ID: 919418435

View in Genome Browser
Species Human (GRCh38)
Location 1:197340835-197340857
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8564
Summary {0: 5, 1: 179, 2: 2034, 3: 3746, 4: 2600}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919418435_919418437 -6 Left 919418435 1:197340835-197340857 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 919418437 1:197340852-197340874 ATAAAGACATACCCTAGACTGGG 0: 58
1: 3386
2: 7414
3: 9049
4: 10689
919418435_919418440 7 Left 919418435 1:197340835-197340857 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 919418440 1:197340865-197340887 CTAGACTGGGTGATTTATTTAGG 0: 1
1: 0
2: 5
3: 183
4: 2781
919418435_919418441 14 Left 919418435 1:197340835-197340857 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 919418441 1:197340872-197340894 GGGTGATTTATTTAGGAAAAAGG 0: 1
1: 0
2: 17
3: 558
4: 5581
919418435_919418436 -7 Left 919418435 1:197340835-197340857 CCATTTTCACTCTGCTAATAAAG 0: 5
1: 179
2: 2034
3: 3746
4: 2600
Right 919418436 1:197340851-197340873 AATAAAGACATACCCTAGACTGG 0: 22
1: 1324
2: 5067
3: 7488
4: 8372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919418435 Original CRISPR CTTTATTAGCAGAGTGAAAA TGG (reversed) Intronic
Too many off-targets to display for this crispr