ID: 919416271

View in Genome Browser
Species Human (GRCh38)
Location 1:197314136-197314158
Sequence CCTCTGGTACTGCAATTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919416264_919416271 1 Left 919416264 1:197314112-197314134 CCTCCCTGTTCTTTTTCTCCTCT 0: 1
1: 1
2: 11
3: 151
4: 1382
Right 919416271 1:197314136-197314158 CCTCTGGTACTGCAATTATATGG 0: 1
1: 0
2: 0
3: 10
4: 87
919416263_919416271 25 Left 919416263 1:197314088-197314110 CCATTATTAATTCAGAATATTTT 0: 1
1: 0
2: 14
3: 123
4: 1179
Right 919416271 1:197314136-197314158 CCTCTGGTACTGCAATTATATGG 0: 1
1: 0
2: 0
3: 10
4: 87
919416265_919416271 -2 Left 919416265 1:197314115-197314137 CCCTGTTCTTTTTCTCCTCTCCC 0: 1
1: 0
2: 21
3: 179
4: 1523
Right 919416271 1:197314136-197314158 CCTCTGGTACTGCAATTATATGG 0: 1
1: 0
2: 0
3: 10
4: 87
919416266_919416271 -3 Left 919416266 1:197314116-197314138 CCTGTTCTTTTTCTCCTCTCCCT 0: 1
1: 1
2: 16
3: 205
4: 1624
Right 919416271 1:197314136-197314158 CCTCTGGTACTGCAATTATATGG 0: 1
1: 0
2: 0
3: 10
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919416271 Original CRISPR CCTCTGGTACTGCAATTATA TGG Intronic
901135884 1:6995069-6995091 CTTCTGGGACTTCAATTATATGG + Intronic
912617095 1:111113700-111113722 CCTCTGATAATGCAAACATATGG + Intergenic
913158600 1:116124728-116124750 CCTGTGGTACTGCAGTCAGATGG - Intronic
919416271 1:197314136-197314158 CCTCTGGTACTGCAATTATATGG + Intronic
920261727 1:204692912-204692934 CCTCAGGTTCTGCAAGTACAGGG - Intergenic
922126317 1:222728134-222728156 TCTCTAATACTGCAACTATAGGG - Intronic
922439360 1:225639921-225639943 CCTCTGGACCTCTAATTATATGG + Intronic
922680886 1:227594623-227594645 CCTCTGGTAAAAGAATTATAAGG - Intronic
923493006 1:234501033-234501055 CCTCAGGTCCTGGAATGATAAGG + Intergenic
924711217 1:246531391-246531413 CCTAAGGTTCTGCAATTAGAAGG - Intergenic
1064337204 10:14454455-14454477 CCTCTGGCACCGCATTTATTCGG + Intronic
1067262738 10:44708541-44708563 CCTCTGGTTCTGAAATTACATGG - Intergenic
1071746904 10:88431010-88431032 CCTCTAGTACTTCAATTTTCTGG + Intronic
1074076922 10:110136719-110136741 CCTCTTGTACTGTATTTTTAGGG - Intergenic
1075883298 10:125873508-125873530 TTTCTGGTACTGAAATTAAAGGG - Intronic
1086327422 11:85718020-85718042 GCTCTGTTGCTGCATTTATATGG + Intronic
1090328385 11:125908966-125908988 CTTCTGGTCCTGCAGTTAGATGG - Intronic
1090353569 11:126123727-126123749 ACTCTGGTTCTGTAATTTTAAGG + Intergenic
1090968120 11:131616093-131616115 CCTCTGTTCCTGCAATTGCATGG + Intronic
1091762933 12:3099146-3099168 TTTCTGGTACCCCAATTATATGG + Intronic
1093270561 12:17055437-17055459 TCTCTGGGACTGCTTTTATAAGG + Intergenic
