGAGAGG - Intergenic
1148218280 17:45845731-45845753 CAATGGTGACATAGACAAAGTGG - Exonic
1149350305 17:55779900-55779922 ACATGGGCCAATAGAGACAGAGG - Intronic
1151383064 17:73738741-73738763 CCAAGGTCACATAGAGTCAGGGG - Intergenic
1154072035 18:11161506-11161528 CCATAGGCACAAAGATAAGGTGG + Intergenic
1154506272 18:15043701-15043723 CCATGGGCCCATGAACAAAGTGG + Intergenic
1156568486 18:38223303-38223325 CATTGGGCAAATAGAAAAAGAGG + Intergenic
1156588010 18:38453897-38453919 ACATAGTCTCATAGAGAAAGAGG - Intergenic
1157192086 18:45590139-45590161 CCAAAGGCAGAGAGAGAAAGAGG + Intronic
1157282533 18:46355660-46355682 CCAGGGGCACTTAGAGATTGTGG - Intronic
1158608856 18:58920282-58920304 CCGTGGGCATAAGGAGAAAGGGG + Exonic
1159391758 18:67802535-67802557 CCATGTGCAGAAAGAGACAGAGG + Intergenic
1160451366 18:78968589-78968611 CCATGGCAACTTAGAGAAATGGG + Intergenic
1164760023 19:30721660-30721682 CCATGAGCAGTTAAAGAAAGGGG - Intergenic
1164858074 19:31540521-31540543 CCATGGGCTCAGAGAAAAATAGG - Intergenic
1165269736 19:34695764-34695786 AAATGGGCAAATAGAGATAGAGG + Intergenic
1166400007 19:42471631-42471653 CCATGGGCACACGGAGGATGTGG + Intergenic
1166462286 19:42998829-42998851 ACATGTGCACATAAAGATAGAGG + Intronic
1166479561 19:43158800-43158822 ACATGTGCACATAAAGATAGAGG + Intronic
1166498351 19:43322500-43322522 ACATGTGCACATAAAGATAGAGG - Intergenic
927759277 2:25737374-25737396 CAATGGGCACATTAATAAAGAGG + Intronic
928308961 2:30194101-30194123 CCATGGGCACGGAAAGGAAGAGG - Intergenic
929711780 2:44273595-44273617 ACATGGTTAAATAGAGAAAGTGG - Intergenic
931325280 2:61215655-61215677 CCAAGGTCACACAGATAAAGAGG + Intronic
933561429 2:83890786-83890808 CCAAGGGGACATAGGGTAAGGGG + Intergenic
936149734 2:110008892-110008914 CCGTGGGCATAAGGAGAAAGGGG + Intergenic
936194944 2:110362477-110362499 CCGTGGGCATAAGGAGAAAGGGG - Intergenic
937451218 2:122003295-122003317 CCATGAGAACCTGGAGAAAGGGG + Intergenic
937583456 2:123517075-123517097 CTTTGGGCACAAGGAGAAAGGGG + Intergenic
937875752 2:126824099-126824121 CCATGGGCACATAGCCAGGGAGG - Intergenic
944997614 2:205311738-205311760 TCATGGTTACATTGAGAAAGGGG - Intronic
945800584 2:214424497-214424519 AGATGTGTACATAGAGAAAGAGG - Intronic
945858020 2:215091187-215091209 AGATGGGCCCATAGAAAAAGAGG - Intronic
946759947 2:222983639-222983661 CTATGGGTACCTAGAGAAAAAGG - Intergenic
947250775 2:228100998-228101020 GAATGTGCAGATAGAGAAAGCGG - Intronic
947390600 2:229635411-229635433 CCAAGGGTACAAAGAGGAAGAGG + Intronic
948298996 2:236888078-236888100 CCATGGGCACACAGGGAAACAGG - Intergenic
949031224 2:241798429-241798451 ATAGGGGCACAGAGAGAAAGTGG - Intronic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1169184103 20:3598263-3598285 TCATGGCCTCATACAGAAAGGGG + Intronic
