ID: 919415734

View in Genome Browser
Species Human (GRCh38)
Location 1:197306558-197306580
Sequence TGGCAAGCTTAGGATTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919415731_919415734 -5 Left 919415731 1:197306540-197306562 CCTGTCATATCCATTGGGTGGCA 0: 1
1: 0
2: 0
3: 2
4: 69
Right 919415734 1:197306558-197306580 TGGCAAGCTTAGGATTGTAGTGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919415734 Original CRISPR TGGCAAGCTTAGGATTGTAG TGG Intronic
903329092 1:22588038-22588060 TGGAAAGCTTAAGATCGTAAAGG + Intronic
905174819 1:36128577-36128599 TGGCCAGCTTCTGATTGTCGTGG - Intergenic
911250663 1:95572912-95572934 TGGTAAGCTAGGGATAGTAGTGG - Intergenic
919415734 1:197306558-197306580 TGGCAAGCTTAGGATTGTAGTGG + Intronic
921059726 1:211575308-211575330 TGGCAAACTTAGAATTTCAGTGG + Exonic
921680675 1:218027250-218027272 TGGCAAACCTAGGATTGGAAGGG - Intergenic
923616387 1:235541791-235541813 TGTCAAGCCTAGGATTAAAGTGG + Intergenic
923920579 1:238559986-238560008 AGGCAAACTCAGAATTGTAGAGG + Intergenic
1063944854 10:11166055-11166077 GGGCAAGCCTAGGAACGTAGGGG - Intronic
1068478691 10:57562346-57562368 TTGCCAGCTTCTGATTGTAGAGG - Intergenic
1074790754 10:116885089-116885111 TGGTAAGCATAGGCTTGAAGAGG - Exonic
1074953923 10:118368862-118368884 TGGAAAGCTTAGGAAAATAGTGG + Intergenic
1077279808 11:1738338-1738360 TGGTAAGCTGAGGAGTGTACTGG + Intronic
1080344720 11:31311677-31311699 TGGCATCTTTAGGATTGTCGAGG - Intronic
1081994427 11:47354436-47354458 TGGGAAACTGAGGCTTGTAGAGG - Intergenic
1084536153 11:69758455-69758477 TGGGAAGCTCAGGAAGGTAGAGG + Intergenic
1091022308 11:132111558-132111580 TGGCTTGCTTAGGACTGCAGAGG - Intronic
1092830360 12:12438701-12438723 TTGCAAGCTGATGATTGTAGTGG - Intronic
1097881350 12:64689466-64689488 TCACAAGCTTAGTATTGTGGGGG + Intronic
1102207816 12:111102345-111102367 TAGCAAGCTCAGGCTTGTGGCGG + Intronic
1104616023 12:130269407-130269429 TGTCCAGCCTAGAATTGTAGAGG - Intergenic
1107863230 13:44681111-44681133 TGGCTAGCTTTGGATTGTGTTGG - Intergenic
1108522708 13:51259911-51259933 TGGCAACCTTGGGCTGGTAGGGG + Intronic
1118303229 14:64633525-64633547 TGGCAGGCATAGGATGGTGGGGG - Intergenic
1119743954 14:77031183-77031205 TGACAAGCTCAGGCTTGCAGAGG + Intergenic
1120424187 14:84326732-84326754 TGGCAAGATAATGATGGTAGGGG + Intergenic
1202874390 14_GL000225v1_random:194385-194407 TGGTAAGCTTTGGATTGGAATGG + Intergenic
1124873190 15:33564260-33564282 CGGTCAGCTTAGGATTCTAGAGG - Intronic
1131178722 15:90225801-90225823 TGGCCAGCTGAGGCTGGTAGAGG - Exonic
1137547260 16:49413004-49413026 TGGAATTCTTAGGAATGTAGAGG - Intergenic
1141027873 16:80564958-80564980 TGGCAATCCCAGGCTTGTAGCGG + Intergenic
1145117657 17:20226319-20226341 TAGTAAGCATAGTATTGTAGAGG + Intronic
1150081898 17:62247548-62247570 AGGCAAGCTCAGGATGGTAAGGG + Intergenic
1155714260 18:28920639-28920661 TGGCAAGCGTACTATTGTACTGG + Intergenic
1157380824 18:47214792-47214814 TTGGAAGCTCAGGATTTTAGAGG + Intronic
1160983887 19:1828596-1828618 TGGGCAGCTCAGGGTTGTAGGGG + Exonic
1164398474 19:27886744-27886766 TGGCAGGCTAAGGACTGTATGGG - Intergenic
1166021230 19:40031661-40031683 TGGCACCCTTTGGATTGTATAGG - Exonic
926996632 2:18742499-18742521 TGGCAAGCTCAGAAGAGTAGTGG - Intergenic