1093335042 12:17894630-17894652 CCTCTAGTGATGCAGTTATAAGG - Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1103815298 12:123650207-123650229 CCTCTTGAACTGCAGTTTTAGGG + Intronic
1106276442 13:28212843-28212865 CATCAGGAACTCCAATTATAAGG - Intronic
1106656558 13:31752922-31752944 CCTCTGGTGCTGCAGTTAGTTGG + Intronic
1109482031 13:62968169-62968191 CTTCTGGGACTGCAGTGATATGG - Intergenic
1110885352 13:80626620-80626642 TCTCTGGAACTACTATTATATGG + Intergenic
1111820914 13:93214229-93214251 CCTCAGGTTCTGCAATGTTATGG - Intergenic
1117343475 14:54810945-54810967 CCTCTGTTACTGGAATCGTATGG - Intergenic
1121676708 14:95759410-95759432 CTTCTAGAACTGAAATTATAGGG + Intergenic
1124466550 15:29945136-29945158 CCTCTGGTGTTTCAAGTATATGG + Intronic
1125274648 15:37978031-37978053 CCACTGCTACTGCCATTGTAGGG - Intergenic
1132384949 15:101393626-101393648 CCTGTGATTCTGCAATTTTAAGG - Intronic
1135791554 16:25401320-25401342 CCTCTAGGACTTCAACTATAGGG + Intergenic
1145356759 17:22164658-22164680 CTTCTGGGACCGCAATGATATGG + Intergenic
1150188297 17:63210090-63210112 TCTCTGGTTCTGCAATTGTCAGG + Intronic
1154388471 18:13916682-13916704 CCTCTGCTTCTGCAAGTACAAGG - Intergenic
1159395471 18:67850030-67850052 CCTCTGGTCCTGAAATTGTTTGG - Intergenic
1168582313 19:57565875-57565897 TCTAAGGTACTGCAATGATATGG + Intergenic
1168633209 19:57973390-57973412 CCTCTAGTACTCAAATTAGAAGG + Intronic
925019921 2:560365-560387 CCTCAGGTACTGCAAGGAGAAGG - Intergenic
926827831 2:16926114-16926136 CCTCTGCTTGTTCAATTATATGG + Intergenic
927308645 2:21603067-21603089 TCTCTGGTACTGCTATGATGGGG + Intergenic
931803218 2:65778794-65778816 CCTCTGGCACTGTAATTAGTGGG + Intergenic
933382786 2:81570831-81570853 CGTGTGGTACTGTAATTAAAGGG - Intergenic
937325376 2:120986964-120986986 CCTTTGGGACTGGAATTAAATGG - Intronic
939014778 2:136889907-136889929 CCTCTAGTACTGCTAAAATAGGG + Intronic
939784212 2:146488771-146488793 ATTTTGGTACTTCAATTATATGG - Intergenic
942541317 2:177018115-177018137 CCTTTGTTACTGCATTTAGAAGG - Intergenic
1171133847 20:22678816-22678838 CCTCTGGTATTGAAATTATCAGG + Intergenic
1175139473 20:56849539-56849561 ACTCTGGTCCTTCAAATATAGGG + Intergenic
1181960437 22:26618422-26618444 CCTCTGTGTCTGCAATTATAAGG + Intergenic
1182108357 22:27705070-27705092 CCTCTGGGGCTGCTTTTATAAGG + Intergenic
1183101652 22:35587866-35587888 CCTCTGGATCTGAAATGATATGG + Intergenic
1184902297 22:47454424-47454446 CTTTTGGGACTGCAATTACAAGG - Intergenic
949421370 3:3869760-3869782 CCTTTGGAGATGCAATTATAAGG + Intronic
950063923 3:10095843-10095865 CCTCTGGTTCTAAATTTATAAGG + Intronic
952646912 3:35671053-35671075 ACTCTGGTACAGCAAATGTATGG - Intronic
953952633 3:47203510-47203532 CCTCTTGTAGTGCAATTGTATGG - Intergenic