1169206239 20:3741859-3741881 CTATGGCCACAAAGAGCAAGAGG + Intronic
1169540587 20:6595335-6595357 CCATGGGCCCAGTGAGAATGAGG - Intergenic
1169700537 20:8441724-8441746 CTATGGGCAGATAGAGGAGGGGG + Intronic
1170532863 20:17311941-17311963 ACATGGGCACATACTGAATGAGG - Intronic
1171012678 20:21517092-21517114 CCATAGGCGCCTAGAGAAGGAGG + Intergenic
1171232390 20:23497891-23497913 CAATGGTCACAAAGAGAGAGGGG + Intergenic
1171428441 20:25063494-25063516 TCATGGGGACATCGAGAAATAGG - Intergenic
1173297307 20:41771156-41771178 CCATATGCACAGAGTGAAAGGGG - Intergenic
1175172149 20:57088304-57088326 CCGTGAGCACATAGAGAAAGGGG + Intergenic
1175239816 20:57538763-57538785 CCATGTGCAAACATAGAAAGTGG - Intergenic
1176266065 20:64209967-64209989 CCATGGGCACAAAGAGACACAGG + Intronic
1176791582 21:13325322-13325344 CCATGGGCCCATGAACAAAGTGG - Intergenic
1177286403 21:19057080-19057102 ACATGGACACATAGAGGGAGGGG - Intergenic
1178005931 21:28219620-28219642 CAATGGGCCCATAAACAAAGTGG - Intergenic
1179279838 21:39924999-39925021 CAATAGGCACACAGGGAAAGAGG - Intronic
1179457984 21:41512770-41512792 CAATGGGCTCATGGACAAAGTGG - Intronic
1179766818 21:43580285-43580307 TCATAGGCACATTGAGAAAGGGG - Intronic
1180116002 21:45705436-45705458 CCCTGTGCACATAGAGACAAGGG + Intronic
1181786006 22:25227827-25227849 CCATGGAGACAGAGAGAAAGGGG - Intronic
1181818196 22:25455686-25455708 CCATGGAGTCAGAGAGAAAGGGG - Intergenic
1183108439 22:35630758-35630780 CCATGGCCACATAGTTAAAGAGG - Intronic
1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG + Intronic
949169925 3:985788-985810 CAATGGGCCCATAAACAAAGCGG - Intergenic
950414759 3:12862595-12862617 CCAAGGGCACATCAAGGAAGAGG + Intronic
950808776 3:15631983-15632005 CCAAGGGGACAAGGAGAAAGTGG - Intronic
952387254 3:32851074-32851096 CCATAGTCACAGTGAGAAAGCGG - Intronic
952865891 3:37854893-37854915 TCCTGGGCACACAGAGAAAAGGG - Intergenic
956434889 3:69224983-69225005 CTGTAGGAACATAGAGAAAGTGG - Intronic
956705886 3:71998629-71998651 CCATGGGCACAAATAAAAATTGG + Intergenic
956821897 3:72961543-72961565 CCATGGGCAAACAGAGAATGTGG - Intronic
958432068 3:94052415-94052437 ACATGGGCAGTTAGGGAAAGTGG + Intronic
958961788 3:100517563-100517585 GCATGGGGACAGTGAGAAAGAGG - Intronic
959667672 3:108939711-108939733 CCATGGGTACATAAAGAAAGGGG - Intronic
959833070 3:110887910-110887932 CCATGGGAACCTAGAGAACTAGG - Intergenic
960349632 3:116576513-116576535 CAATGGGCACATGAACAAAGCGG + Intronic
961196072 3:125002494-125002516 CCATGAGTACAAAGAGAAAGAGG + Intronic
961454875 3:127018981-127019003 CCCTGGGCACATAGAGATCTTGG + Intronic
961710866 3:128827206-128827228 CAATGGGCTCATAAACAAAGTGG - Intergenic
