ID: 919421812

View in Genome Browser
Species Human (GRCh38)
Location 1:197379081-197379103
Sequence TTGTTTGTGGATAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 378}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919421809_919421812 11 Left 919421809 1:197379047-197379069 CCTTGCAAAGAAAAAAGATTCTA 0: 1
1: 0
2: 2
3: 44
4: 580
Right 919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG 0: 1
1: 0
2: 3
3: 45
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919421812 Original CRISPR TTGTTTGTGGATAGGAAAGA TGG Intronic
901552864 1:10009038-10009060 TTATTTGTGAATGGGAAAAATGG - Intronic
904175417 1:28624944-28624966 ATGTTTGTGGGTAGGGGAGAAGG - Intronic
905828477 1:41045547-41045569 TTGTTTGTGTAGAGGAAGGTCGG + Intronic
906751860 1:48270738-48270760 TTTTTTGTGGAGTGGGAAGATGG - Intergenic
906797606 1:48710449-48710471 TTGCTTGTGGAGAGGAAGGCGGG + Intronic
907091881 1:51732734-51732756 TTGTTTTTGGATAAAAAGGATGG - Intronic
907711731 1:56889330-56889352 CTGTTTGTCAAAAGGAAAGAAGG - Intronic
907957960 1:59249516-59249538 TTATTTGTGTAAAGGAATGAGGG + Intergenic
908433605 1:64082869-64082891 GTGTTTGTGGAAGAGAAAGAGGG - Intronic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
909479469 1:76116006-76116028 TTGTTGTATGATAGGAAAGAAGG + Intronic
910082521 1:83358018-83358040 TTGTTGGTGTATAGGAATGCTGG + Intergenic
910450466 1:87338484-87338506 ATATTTGTGGATATTAAAGAGGG + Intronic
910590853 1:88927008-88927030 TTCTTTGTGGTCAAGAAAGACGG + Intergenic
910629490 1:89340831-89340853 TTGTTTCTCGTTAGGAAAGGAGG - Intergenic
912581826 1:110727885-110727907 TGGTTTGGGTGTAGGAAAGATGG + Intergenic
912610300 1:111035539-111035561 TTGTTGGTGTATAGGAACGCTGG - Intergenic
912707878 1:111928382-111928404 TTTTTTGTGGGAAGGTAAGAAGG - Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915947225 1:160162397-160162419 GTGCTGGTGGAGAGGAAAGAGGG + Intronic
916032131 1:160886503-160886525 TTGTTTGTAAATATGAAAGCTGG - Intergenic
917299641 1:173560002-173560024 TTGTCTGTTGATATGAAAAAAGG + Intronic
918209893 1:182341181-182341203 TAGTTTTTGGATGGGAAAGAAGG - Intergenic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
919556741 1:199065012-199065034 TTATGTGGGGATAGTAAAGATGG + Intergenic
919608294 1:199713599-199713621 TTGTTGGTGCATAGGAATGCTGG - Intergenic
919944166 1:202307678-202307700 TTGTTGGTGGATAGAGAGGATGG - Intronic
920021378 1:202958717-202958739 TAGTTTGTGGAAGGGAAGGAAGG - Intergenic
920477534 1:206290994-206291016 GTGTATGTGGTTGGGAAAGAGGG - Intronic
920732295 1:208498525-208498547 TTGTTTGTTTTTAGGAAGGAAGG + Intergenic
921542429 1:216432529-216432551 ATGTTTGTGGGTATGGAAGAAGG - Intergenic
923745456 1:236695653-236695675 TTGTTTTTGTATAGAAAACATGG + Intronic
923778550 1:237001195-237001217 TTTTTTCTGGATAGGACAAAGGG + Intergenic
924258080 1:242202444-242202466 ATGTTTGAGGGCAGGAAAGATGG - Intronic
924332139 1:242950861-242950883 TTGTTGGTGTATAGGAATGCTGG - Intergenic