955891412 3:63653928-63653950 CCTCTGGTTCTTCAATCATATGG + Intronic
958629060 3:96665284-96665306 CTTCTGGTACTCCAATAATTTGG - Intergenic
961773803 3:129269413-129269435 CCTCTGGTGTTGCATTTTTAAGG + Intronic
964150551 3:153518904-153518926 CCTCTGGGCCTGCAATCAGAGGG + Intergenic
964516824 3:157519634-157519656 CCCCAGGTACTGAAATTATTAGG - Intronic
969198381 4:5581757-5581779 CCTCTGGGACTGTGATTAAAGGG - Intronic
970518543 4:16859727-16859749 CCTCTGGTACTGTGATTGTGTGG - Intronic
971619271 4:28833547-28833569 ACTCAGGTACTGTCATTATAAGG - Intergenic
980791140 4:137620974-137620996 GCTCTGGTTCTCCAAATATAGGG - Intergenic
981533083 4:145771835-145771857 CCTAAGGTACTGAAATAATAGGG + Intronic
982438213 4:155401837-155401859 CCTCTTGTACTCCAATTGTATGG - Intergenic
984767474 4:183410543-183410565 CCTCTGGCACTGCAGAGATAGGG - Intergenic
992009390 5:72511720-72511742 CCTGTGGTTCTCCAATTTTAGGG - Intergenic
992237262 5:74723720-74723742 CATCTGGTACTACAGTTAAAAGG + Intronic
997771943 5:136563211-136563233 CCTAGGGTCCTGGAATTATAAGG - Intergenic
998921672 5:147075010-147075032 TTTCTGATACTGCAATTCTAGGG - Intronic
1007185436 6:39967147-39967169 CCTCTGACACTGCACTGATAGGG - Intergenic
1008574223 6:52844202-52844224 GCTCTGGTCCTGCAATCAGAAGG - Intronic
1012205934 6:96460141-96460163 CCTCTGGTATTGCATTTATGGGG + Intergenic
1014651269 6:124041304-124041326 CTTCTGTTACTACAGTTATAAGG - Intronic
1018574854 6:165249266-165249288 CCTCTGGTCCTTCAATTTTATGG + Intergenic
1020984788 7:15119895-15119917 TCTCTGGTGCTACATTTATAAGG - Intergenic
1021021304 7:15601018-15601040 CCTCTTATACTGCTATAATAGGG + Intergenic
1022420454 7:30216137-30216159 CTTCTGGTATTCCAATTACATGG - Intergenic
1028607713 7:92673196-92673218 TGTCTGGGACTGCAGTTATATGG - Intronic
1029029501 7:97453052-97453074 CCTCTGGTACTCCTCTTATTTGG - Intergenic
1032997778 7:137467104-137467126 CCTCTGCCACTGCTATTCTAAGG + Intronic
1035142371 7:156775640-156775662 TCTCTAGAACTACAATTATAGGG + Intronic
1037745148 8:21637474-21637496 CCTCTGGCACTGCAGTTACCTGG + Intergenic
1041378096 8:57222784-57222806 CCTGTGGTTCTGCAATGAGAAGG + Intergenic
1041624624 8:60011393-60011415 CATATGGTATTGTAATTATATGG - Intergenic
1042949423 8:74185644-74185666 CCCATTCTACTGCAATTATATGG - Intergenic
1050739444 9:8803320-8803342 CCTCAGGTAATTAAATTATAGGG - Intronic
1058238714 9:102528044-102528066 CCTCTTTTACTGCAATTTTTGGG + Intergenic
1186117667 X:6321897-6321919 CCTCTGGTTCTGAAATTTTATGG + Intergenic
1186574263 X:10748900-10748922 TCTTTGGTACTGCTATTTTAAGG + Intronic
1192422505 X:71046048-71046070 CATCAGGCACTGCAAATATAGGG + Intergenic
1199783696 X:151084908-151084930 CCTCTGGTCTAGCAAATATAAGG - Intergenic