961713462 3:128844126-128844148 CCAAGGCCACATCGAGGAAGAGG - Intergenic
962476544 3:135760035-135760057 CCATGGGCACATTGAAGGAGGGG - Intergenic
963227255 3:142874858-142874880 CTATGGGAACACAGAGGAAGTGG + Intronic
963301360 3:143600831-143600853 CCTTGGGCACAGTGAAAAAGAGG - Intronic
963355551 3:144206055-144206077 CAATGGGCCCATAAACAAAGTGG - Intergenic
964247529 3:154670507-154670529 CCATGTGCCCACAGAGAAAGAGG - Intergenic
964297787 3:155252745-155252767 CAATGGGCTCATGAAGAAAGTGG + Intergenic
965212600 3:165812923-165812945 CAATGAGGACACAGAGAAAGAGG - Intronic
965467017 3:169042334-169042356 GCAGGGGCACATAAAGAAATAGG - Intergenic
966070992 3:175877769-175877791 CCATGTGGAGAGAGAGAAAGAGG - Intergenic
969533247 4:7740929-7740951 CCCTGGGCACTCAGGGAAAGGGG - Exonic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
971772481 4:30915264-30915286 CAATGGAGAAATAGAGAAAGTGG - Intronic
976598523 4:86916412-86916434 CAATGGGCACATGAATAAAGTGG + Intronic
977435784 4:96992567-96992589 CAATAGGAACATAGAGACAGGGG - Intergenic
977833119 4:101617027-101617049 CCATGGGCTCATGAACAAAGTGG - Intronic
978166212 4:105610666-105610688 CCATGGGCTCATAGTGATATGGG + Intronic
981473792 4:145167011-145167033 ACATGTGCACACATAGAAAGGGG + Intronic
982624482 4:157749017-157749039 CAATGGGCTCATAAACAAAGTGG + Intergenic
982873879 4:160620005-160620027 CCATGTGCAGATGCAGAAAGAGG - Intergenic
985494711 5:198016-198038 CCAGGGGCAGAAGGAGAAAGGGG - Exonic
986111960 5:4728221-4728243 CCATGGGAAGATGGAGAAATAGG + Intergenic
986264008 5:6176930-6176952 CCATGGGCAGAAAGAGACAAAGG + Intergenic
986470543 5:8069657-8069679 ACATGGGCACCTAGAGATAGAGG - Intergenic
986754732 5:10824439-10824461 CTATGGGCCCATGGAGAGAGGGG + Intergenic
987018267 5:13843406-13843428 CCATGAGCAAAGAGAGAAGGGGG - Intronic
989111728 5:37913304-37913326 CCATGGGAACAAAGGGGAAGGGG + Intergenic
991080131 5:62589558-62589580 ACATGGGAATAAAGAGAAAGGGG - Intronic
993624283 5:90205427-90205449 TCATGGGCACATAAAGAAACAGG + Intergenic
994228357 5:97281824-97281846 CCATGAGCACACAGACATAGAGG - Intergenic
995469482 5:112485375-112485397 TCATGGAAACATAGAGAAAGGGG - Intergenic
996570665 5:124929654-124929676 CAATGGGCACATAAATGAAGTGG - Intergenic
997027281 5:130080257-130080279 CCATGGTCACACAGAGAGATGGG - Intronic
997209092 5:132067245-132067267 GCATGGGGACAGAGACAAAGAGG - Intergenic
998600878 5:143583746-143583768 ACAGGGGAACATAGGGAAAGAGG - Intergenic
998923082 5:147092316-147092338 CCATATGCAAATGGAGAAAGGGG + Intergenic
999102774 5:149040450-149040472 CCATGTGCACAGACAGAAACTGG + Intronic
1001077101 5:168638161-168638183 CCATGGGCACATCCACAAACCGG + Intergenic
1001771006 5:174295722-174295744 CCATGGGCACAGTGATGAAGAGG - Intergenic
