ID: 919421196

View in Genome Browser
Species Human (GRCh38)
Location 1:197372392-197372414
Sequence GGGGAATGTCTCTCCTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919421196_919421204 2 Left 919421196 1:197372392-197372414 CCCCCAAAGGAGAGACATTCCCC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 919421204 1:197372417-197372439 CATACAAACATATAACACAAAGG 0: 1
1: 0
2: 2
3: 57
4: 575
919421196_919421206 28 Left 919421196 1:197372392-197372414 CCCCCAAAGGAGAGACATTCCCC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 919421206 1:197372443-197372465 AGACTCTAGTTCAGAATTTCTGG 0: 1
1: 0
2: 2
3: 24
4: 239
919421196_919421205 3 Left 919421196 1:197372392-197372414 CCCCCAAAGGAGAGACATTCCCC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 919421205 1:197372418-197372440 ATACAAACATATAACACAAAGGG 0: 1
1: 1
2: 9
3: 63
4: 752

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919421196 Original CRISPR GGGGAATGTCTCTCCTTTGG GGG (reversed) Intronic
901329736 1:8396781-8396803 GGGGGAGGGGTCTCCTTTGGGGG - Intronic
906315406 1:44784017-44784039 TGGGAATGTGTCCACTTTGGTGG - Exonic
910501799 1:87900780-87900802 GGTGAATGTGTGTCCTTGGGAGG + Intergenic
912322493 1:108727469-108727491 GGGGAATGGCTTTCCAGTGGAGG + Intronic
913448891 1:118979098-118979120 CGGGAATGGCTTCCCTTTGGAGG - Intronic
915404092 1:155645944-155645966 GGAAAATGTTTCTCCTTTTGTGG - Intergenic
915974568 1:160376430-160376452 GGGGAATGTCTCTCCCTGAGGGG + Intergenic
917599481 1:176560048-176560070 GGGGAATGTCTCTGATTTCTTGG + Intronic
917644303 1:177014854-177014876 GGGGAATGCCTCTGCTATGAAGG - Exonic
919189504 1:194197539-194197561 GTACAATGTCTCTTCTTTGGTGG - Intergenic
919421196 1:197372392-197372414 GGGGAATGTCTCTCCTTTGGGGG - Intronic
1062968377 10:1627337-1627359 GGAGAATTTCTCTCCTTTGTGGG - Intronic
1063118917 10:3090763-3090785 GGGGAAAATCACTCTTTTGGGGG + Intronic
1063460130 10:6210107-6210129 GGGGGGTGTCTCTTTTTTGGTGG + Intronic
1067326794 10:45276292-45276314 GGTGAATTTCTCTCCTCTTGAGG + Intergenic
1073450252 10:103604920-103604942 TGGGAATGTCACTGCTTTAGAGG + Intronic
1073818257 10:107231555-107231577 GATGAAAGTCCCTCCTTTGGAGG + Intergenic
1077261174 11:1621807-1621829 GGGGGCTGTGTCTCCTGTGGGGG - Exonic
1079236753 11:18696522-18696544 GGGGGATGCCTCTGCTTTGTAGG + Intronic
1079280666 11:19084052-19084074 GGGGAAAGACACTCGTTTGGAGG + Intergenic
1079322768 11:19465256-19465278 GGGGGCTGTCTTTTCTTTGGCGG - Intronic
1081330444 11:41793914-41793936 GGGCAATGGCTCCCCTTTGCTGG + Intergenic
1081835657 11:46151484-46151506 GAGGACTGTCACTCCTTTGATGG - Intergenic
1084254465 11:67930208-67930230 GGGGGTTGTCTCTACTTGGGGGG + Intergenic
1084800144 11:71538257-71538279 GGGGACTGTGGCTCCTGTGGGGG + Exonic
1086975554 11:93128696-93128718 GGAGAATTTGCCTCCTTTGGCGG - Intergenic
1088095744 11:106099389-106099411 GGGGATTGTCTCTCCTGTGTTGG + Intergenic
1088562788 11:111132881-111132903 TGGCAATGTCTCTCATTTTGGGG - Intergenic
1092424532 12:8363680-8363702 GGGGGTTGTCTCTACTTGGGGGG + Intergenic
