ID: 919411253

View in Genome Browser
Species Human (GRCh38)
Location 1:197245997-197246019
Sequence CTCCTATGACACTACCATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919411249_919411253 24 Left 919411249 1:197245950-197245972 CCTCACTGACGTTGGTTGGGGGC No data
Right 919411253 1:197245997-197246019 CTCCTATGACACTACCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919411253 Original CRISPR CTCCTATGACACTACCATAG TGG Intergenic
No off target data available for this crispr