1001838964 5:174856947-174856969 CCATGGGCTCATGAACAAAGTGG + Intergenic
1003953820 6:11143884-11143906 CCATGAGCATGTAGAGTAAGAGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1007369759 6:41418711-41418733 ACATAGGCACATCCAGAAAGTGG + Intergenic
1008255699 6:49297219-49297241 ACATTGGCAGACAGAGAAAGTGG + Intergenic
1008257752 6:49325191-49325213 CCATAAGAAAATAGAGAAAGAGG - Intergenic
1009662179 6:66628270-66628292 TCATTGGGACATAGAGAATGAGG + Intergenic
1013703718 6:112806915-112806937 CCATGCGAACCTATAGAAAGAGG - Intergenic
1013719553 6:113007444-113007466 CCAAGGCAACACAGAGAAAGGGG - Intergenic
1015129967 6:129798236-129798258 TCATGGGGACATAGACAAATTGG - Intergenic
1015706493 6:136093688-136093710 CCATGAGCAGAGAGAGAAGGGGG + Intronic
1017001123 6:149998635-149998657 CCATTAGCACCGAGAGAAAGTGG + Intergenic
1017010778 6:150062774-150062796 CCATTAGCACCGAGAGAAAGTGG + Intergenic
1017717674 6:157223707-157223729 CCAAGGGAACACAGAGAAGGTGG + Intergenic
1019893890 7:3967913-3967935 CCATGGGCACAAGGATAAATAGG + Intronic
1021342081 7:19477824-19477846 CCATGGGAACCAAAAGAAAGTGG - Intergenic
1021556558 7:21925191-21925213 CCATGGCCACACAGACAAAATGG + Intronic
1021762231 7:23913268-23913290 CCAAGGCCACATAGAGAAGGGGG - Intergenic
1023110796 7:36808723-36808745 TCATGGGGGCACAGAGAAAGAGG - Intergenic
1025296024 7:57775877-57775899 ACATGTGCAAAGAGAGAAAGAGG - Intergenic
1026046374 7:66908290-66908312 CAATGGGCTCATAAACAAAGTGG - Intergenic
1026675587 7:72425438-72425460 CCATGGGCACATGGGGATGGAGG - Intronic
1026742063 7:72984973-72984995 CTCTGGACACACAGAGAAAGAGG - Intergenic
1026801908 7:73405401-73405423 CTCTGGACACACAGAGAAAGAGG - Intergenic
1027101672 7:75380104-75380126 CTCTGGACACACAGAGAAAGAGG + Intergenic
1028280797 7:88925525-88925547 ACATGAGGACACAGAGAAAGTGG + Intronic
1028697377 7:93730826-93730848 CCATGTGCACAAAGAGAAAGGGG + Intronic
1031833117 7:126650828-126650850 CAATGGGCCCATAAACAAAGTGG + Intronic
1032501063 7:132400272-132400294 ACATGGGAACTTAGAGAAAGTGG - Intronic
1034499062 7:151438523-151438545 AAATGGGCACCTAGACAAAGGGG - Intronic
1035621266 8:1037111-1037133 CCATGGTCACGTAGAGAGAGAGG + Intergenic
1035861984 8:3039082-3039104 CAAAGGGTACTTAGAGAAAGTGG + Intronic
1036652511 8:10654385-10654407 CCCAGGGCAAATAGAGAGAGTGG - Intronic
1037179867 8:15992542-15992564 CCATGTGCACATGGATATAGGGG - Intergenic
1037457535 8:19078845-19078867 AGATGGGCAGAAAGAGAAAGAGG + Intronic
1038987178 8:32824461-32824483 CCATGGGCAGGTTGTGAAAGAGG + Intergenic
1040522184 8:48187598-48187620 CCAAGGCCACATAGTGAAAGTGG + Intergenic
1041799802 8:61786769-61786791 CCAAGGGAACATAGAAAGAGGGG + Intergenic
1042000949 8:64123182-64123204 CAATGGGCCCATGAAGAAAGTGG - Intergenic
