ID: 919405728

View in Genome Browser
Species Human (GRCh38)
Location 1:197180630-197180652
Sequence GCTATAAAACAGATGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919405728 Original CRISPR GCTATAAAACAGATGGATCA AGG (reversed) Intronic
903537463 1:24076474-24076496 GAAATAAAACAGATGGAACCTGG - Intronic
907556767 1:55350851-55350873 CCCATACAACAGAAGGATCATGG - Intergenic
908368846 1:63458938-63458960 GCAATATAACTGATGAATCATGG - Intronic
908392625 1:63697389-63697411 GCCATAAAATGGATGGATCCTGG - Intergenic
910217547 1:84857581-84857603 GCTGCAAAACATTTGGATCAAGG + Intronic
910291185 1:85602023-85602045 GTTATAAAATAGATAAATCAGGG - Intergenic
911355078 1:96806919-96806941 GCTCTAATACAGATGGCTGATGG + Exonic
912131095 1:106601391-106601413 CCTATAAAACATAGGGAGCAGGG + Intergenic
912256591 1:108065681-108065703 GCAAGAAGACAGATGGATCTTGG - Intergenic
912703294 1:111894420-111894442 GCTATGAAGGAGATGGAACAGGG - Intronic
916284273 1:163087518-163087540 TCTATAGAACAGGTGGATCCTGG - Intergenic
916671380 1:167024403-167024425 TCTTTAAAACAGATGGTTCTAGG + Intergenic
918732478 1:188015207-188015229 GCTATAAAACAAATGTACAATGG - Intergenic
919405728 1:197180630-197180652 GCTATAAAACAGATGGATCAAGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922400486 1:225249244-225249266 GAAATAAAAAAGATGGATCAAGG + Intronic
922971128 1:229739600-229739622 TCTATAAAACAGGGGGACCATGG + Intergenic
923063385 1:230497214-230497236 GCTGTAAAAGAGATGGAGGAGGG + Intergenic
924353958 1:243150150-243150172 TCTAAAAAATAGATGTATCACGG - Intronic
1062777670 10:167536-167558 GCTATGTAACACATTGATCAAGG - Intronic
1063403422 10:5770073-5770095 GCTACAACACAGATGAACCATGG + Intronic
1063612916 10:7578138-7578160 GCAATAAAACAGAAGGAGCTTGG + Intronic
1065914619 10:30343513-30343535 GCTATGAAACTGATGGATCAAGG + Intronic
1068225459 10:54102492-54102514 AGCATAAAACAGATGGATCTTGG - Intronic
1068502005 10:57851458-57851480 GAAATAAAACTGCTGGATCATGG - Intergenic
1072513861 10:96157272-96157294 GATATAAAATAGGTGCATCAAGG + Exonic
1073859263 10:107718713-107718735 GCTATAAAACATATAGATAATGG - Intergenic
1075064873 10:119282593-119282615 ACTATCGAGCAGATGGATCAAGG + Intronic
1075515463 10:123104631-123104653 GCTCTAAGACAGATGGTCCATGG + Intergenic
1077881805 11:6356495-6356517 GCTATAAAATAAGTGGATAAGGG + Intergenic
1078500216 11:11866373-11866395 GATATGAAACAGATTGTTCATGG - Intronic
1079687427 11:23377413-23377435 TCTATAACACAGATGCAGCAGGG + Intergenic
1082751709 11:57025549-57025571 ACTAGAAAACATATGGTTCAGGG + Intergenic
1087044341 11:93831595-93831617 GCCATTAAACAGAAAGATCATGG - Intronic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1088743897 11:112788386-112788408 GCCACAAACCAGATGGAACAGGG - Intergenic
1089079000 11:115760687-115760709 GCTGTGAAACAGAGGGAGCATGG - Intergenic
1090846372 11:130533174-130533196 TCTAGAAAGCAGATGGCTCAGGG - Intergenic
1093486572 12:19659381-19659403 GATATATAACAGATGACTCAGGG - Intronic
1095318370 12:40794386-40794408 GCTATAAAACAGCAGGAACTTGG - Intronic
1096456667 12:51793047-51793069 GATTTAAAACAAATGGATCATGG - Intronic
1098386717 12:69927273-69927295 GCTACTAAACAGATGTCTCATGG - Intronic