929272676 2:39990091-39990113 TTGCATGCATAGGACTGTAGGGG + Intergenic
935823536 2:106918086-106918108 TGACAAGTTTAGACTTGTAGTGG + Intergenic
941537621 2:166742174-166742196 TTGCAAGCTTTGCATAGTAGTGG + Intergenic
942375126 2:175328875-175328897 TGACAAGCCCAGGATTGTACAGG + Intergenic
944285345 2:197943072-197943094 TGGCATGCGTGGGATTGTCGGGG + Intronic
945579999 2:211581460-211581482 TGGTAAGCATAGGCTTGAAGAGG - Intronic
1172532636 20:35643767-35643789 GGTCAAGCTTATGATTGCAGAGG - Intronic
1173848599 20:46203312-46203334 TGGCAAACTTAGGGGTGGAGGGG + Intronic
1184971392 22:48023816-48023838 TGGCAAACTAAGGATAGGAGAGG + Intergenic
954361102 3:50123262-50123284 TGGCATGCTTATGAGTGCAGAGG - Intergenic
956226487 3:66964958-66964980 TGCCAAGCTTAGTACAGTAGGGG - Intergenic
957899218 3:86466708-86466730 TAGCAGGCTTAGAATTTTAGAGG + Intergenic
967067773 3:185935936-185935958 TCGCAATCTTTGAATTGTAGAGG - Intronic
967234863 3:187374263-187374285 TTGCAAGATGTGGATTGTAGTGG - Intergenic
967553124 3:190823129-190823151 TGGCAGGTCTAGCATTGTAGCGG + Intergenic
973554792 4:52072274-52072296 TGCCAAGCTTTGAATTGTAAAGG + Intronic
975625756 4:76345194-76345216 TGACAAACTTAGGAAAGTAGAGG + Intronic
984146393 4:176066111-176066133 AGGCAAGCTCAGGATTGATGTGG + Intronic
988849489 5:35164797-35164819 TGCCAGGATTAGGATGGTAGCGG + Intronic
992743326 5:79795457-79795479 TGGCAAGTTTAGGAATGGACAGG - Intronic
993605178 5:89981126-89981148 TGGTAAGATTAGGAGTGGAGTGG - Intergenic
993658099 5:90597184-90597206 TGGCAAACTTTTGATTATAGTGG - Intronic
1001205524 5:169759115-169759137 GGGAAAGCTGAGCATTGTAGTGG - Intronic
1001461808 5:171922395-171922417 TGGCAAGATTTGGGTTTTAGGGG - Intronic
1004590975 6:17051233-17051255 TAGCAGGATTAGGATTGAAGAGG + Intergenic
1013317722 6:108957947-108957969 TGGAAAGAGTAGGATAGTAGGGG + Intronic
1024321866 7:48078967-48078989 TGCCAGGCTTAGGGTTGGAGTGG + Intergenic
1029926764 7:104327598-104327620 TGGTTAGCTTTGGGTTGTAGGGG + Intergenic
1031622312 7:123949014-123949036 TGGGAAGATTAGGATTTTTGAGG - Intronic
1032409111 7:131680821-131680843 TGAGAAGCTAAGGATTGGAGGGG + Intergenic
1032650227 7:133869872-133869894 TGGCAAGCTGTGGATTGAACTGG - Intronic
1038197504 8:25381746-25381768 TGGCATGCTAACCATTGTAGGGG + Intronic
1041748458 8:61234091-61234113 TGGCAAGGGTAGGAGGGTAGGGG + Intronic
1044817684 8:96130029-96130051 AAGCAAGTTTAGGATTGTAGTGG - Intergenic
1049849782 8:144824678-144824700 TGGCAGGCTCAGGGCTGTAGGGG - Intergenic
1049917837 9:335795-335817 TGGCAAGTTTAGGTGGGTAGAGG + Intronic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051828723 9:21251776-21251798 TGGCAAGCTCAGCACTGCAGAGG - Intergenic
1052468574 9:28863284-28863306 TGGTATGCTTAGGATTTAAGGGG + Intergenic
1054813276 9:69451603-69451625 TGGCGATCTGGGGATTGTAGGGG - Intronic
1054830280 9:69617322-69617344 TGACAAGATTAATATTGTAGTGG + Intronic
1192511668 X:71723691-71723713 TGGCAATCATAGGATCATAGTGG + Intergenic
1192515029 X:71757814-71757836 TGGCAATCATAGGATCATAGTGG - Intergenic
1192528272 X:71866711-71866733 TGGCAATCATAGGATCATAGTGG - Intergenic
1196760099 X:119193229-119193251 AGGTAAGATTAGGATTGTAAAGG - Intergenic
1197611480 X:128643929-128643951 TGGGAAGCTAAGCATTGCAGGGG + Intergenic
1201604623 Y:15771456-15771478 TTGCAAGCTTTGCATAGTAGTGG - Intergenic