1042028397 8:64447920-64447942 CAATGGCCACCCAGAGAAAGTGG - Intergenic
1043052177 8:75397750-75397772 GAATGGTCATATAGAGAAAGAGG + Intergenic
1043172929 8:76987700-76987722 CAATGGGGACAGAGAGAAAAGGG + Intronic
1043879303 8:85523893-85523915 TCATGAGCACAGAGACAAAGAGG - Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1045673334 8:104581240-104581262 ACATGGACACATAGAGGAAGGGG + Intronic
1047756610 8:127923743-127923765 CCAGGGGCACATGGAGAAGGAGG + Intergenic
1048316883 8:133369441-133369463 CCATGGACACAGAGAGCAGGGGG - Intergenic
1049117223 8:140699459-140699481 CCTTGGGGACAGAGAGGAAGTGG - Intronic
1052923364 9:33991467-33991489 ACATAGGTACATATAGAAAGAGG + Intronic
1053302725 9:36963339-36963361 CCATGGGCTCATGGAGAGATGGG - Intronic
1053317538 9:37064757-37064779 TGAAGGGCACAGAGAGAAAGTGG + Intergenic
1053387617 9:37707151-37707173 CTATGGACACACAGAGAAGGGGG - Intronic
1054947551 9:70811881-70811903 CCTTGGCCAGAGAGAGAAAGAGG - Intronic
1055322987 9:75100352-75100374 ACATGGGCACATGGACAAGGAGG - Intronic
1056534736 9:87517446-87517468 AGATGGGCACACAGAGAGAGAGG - Intronic
1056915089 9:90739271-90739293 CCAAGGCTTCATAGAGAAAGAGG + Intergenic
1058124688 9:101178190-101178212 CAATGGGCCCATGGACAAAGTGG + Intronic
1058838286 9:108879389-108879411 TCCTGGGCATATAGGGAAAGTGG - Intronic
1059297023 9:113280306-113280328 CCAAGGGCAAGTAGAGAAAAAGG - Intronic
1059522908 9:114960729-114960751 CCATGGGCACAAGGACAACGAGG - Intergenic
1203775293 EBV:69579-69601 CCATCGCCCCACAGAGAAAGAGG - Intergenic
1188174899 X:26977206-26977228 CCATCGCCAAAAAGAGAAAGAGG - Intergenic
1188275959 X:28200517-28200539 CTGTAGGAACATAGAGAAAGAGG - Intergenic
1189732199 X:44033326-44033348 CCATGGGAACATAGAGGAGTTGG - Intergenic
1190767110 X:53484401-53484423 CAATGGGCCCATAAAGAAATAGG - Intergenic
1190953702 X:55171331-55171353 CCATGGCCACGTAGAGAAAAGGG + Intronic
1191629917 X:63311773-63311795 CAATGGGCCCATGGAAAAAGTGG - Intergenic
1191669978 X:63740006-63740028 CCATGAGCACAAACACAAAGAGG + Intronic
1193053603 X:77126578-77126600 CAATGGGCCCATAAACAAAGTGG + Intergenic
1193479610 X:82010957-82010979 GCAGGGGAACACAGAGAAAGAGG - Intergenic
1195375307 X:104220953-104220975 CAATGGGCAGTTAGAGAAAAGGG + Intergenic
1195533418 X:105982918-105982940 CCAGAGGCACTTGGAGAAAGTGG + Intergenic
1195974974 X:110516865-110516887 CCAAGAGGACATAGACAAAGTGG - Intergenic
1197550589 X:127887696-127887718 ACCTGGGCTCCTAGAGAAAGTGG + Intergenic
1198170112 X:134097051-134097073 CCATGGGCTCATAAACAAAATGG + Intergenic
1198641609 X:138762024-138762046 CAATGGTCACATATAGAAAGTGG - Intronic
1200521375 Y:4212834-4212856 CAATGGGCACATGAATAAAGTGG + Intergenic
1202625440 Y:56852635-56852657 CCAGAGGTACATAGAGAAGGTGG + Intergenic