1065042156 10:21708158-21708180 TTGTTTGATGAAAGGAAGGAAGG + Intronic
1067749185 10:48958672-48958694 CTGTGTGAGGATAGGAAAAATGG + Intronic
1068303589 10:55176491-55176513 TTGTCTCTGGTTAGGAAAAAAGG - Intronic
1069652290 10:70058483-70058505 TTGTTTCTGGATATGAAAGGCGG + Intronic
1070855675 10:79606538-79606560 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1071200853 10:83219774-83219796 TTGTTTCTGGCTAGGAAATGAGG + Intergenic
1071529586 10:86378524-86378546 TTGTTTGTGGGAACGTAAGAGGG + Intergenic
1071857467 10:89640263-89640285 TTCTCTGTTGTTAGGAAAGAAGG - Intronic
1073153647 10:101329267-101329289 TTGTCTTTGGATAAGCAAGAGGG + Intergenic
1074605626 10:114961929-114961951 TTATTTCAGGATAGTAAAGAAGG - Intronic
1074769311 10:116723214-116723236 TTGTATGAGGACAGGAATGATGG - Intronic
1075219328 10:120570940-120570962 CTGTCTGTGAGTAGGAAAGATGG - Intronic
1075778203 10:125001433-125001455 TTGTTTGTGCCAGGGAAAGATGG + Intronic
1076592550 10:131595732-131595754 TTGTTTGTGTACAGGAATGCTGG + Intergenic
1076592869 10:131600433-131600455 TTGTTTGTGTACAGGAATGCTGG + Intergenic
1078094544 11:8288763-8288785 GTGTGTGTGGAAAGGAAAGAAGG + Intergenic
1078370398 11:10739905-10739927 TTTTTTGTGGAGAGGAAGGTGGG - Intergenic
1078700048 11:13670908-13670930 CTGTTTGAGGATAGGACAAAAGG + Intronic
1079222031 11:18571541-18571563 GTATTTGCTGATAGGAAAGAGGG - Intronic
1079581487 11:22069873-22069895 TTGTTGGTGTATAGGAATGCTGG - Intergenic
1079756060 11:24264772-24264794 TTGGTGGAGGATAAGAAAGAAGG - Intergenic
1080115584 11:28618271-28618293 ATATTTGTGGAAAGGAAAAAGGG + Intergenic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1080989451 11:37512780-37512802 TTCTTAGTGGATAAAAAAGAAGG + Intergenic
1081107522 11:39088969-39088991 GTGTGTGTGTATAAGAAAGAGGG - Intergenic
1081618390 11:44603908-44603930 TTATTTGAAGATTGGAAAGAAGG - Intronic
1082749203 11:56999431-56999453 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1082830024 11:57609671-57609693 ATGTTTGTAGATAGAAAAAATGG - Intronic
1085695099 11:78697442-78697464 TTACTTGGGGATAGGAAAGCTGG - Intronic
1086002631 11:82000464-82000486 CTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1086222942 11:84471546-84471568 TTGTTTGAGGAAAGGAAAAGGGG + Intronic
1086310360 11:85529740-85529762 GTGTTTGAGGAAAGGAAAGTTGG - Intronic
1087433096 11:98078366-98078388 TTGTTTCTTGATAGAAAATAGGG + Intergenic
1087923641 11:103894980-103895002 TTGTTTACGGATAGGCAGGATGG - Intergenic
1088406784 11:109490143-109490165 TTGTTTGTGGAAAGGAAGGATGG + Intergenic
1088863978 11:113828704-113828726 TTTTTTCTGGGTTGGAAAGACGG - Intronic
1088990811 11:114951774-114951796 TTGTTTCTCTTTAGGAAAGAAGG - Intergenic
1089585955 11:119509678-119509700 CTGTCTGTGGACATGAAAGAGGG + Intergenic
1089921659 11:122214851-122214873 TTGTTTGTTAAAAGGAAAAATGG - Intergenic
1089962620 11:122629198-122629220 TTGTTAGTGGATGGGCAAGAAGG + Intergenic