1094084764 12:26577213-26577235 GGGCAATGTCCCTCCATAGGAGG + Intronic
1095799218 12:46254584-46254606 GGTAAATTTCTCTCCTTTTGAGG + Intronic
1096337794 12:50770445-50770467 GGTAAATTTCTCTCCTTTTGAGG - Intronic
1097310836 12:58117466-58117488 GCGGATTGTAGCTCCTTTGGTGG + Intergenic
1098299831 12:69043001-69043023 GGGGCATGTGTGGCCTTTGGTGG + Intergenic
1099858597 12:88202357-88202379 GGCGAATGGCTCTCCTTGGAAGG - Intergenic
1104494000 12:129219551-129219573 GGGGAATTTCTCTCCTTGCATGG - Intronic
1104764689 12:131319910-131319932 GGTGAATTTCTCTCCTTCTGAGG + Intergenic
1107033417 13:35876827-35876849 GAGGACTGTATTTCCTTTGGTGG + Intronic
1107050558 13:36043880-36043902 GGGGAATGTATCTCATTTTTTGG - Intronic
1118105724 14:62657359-62657381 GGGGAAAGCCTCTTCTTTGCTGG + Intergenic
1121614288 14:95302589-95302611 GAGGAATGTGTTTGCTTTGGTGG - Intronic
1122542295 14:102505255-102505277 GGGAGGTGCCTCTCCTTTGGAGG - Exonic
1122871993 14:104642943-104642965 AGGGAATTTCTCTGCTTTGGAGG + Intergenic
1123978676 15:25578373-25578395 GGGCAATGTCACTCCTTGGTTGG + Intergenic
1132234144 15:100206568-100206590 TGGAAATGTCTCCCCTTTGCTGG + Intronic
1135967813 16:27050540-27050562 GGGAATAGTCTCTACTTTGGGGG + Intergenic
1138068670 16:53968713-53968735 GTGAAATGTCTCTCCTTTTATGG - Intronic
1140466673 16:75188630-75188652 GAGGAAGGGGTCTCCTTTGGGGG + Intergenic
1145063982 17:19749648-19749670 GGTGAATGACTCTCCTGGGGCGG + Intergenic
1148511962 17:48178444-48178466 GGGGAATGCATCTCCTTTTAGGG + Intronic
1148674238 17:49435759-49435781 GAGGAATGTCCCTGCATTGGGGG - Intronic
1148973477 17:51505613-51505635 GCTGAATGTCTCACCTTTGATGG + Intergenic
1149209202 17:54284984-54285006 GGGGATTATATCTCCTCTGGAGG - Intergenic
1149441631 17:56678987-56679009 GGTGAGCGTCTCTCCGTTGGAGG - Intergenic
1149477050 17:56971393-56971415 GGTGAATTTCTCTCCTCTTGAGG - Intergenic
1154369869 18:13750222-13750244 GGGAAATGTCTGTATTTTGGAGG + Intronic
1155101057 18:22610250-22610272 GGGGAAAGTTTCTCTTTTGTGGG - Intergenic
1155579690 18:27289105-27289127 AAGGAATGTCTCTCCTTTCTGGG - Intergenic
1159474431 18:68901602-68901624 GGGGAAAGACTTTTCTTTGGAGG - Intronic
1159757348 18:72381581-72381603 TGTGAATGTATTTCCTTTGGGGG - Intergenic
1162906380 19:13826380-13826402 GGTGAATCCCTCTCCTTAGGCGG - Intronic
1163939307 19:20477846-20477868 AGAGGATGTCTCTACTTTGGAGG + Intergenic
924972737 2:144079-144101 GGTGAATTCCTCTCCTTTTGAGG + Intergenic
926736522 2:16077685-16077707 GGGGATTATTTCTCCCTTGGGGG - Intergenic
927685372 2:25167391-25167413 GTGGACTGTCTCTCCTTCGCTGG + Intronic
930031173 2:47058899-47058921 GGGGTGTGTGTCTGCTTTGGAGG + Intronic
930292658 2:49515259-49515281 ATGGTATGTCTTTCCTTTGGTGG - Intergenic
932916582 2:75865685-75865707 GGGGAATTTGTGTCTTTTGGGGG + Intergenic
933000602 2:76917725-76917747 GGGGCATGACTGTCCTTTGTGGG - Intronic
933614114 2:84466073-84466095 GGTAAATTTCTCTCCTTTTGAGG + Intergenic
934745702 2:96758178-96758200 GAGGAGCCTCTCTCCTTTGGGGG - Intergenic
937070547 2:119059923-119059945 GGGAGAGGTCTCTCCTGTGGTGG - Intergenic
937411666 2:121682272-121682294 TGGCAATGTCTCACCTTTTGGGG + Intergenic