1099339100 12:81404622-81404644 TCTATAAAATACATGGATAAAGG + Intronic
1099569767 12:84302024-84302046 GCTATAAAATTGAAGGATTATGG + Intergenic
1101501234 12:105306085-105306107 GATAGAAAACAGATTGCTCATGG + Intronic
1102407138 12:112683395-112683417 CCTACCAAACAGATGGCTCATGG + Intronic
1109495257 13:63161954-63161976 GGTATAGAACAGATGTATCTAGG - Intergenic
1112151271 13:96767139-96767161 GATATAAAACACAAAGATCACGG - Intronic
1115103824 14:29736056-29736078 TCTATGAAACAGATGGATATAGG - Intronic
1115751271 14:36492971-36492993 GCAATAAAACAGAGGAAGCAGGG - Intronic
1115955095 14:38768909-38768931 GCTTTAAAACATATTGATTATGG - Intergenic
1116236793 14:42288827-42288849 GTTACAGAACAGATGGATGAGGG - Intergenic
1116465777 14:45230956-45230978 ACTATAATACAGATTAATCATGG - Intronic
1117575084 14:57089659-57089681 GATATAAAACAAATTGATCTTGG + Intergenic
1118496407 14:66312074-66312096 ACTATAGAACAGATGGCCCAAGG + Intergenic
1119732903 14:76962413-76962435 GTGATAAAACACATGGATGAAGG + Intergenic
1120014186 14:79451486-79451508 CCAATTAAATAGATGGATCATGG + Intronic
1120122920 14:80703896-80703918 GCTATAAATTAGTTGGATGAGGG - Intronic
1120669651 14:87349135-87349157 GCTGTAAAGCAGGTAGATCAGGG + Intergenic
1123679762 15:22753504-22753526 GCTACAAAACAGATGAAAAAAGG - Intergenic
1124165169 15:27319826-27319848 GCTATTAAAAAAATGTATCATGG - Intronic
1124331977 15:28827979-28828001 GCTACAAAACAGATGAAAAAAGG - Intergenic
1129605983 15:77025262-77025284 GCTGCAAAACAGATGGGTCCAGG - Exonic
1130759525 15:86804084-86804106 GCTAGAAGACAAAGGGATCATGG + Intronic
1131006986 15:88986369-88986391 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1133389648 16:5399303-5399325 GCTCAAAAACAGATAAATCAAGG - Intergenic
1134821030 16:17247588-17247610 CCTATAAAACAGATTGCACAAGG - Intronic
1136115963 16:28094659-28094681 GCCATAAAACAGCAGGATCTCGG + Intergenic
1137381127 16:48000725-48000747 GCTAAAAAACAGAAAGACCAAGG + Intergenic
1137399519 16:48141940-48141962 GCTATGAAAGTGATGGATGATGG + Intronic
1140160547 16:72487536-72487558 ACTATAAAACAGTAAGATCAAGG - Intergenic
1140177394 16:72676256-72676278 GCTGTATAACAAATGGGTCAAGG + Intergenic
1143842076 17:9740480-9740502 GATAAAATACAGTTGGATCACGG + Intergenic
1146761112 17:35479928-35479950 GTTATAAAAAAGATGGAATAGGG - Exonic
1147491425 17:40870885-40870907 GAAATTAAACAAATGGATCATGG - Intergenic
1154005483 18:10523897-10523919 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1155241981 18:23872666-23872688 GCTAGAAAAGAGATGGAGGAAGG - Intronic
1157992026 18:52508782-52508804 GTTATAAAAGAGATGTAACAAGG + Intronic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1159871705 18:73766179-73766201 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1166349890 19:42191674-42191696 GGCAGAAAACAGAGGGATCAAGG + Intronic
1168182673 19:54672729-54672751 GTTAGAAAAGAGATGGTTCAGGG - Intronic
1168183128 19:54677184-54677206 GTTAGAAAAGAGATGGTTCAGGG - Intronic
925098721 2:1228326-1228348 GCCAGAAACCAGATGGATCAGGG - Intronic
925761279 2:7187067-7187089 GTTATAACACAGAGTGATCAGGG + Intergenic
926991239 2:18682808-18682830 TCCATAAAACAGATGGATTTTGG + Intergenic
928226377 2:29451876-29451898 GCTATAGAACAAATTCATCATGG - Intronic