1090562995 11:127953283-127953305 TGGTTTGTACATAGGAAAAATGG + Intergenic
1091000141 11:131904158-131904180 TTGTTTTTGGATGGGGAACAAGG + Intronic
1091437706 12:485799-485821 TTACTTGTGGTTAGGACAGAAGG - Intronic
1092274773 12:7051337-7051359 TTGTTTTTGTATAGGAATGCTGG + Intronic
1092723584 12:11464804-11464826 TGGTTTTAGGATAGGTAAGATGG + Intronic
1092756032 12:11764272-11764294 TTCTCTGTGGATAAGACAGATGG + Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093776584 12:23082694-23082716 TTGTGTGTGGAGAGAACAGAAGG + Intergenic
1094628077 12:32144877-32144899 TTGTATTTGAATAGAAAAGAGGG - Intronic
1094702244 12:32881175-32881197 TTGTTTGGCTATAGGAAATAAGG - Intronic
1095138862 12:38638745-38638767 TTGTTTGTGGTCAAGAAAGGTGG + Intergenic
1095173717 12:39065341-39065363 TTGTATGATGATATGAAAGATGG - Intergenic
1095388391 12:41676644-41676666 TTGTTGGTGTATAGGAATGCTGG - Intergenic
1095998877 12:48112756-48112778 TGGTTTTTGGATAGGTAAAATGG + Intronic
1096361646 12:50993016-50993038 TTGGTGGTGCATAGCAAAGAAGG - Intronic
1097355617 12:58597672-58597694 TGGTTTGTGTATAGGAAACAAGG + Intronic
1098593025 12:72237117-72237139 ATCATTGTGGATAGAAAAGAAGG + Intronic
1099588363 12:84551176-84551198 TTGTGTGTGGAGAGAAAAAATGG - Intergenic
1101183501 12:102247879-102247901 TTGTTGGTGGAGGGGAGAGAGGG - Intergenic
1101643095 12:106602601-106602623 TTGTTTGAGGAATGGCAAGAAGG - Intronic
1101924784 12:108962449-108962471 TTTTTTCTGGATAGTTAAGAAGG + Intronic
1102863821 12:116358886-116358908 GTGCTGGTGGATAGGAAAGATGG + Intergenic
1103210238 12:119160353-119160375 TTGTTTTTGGATAGAAAAAAAGG - Exonic
1103454859 12:121057278-121057300 TTGTTTCTGTATTGGGAAGAAGG - Intergenic
1104211381 12:126691964-126691986 TTGTCAGTGGATAGGACACAGGG - Intergenic
1105391914 13:19987589-19987611 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105391918 13:19987649-19987671 GTGTGTGTGTATAGGAAAGATGG + Intronic
1107181517 13:37466391-37466413 ATGTTTGTGTGTATGAAAGATGG + Intergenic
1107738503 13:43423754-43423776 TTATCTGTGGCTAGGTAAGATGG - Intronic
1108355203 13:49623806-49623828 TTGGTGGTGGGTAGGAAAGGTGG + Intergenic
1108847636 13:54696114-54696136 TTGTTTCTGGTTAGGGAAGGAGG + Intergenic
1109128175 13:58544883-58544905 TTGTTTGAACATAGGAATGAAGG - Intergenic
1110028792 13:70578063-70578085 TTGTTGGTGGGAAGGAAAAATGG + Intergenic
1110103123 13:71634432-71634454 TTGCTAGTGAAAAGGAAAGAAGG - Intronic
1111275442 13:85939707-85939729 TTGTCTCTGGTTAGGAAAGGAGG - Intergenic
1111458201 13:88510388-88510410 TTGTCTGTGAATAAAAAAGAGGG + Intergenic
1113404724 13:110027767-110027789 CTCTTTGTGGAGAGGAGAGAGGG + Intergenic
1114474677 14:22985588-22985610 TTGGTTTCGGAGAGGAAAGACGG - Intergenic
1114538625 14:23438627-23438649 TTGTTTGTGCACAGGGCAGAGGG + Intergenic
1115318556 14:32052966-32052988 ATGTTTGTTGTAAGGAAAGAAGG + Intergenic