937411682 2:121682358-121682380 TGGAAATGTCTCACCTTTTGGGG + Intergenic
937411690 2:121682401-121682423 TGGAAATGTCTCACCTTTTGGGG + Intergenic
943842162 2:192597474-192597496 GGGATAGATCTCTCCTTTGGTGG + Intergenic
943846067 2:192650009-192650031 GGGATAGATCTCTCCTTTGGTGG - Intergenic
946310436 2:218880130-218880152 GGGGGAAGTCCCTCCTCTGGCGG + Intergenic
947565507 2:231190587-231190609 GGGGACTGACTCTCCATTGCAGG + Intergenic
947801053 2:232928571-232928593 GGGGAATGTGTCCCCGCTGGAGG + Intronic
948428262 2:237902142-237902164 GGGGGATGCCTCTCCTCCGGGGG + Intronic
948474915 2:238211182-238211204 GGGGAAGGTGTCCCCATTGGGGG + Intergenic
1170559932 20:17548513-17548535 GGTGAATTCCTCTCCTCTGGAGG + Intronic
1172487864 20:35309720-35309742 GGGGATTGTTTCAGCTTTGGAGG + Intronic
1178258882 21:31080431-31080453 GGAGACTGTGTCTCCTTTGGTGG + Intergenic
1178311525 21:31534007-31534029 AGGGCATGTGTGTCCTTTGGAGG - Intronic
1180083713 21:45498105-45498127 GGGGAATTCTTGTCCTTTGGGGG - Intronic
1180791261 22:18576956-18576978 GGGGAATGCCTCTCCCTGGGGGG - Intergenic
1181230477 22:21418358-21418380 GGGGAATGCCTCTCCCTGGGGGG + Intronic
1181248173 22:21516511-21516533 GGGGAATGCCTCTCCCTGGGGGG - Intergenic
1183110645 22:35646197-35646219 GGGTAAAGTCTCTCATTTGGGGG - Intergenic
1184605098 22:45568385-45568407 GGGGAATGCCTCTTCTGTAGGGG + Intronic
1184605117 22:45568480-45568502 GGGGAATGCCTCTTCTGTAGGGG + Intronic
1184605125 22:45568518-45568540 GGGGAATGCCTCTTCTGTAGGGG + Intronic
1184605152 22:45568666-45568688 GGGGAATGCCTCTTCTGTAGGGG + Intronic
1184685003 22:46092454-46092476 TGCAAATGTCTCTCTTTTGGGGG - Intronic
949895340 3:8764165-8764187 GGGGAATGTCACGCTTCTGGTGG - Intronic
955082287 3:55669087-55669109 AAGGAATGTCTCCTCTTTGGAGG - Intronic
955404472 3:58617309-58617331 GGGCAGTGTCTGTCCTTTTGAGG - Intronic
957068543 3:75546782-75546804 GGGGTTTGTCTCTACTTGGGGGG + Intergenic
959999768 3:112718656-112718678 GAAGAATGTCTCTCCTTTCTGGG + Intergenic
961469792 3:127104386-127104408 GGGCATTGTTTGTCCTTTGGAGG + Intergenic
971077866 4:23170991-23171013 GGGAAATGCCTCTGCTTTGTAGG - Intergenic
971837633 4:31788672-31788694 TTGGAATGTCCCTCCTTTTGTGG + Intergenic
973264171 4:48194532-48194554 AGGGAATGTTTCTCTTTTAGGGG - Intronic
975645887 4:76545480-76545502 GGAGACAGTCTCTCCTTTGGAGG - Intronic
976147033 4:82052029-82052051 GGGAACTGTCTCTCCTTTTCAGG - Intergenic
976486537 4:85612014-85612036 GGGTAATATTTCTTCTTTGGTGG + Intronic
979213610 4:118135989-118136011 GGGAAATGTCTCTGCTATGCTGG + Intronic
979303003 4:119108814-119108836 GGAAAATGTCTCTCCTCTGCTGG + Intergenic
980135562 4:128855501-128855523 TGGGAGCGTCTCTGCTTTGGTGG + Intronic
980435470 4:132766457-132766479 TGTGATTGTCTCTCCCTTGGGGG - Intergenic
982609697 4:157558064-157558086 GTGCCATTTCTCTCCTTTGGGGG - Intergenic
989352197 5:40499333-40499355 TGGGAATGTGTCTCCTTTGAAGG - Intergenic
989519386 5:42383060-42383082 GGGTAATGGCTCTCTTTTGCAGG - Intergenic
989742206 5:44786514-44786536 GGTAAATGTCTCTCCTTTTGAGG + Intergenic