929009827 2:37430214-37430236 GAAAAAAAAAAGATGGATCAAGG - Intergenic
929229289 2:39542616-39542638 GCCTTAAACCAGATGGAGCATGG + Intergenic
931679914 2:64737480-64737502 GCTATAAACCAGCTGGAGGAAGG + Intronic
931899309 2:66770185-66770207 TCTATGAAACACATGTATCAAGG - Intergenic
939287894 2:140156225-140156247 AATATAAAACGGTTGGATCAGGG - Intergenic
942022420 2:171880124-171880146 GCTGTAATACAGATGAAGCAAGG + Intronic
943748324 2:191485486-191485508 GATATAAAAGATATGGCTCAAGG + Intergenic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
945001451 2:205355340-205355362 TTTATAAAACAAATGCATCATGG - Intronic
945523847 2:210864034-210864056 GCTGCAAAACAGATGCATTAGGG + Intergenic
945927708 2:215822518-215822540 TCTAAAAAACAAATGGATCCAGG + Intergenic
946268020 2:218565385-218565407 CCTATAAAACAAATGGACAAAGG + Intronic
946802119 2:223429500-223429522 GTTATAAAACATCTGGATTATGG + Intergenic
947233191 2:227910149-227910171 GCTATATAATATATGCATCATGG + Intronic
948077657 2:235178542-235178564 GCTAGCACACAGATGGATAATGG + Intergenic
1173349335 20:42230879-42230901 GCTATGGAACAGAGGGATCTGGG - Intronic
1177918550 21:27122836-27122858 GATCTAAAACAGCTGGTTCAAGG + Intergenic
1180569129 22:16699446-16699468 GCAATAAATCTCATGGATCATGG - Intergenic
1184730866 22:46370209-46370231 GCTCCAAAACAGATGGAGGACGG + Intronic
1185325567 22:50224256-50224278 GCTATAAAACACATAGAGCCTGG + Exonic
953075533 3:39566605-39566627 GCTAAAGACCAAATGGATCATGG + Intergenic
953107395 3:39897491-39897513 GCTATAAACCAGAGAAATCAAGG + Intronic
953505174 3:43479038-43479060 GTTATTAAACAAAAGGATCAGGG - Intronic
953505181 3:43479122-43479144 GTTATTAAACAAAAGGATCAGGG - Intronic
955778222 3:62456239-62456261 ACTATAATACAGATGGTTCATGG - Intronic
958758582 3:98279428-98279450 GATATTGAACAGAAGGATCAAGG - Intergenic
960355507 3:116648022-116648044 GATATAAATAAGATGGAGCAAGG + Intronic
962477459 3:135768218-135768240 GCTAAAGAAAAGATTGATCATGG + Intergenic
963128617 3:141837788-141837810 GTTATAAAAAAGATTAATCAGGG - Intergenic
964553817 3:157913890-157913912 GCTATAAAACATATGTTTAATGG + Intergenic
965820454 3:172679666-172679688 GTTATAAAAGAGATGATTCAGGG - Intronic
966404011 3:179576598-179576620 CCTATGAAACAGATGAAACAAGG - Exonic
969579156 4:8053993-8054015 GCAATAATACAGATGGAACAAGG - Intronic
970705548 4:18797319-18797341 GGAATAAAACAGAAGGACCATGG + Intergenic
973171360 4:47148014-47148036 GCCATATAACAAATGGATTAGGG + Intronic
975229111 4:71909703-71909725 GCTATTAAACAGATGGGCAAAGG - Intergenic
977175712 4:93817248-93817270 GCAAAAAATCAGTTGGATCATGG + Intergenic
977753822 4:100641564-100641586 TGCATAAAACAGATGGATCTTGG - Intronic
979247843 4:118529481-118529503 TCTAAAAAATAGATGTATCACGG + Intergenic
981899582 4:149846905-149846927 GCTTTAAAACAGAAGAATAAAGG + Intergenic
983277153 4:165631730-165631752 GCTACTAAATAGAAGGATCAGGG - Intergenic
984930480 4:184842777-184842799 GAAAAAAAACAGATGGATCATGG + Intergenic
986390729 5:7285299-7285321 GCTACAAAACAGATGAAAAAAGG - Intergenic
988441746 5:31241623-31241645 GCTGTAAGACAGATGGAGCAGGG - Intronic
988650906 5:33149799-33149821 GCTATAAAAGAGAAAGAGCATGG - Intergenic
989065265 5:37453932-37453954 GCTATAAAAGAAATAAATCAGGG - Intronic