1115458756 14:33635483-33635505 TTGTTTATGGATTGAAAGGAAGG + Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115813517 14:37136042-37136064 TTGTCTATGGAATGGAAAGATGG + Intronic
1116074043 14:40087387-40087409 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1118382737 14:65230547-65230569 TTGTTTGGGGACAGGAGGGAAGG + Intergenic
1119948165 14:78716509-78716531 ATGTTAGTGGACAGAAAAGAAGG + Intronic
1120272814 14:82336244-82336266 TTGCTTTTGGAGAGCAAAGAAGG + Intergenic
1122381993 14:101314361-101314383 TTGTTTGTGGACAAGCAAAATGG + Intergenic
1124204599 15:27706370-27706392 TTGATTGTGAATAGAAAATAAGG - Intergenic
1124804448 15:32867369-32867391 ATGTTTGAGGAATGGAAAGAAGG - Intronic
1125119693 15:36139834-36139856 TTGTTTGTGTATAGGAATGCTGG + Intergenic
1125216272 15:37279018-37279040 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1125732005 15:41897844-41897866 GTGTTTATGTATAGGAGAGAGGG - Exonic
1126141863 15:45445555-45445577 TTGTTTTTGGAGAGGAGGGAGGG - Intronic
1127743078 15:61932939-61932961 TTATTAGTGGAAAGGGAAGATGG + Intronic
1127899637 15:63331410-63331432 TTGTTTCTGAATAGGAAAGAAGG + Intronic
1127930238 15:63591506-63591528 TTGTTTGCGGGGAGGTAAGATGG + Intronic
1128200564 15:65802985-65803007 TTGTTTTTGGAGTGGAAGGAAGG - Intronic
1128986448 15:72225234-72225256 TTGTTTTTAGAAAGTAAAGAGGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130120187 15:81041300-81041322 TTGTTTGGGGATGGGGAAGATGG + Intronic
1130286630 15:82560745-82560767 TGTTGTGTGGATAGCAAAGAAGG + Intronic
1130366638 15:83246404-83246426 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1133093317 16:3422603-3422625 TTGTATGTGCATAGGAATGCCGG + Intronic
1134340847 16:13344336-13344358 TTGTGTGTGTATAGGAATGGGGG + Intergenic
1134815520 16:17202491-17202513 TTGTTTGAGGAAGAGAAAGAAGG - Intronic
1135170750 16:20181306-20181328 GTGTGTGTGTATAGGAAGGATGG - Intergenic
1135752099 16:25066248-25066270 GTGTTTGGGGAAAGGAAAAAGGG - Intergenic
1138290310 16:55841090-55841112 ATGTTTGTGTAAAGGAAAAACGG + Intergenic
1138773100 16:59688074-59688096 TTGCTTTTGGATAAGAAAGAAGG + Intergenic
1140637209 16:76929246-76929268 TTTGTTGTGGATAGGTAATAAGG - Intergenic
1141353836 16:83324409-83324431 TTGTTTAGAGATAGGAAAGAGGG - Intronic
1144042425 17:11424630-11424652 TTATTGCTGGATAGGATAGAAGG + Intronic
1144301498 17:13925878-13925900 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
1146742078 17:35295415-35295437 TTGAGTGTGGATATGAAGGATGG + Intergenic
1147800219 17:43080158-43080180 TTCTTTGTGGATAGGAAGTATGG + Intronic
1150052261 17:61976385-61976407 TTGTCTATAGCTAGGAAAGAAGG + Intronic
1150805125 17:68312710-68312732 TTCTTTGTTGACAGGAAAGCCGG + Intronic
1151554784 17:74841242-74841264 CTGTTTGTGGAACGGATAGAAGG + Intergenic
1151906846 17:77054403-77054425 TTGTTGGTAGAAAGGAAAGGTGG - Intergenic
1152502738 17:80724019-80724041 ATGTTTGTAGATAGGAGAAAGGG + Intronic