991386180 5:66092858-66092880 GGGGAATGACTGACCTATGGAGG + Intergenic
992256468 5:74925965-74925987 GGGCAATGTTTGTCCTTCGGTGG + Intergenic
992543631 5:77787837-77787859 TGTGTATGTCTCTTCTTTGGAGG + Intronic
998401583 5:141851433-141851455 AGGGCATGTCTCTCCGTAGGGGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1007641365 6:43342516-43342538 GGGGATGGTGTCTCCTTTGTTGG + Intronic
1011807445 6:91088075-91088097 GGGGAATGTCTCACCTATCTTGG + Intergenic
1013789992 6:113825708-113825730 GGTGACTGTCTCTCCCTTGAAGG + Intergenic
1016985152 6:149889526-149889548 GAGGGATTTCTCTCCATTGGTGG + Exonic
1017751315 6:157492500-157492522 GGGGAATGATTCTGCCTTGGGGG + Intronic
1017764739 6:157597360-157597382 GAGGGATGTCTGTCGTTTGGTGG + Intronic
1019405375 7:880839-880861 GGGGAATGTGACTTCTCTGGCGG - Intronic
1019443013 7:1056840-1056862 GAGGAATGCCTGTGCTTTGGCGG + Intronic
1023088183 7:36593371-36593393 GATTAATGTCTGTCCTTTGGGGG + Intronic
1030222733 7:107114238-107114260 GGGTATTGTTTTTCCTTTGGAGG + Intronic
1032327011 7:130938463-130938485 GGGAAATCTCTGTCCTTTGAGGG - Intergenic
1033161880 7:139004888-139004910 AGTAAATGTCTCTCCTTTTGAGG - Intergenic
1036254624 8:7195404-7195426 GGGGTTTGTCTCTACTTGGGGGG + Intergenic
1036362867 8:8092084-8092106 GGGGTTTGTCTCTACTTGGGGGG - Intergenic
1036895697 8:12633104-12633126 GGGGGTTGTCTCTACTTGGGGGG + Intergenic
1038195332 8:25361760-25361782 GGGGAATGACTCTCCCTGGCCGG - Intronic
1038544498 8:28414697-28414719 GGGGAATGTCGCTGCTATTGAGG - Intronic
1039848291 8:41341844-41341866 CGGGAATGTCTCTGCTCTGAGGG + Intergenic
1040110481 8:43564998-43565020 GGTGCATGTCTCTCCCCTGGGGG - Intergenic
1040277070 8:46019215-46019237 GGTGCATGTCTCACCCTTGGGGG - Intergenic
1041411345 8:57559877-57559899 TGGAAATGTGTCTTCTTTGGGGG + Intergenic
1043091375 8:75908369-75908391 GGGGAATTTCTCTCTTCTTGAGG - Intergenic
1044429689 8:92094824-92094846 TGAGACTGTCTCTCTTTTGGTGG - Intronic
1053431142 9:38042607-38042629 TGGAAATGTCACTCCCTTGGAGG - Intronic
1054732463 9:68714981-68715003 GGTGAATTTCTCTGCTATGGTGG - Intronic
1058384222 9:104414702-104414724 GGTGAATTCCTCTCCTTTTGAGG - Intergenic
1058977368 9:110137397-110137419 GGGGGATTTCTGTCCCTTGGCGG - Exonic
1061232139 9:129321228-129321250 TGGGAATGTCTCTGATTGGGTGG + Intergenic
1061626465 9:131843386-131843408 GAGGAATGTCTAACCTATGGAGG + Intergenic
1191257677 X:58286690-58286712 GGTGCATGTCTCTCCTACGGGGG + Intergenic
1191258781 X:58291491-58291513 TGTGCATGTCTCTCCTGTGGGGG + Intergenic
1192704794 X:73518419-73518441 TGGGAATGTCTATCCTATGCTGG - Intergenic
1192966819 X:76185680-76185702 AGTGAATGTCTCTACTTTTGGGG - Intergenic
1196948947 X:120856962-120856984 GTGGATTCTCTCTCCTTTGCTGG - Intergenic
1197565511 X:128079689-128079711 GGTGAATTTCTCTCTTTTTGAGG + Intergenic
1199637343 X:149826149-149826171 TGGGAATTTCTCACCTTTTGGGG - Intergenic
1199717313 X:150515827-150515849 GGGCACTGTCACTCCTTTGAAGG - Intergenic
1200505856 Y:4010811-4010833 GGTGAATTTCTCTCCTATTGAGG + Intergenic
1201939575 Y:19445379-19445401 GGTGAATTCCTCTCCTTTTGAGG - Intergenic