ID: 919409787

View in Genome Browser
Species Human (GRCh38)
Location 1:197228546-197228568
Sequence CAAAATGCTGATAGTAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919409787_919409790 3 Left 919409787 1:197228546-197228568 CCAATATTACTATCAGCATTTTG No data
Right 919409790 1:197228572-197228594 AAAACCATTCAACAAGTCTCTGG 0: 15
1: 74
2: 73
3: 67
4: 206
919409787_919409791 4 Left 919409787 1:197228546-197228568 CCAATATTACTATCAGCATTTTG No data
Right 919409791 1:197228573-197228595 AAACCATTCAACAAGTCTCTGGG 0: 335
1: 1966
2: 1995
3: 1255
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919409787 Original CRISPR CAAAATGCTGATAGTAATAT TGG (reversed) Intergenic
No off target data available for this crispr