989174777 5:38513210-38513232 GCTGGAAAGCAGATGGATAATGG + Intronic
995870201 5:116736515-116736537 GCTATAAAACAGGTAGAGCCTGG - Intergenic
995893205 5:116980836-116980858 GATATAAAACAGATGGACAGAGG + Intergenic
997130234 5:131269378-131269400 GCAAGAAAACAGATATATCAGGG - Intronic
1000294334 5:159899837-159899859 GCTATAAAACAGATACAGAAAGG - Intergenic
1001451399 5:171827727-171827749 GCTATAAAAGTGGTGGATCTGGG + Intergenic
1006560708 6:34909698-34909720 GCTATGAAACAGAGGGATGCTGG + Intronic
1010053991 6:71542326-71542348 GCCATACAGCAGAAGGATCATGG - Intergenic
1012183305 6:96182599-96182621 GCTATACACAAGATGGATCAAGG - Intronic
1012647733 6:101709235-101709257 GATATAAAACAGATAGACCGTGG + Intronic
1013260098 6:108433147-108433169 GGTATAAAACAGTTTAATCAGGG - Intronic
1014053555 6:116986541-116986563 GCTATAAAATACATGAACCATGG + Intergenic
1014263105 6:119242643-119242665 GCTATGAAACAGATGGACATTGG - Intronic
1026510810 7:71026050-71026072 GCTATAAAAAAGTGAGATCATGG + Intergenic
1027562888 7:79754362-79754384 GGTATAAAACCCATTGATCATGG + Intergenic
1027647111 7:80815599-80815621 GATATAAAACAGAGTGATGAAGG + Intronic
1029128267 7:98310491-98310513 GTTATTAAACATATCGATCAAGG + Exonic
1032841084 7:135714125-135714147 TATATAAAACAGATGGAACCAGG - Intronic
1037416252 8:18653105-18653127 GATATAAAACAAAGGGATTATGG - Intronic
1038720939 8:30034786-30034808 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1039165728 8:34677720-34677742 ACCATACAACAGCTGGATCATGG - Intergenic
1040902165 8:52428260-52428282 TCTAAAATACAAATGGATCAAGG + Intronic
1048884286 8:138897073-138897095 TCTATAAAACAGATAGATAATGG - Intronic
1050021201 9:1286326-1286348 GGTATAGGACAAATGGATCATGG - Intergenic
1050389823 9:5130385-5130407 GGTAAATAACAGATAGATCAAGG + Intergenic
1050735368 9:8756233-8756255 GCTATAAAACAGAGCAACCAGGG - Intronic
1050850320 9:10277075-10277097 GCTATAAACATGATGAATCAGGG - Intronic
1051014100 9:12454215-12454237 GCTATAAAACACATCAATCATGG + Intergenic
1051341635 9:16117434-16117456 GCAAAAAATCAGATGGATCTTGG - Intergenic
1051514839 9:17918052-17918074 GCTATGAAGCAGATTGATCAGGG - Intergenic
1052859668 9:33429600-33429622 GCTATAACACAGATGAACCTTGG - Intergenic
1055046321 9:71928960-71928982 GCTTTAAACCAAATGAATCATGG + Intronic
1056069934 9:82975749-82975771 GCTGGAAAGCAGATGGATAATGG - Intergenic
1057817894 9:98309060-98309082 GCTCTAAAATAGAAGGATTAGGG + Intronic
1058509479 9:105701609-105701631 AATATAAGACAGATGGATCTTGG - Intronic
1060197357 9:121632349-121632371 GTGATAAAACAGATGGGTCCTGG + Intronic
1060579624 9:124733092-124733114 TCTATTAAACAGATAGATCCTGG + Intronic
1192305815 X:69958414-69958436 GCTATTAAAGAGATGGAGCCAGG + Intronic
1192875458 X:75224901-75224923 GCTATCAAACAGGTAGTTCAAGG - Intergenic
1195751410 X:108164475-108164497 TGTCTAAAACAGCTGGATCAAGG - Intronic
1195894498 X:109732558-109732580 GTTAGAAAACAGCTGGATCCTGG - Intronic
1196466609 X:115978359-115978381 GTTATAAAAAAGTTTGATCAGGG + Intergenic
1199130253 X:144176889-144176911 GATATTAAACAGGTAGATCAAGG - Intergenic
1200354770 X:155536966-155536988 GTTATAAAAGAGATGAATCAAGG - Intronic
1201980882 Y:19909187-19909209 GCTATAAATAAAATGGGTCATGG - Intergenic