1153200503 18:2642925-2642947 TTATTTGTGGCTAGGAAATTGGG + Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1156054555 18:32983402-32983424 GTGTTTGTAGATAGGAAATACGG - Intronic
1156584075 18:38412567-38412589 TTGTTTGTGTTAAGGAAAAAAGG + Intergenic
1156689672 18:39692405-39692427 TATTTTGTGGAAGGGAAAGAAGG - Intergenic
1156860302 18:41828381-41828403 TTGTTTGTGTCTAGTAAAGCTGG + Intergenic
1159192508 18:65065279-65065301 TTGTTTGTGGAAATGCAATACGG - Intergenic
1160191837 18:76721338-76721360 CTGTTTGTGGGGAGGAAAGGAGG - Intergenic
1161897934 19:7096665-7096687 TTGTTTGGGGAGAGGATGGAGGG - Intergenic
1162043345 19:7983614-7983636 TTGTTTATGGAGCAGAAAGATGG - Intronic
1163751003 19:19077715-19077737 TTTTTTGTATTTAGGAAAGATGG - Intronic
1164039199 19:21479928-21479950 TTGTTTGTGTATAGGAATGCTGG + Intronic
1164276689 19:23724835-23724857 TTGTTGCTGGTTAGGAAAAAAGG + Intergenic
1164411681 19:28011387-28011409 TTGTGTGTAGAGAGGAATGAAGG + Intergenic
1164551816 19:29218434-29218456 TTGGTTGTGAAGATGAAAGAAGG + Intergenic
1165947306 19:39451956-39451978 TTGTTTCTGGTATGGAAAGAGGG + Intronic
1166449861 19:42889513-42889535 GTGTTTGTGGGTATGAAATATGG + Intronic
1167729008 19:51239498-51239520 TTTCTTATGGAGAGGAAAGAAGG - Exonic
1167738047 19:51309544-51309566 TTGTTTAAGGAATGGAAAGAAGG + Intergenic
1167945251 19:52982994-52983016 TTGCTTGGGGATATAAAAGATGG - Intergenic
1168522103 19:57060669-57060691 TTGTGTGTGTGTAAGAAAGACGG - Intergenic
925085527 2:1104917-1104939 TTCTTTTTAGGTAGGAAAGAAGG + Intronic
925523997 2:4779601-4779623 TTGTGTGTGTGTATGAAAGATGG - Intergenic
927353323 2:22144631-22144653 TTGTTTCTGGGTAGGAAGTATGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928849255 2:35723218-35723240 TTGTTTGTAGTCAGCAAAGATGG - Intergenic
929285897 2:40135087-40135109 TGGTGTGTGGATAGAAAAAAAGG + Intronic
929630640 2:43458049-43458071 TTATTTATGGAAAGGAAAAAGGG + Intronic
929634129 2:43499264-43499286 TTATTTGTGGCTAGGTATGAGGG - Intronic
931384727 2:61787772-61787794 ATGCTTGTGGATTGAAAAGAAGG + Intergenic
932071777 2:68627862-68627884 TTGTTTTTGCAGATGAAAGATGG - Intronic
932438143 2:71715349-71715371 CTGTTTGAGGATGTGAAAGAAGG - Intergenic
935319738 2:101874333-101874355 TAGTTTGTGGATAGACAGGATGG + Intronic
936580860 2:113699362-113699384 TTGCTGGTGGAAAGGAAAAATGG + Intergenic
937390903 2:121485503-121485525 TTGTTTTAAGATAGAAAAGAGGG + Intronic
938042310 2:128085778-128085800 TTGATTGTGGAAAGCAAAGTTGG - Intergenic
938939780 2:136159748-136159770 TTGGCTCTGGATAGGAAAAATGG + Intergenic
939004199 2:136766363-136766385 CTGTTTGTGGAGAGGAAACTGGG + Intronic
939637310 2:144598056-144598078 TTTTCTGTGGGTAGGAAAGAAGG + Intergenic
939674513 2:145055362-145055384 TTGTTTGTGAATAATAGAGACGG + Intergenic
939854315 2:147339622-147339644 TTGTTTGTGAATTGGGAAGCTGG - Intergenic
940811540 2:158248228-158248250 TTGTCTCTGGGGAGGAAAGAAGG + Intronic
941331671 2:164185319-164185341 TTTTTTTTGTATTGGAAAGATGG - Intergenic
942167017 2:173251649-173251671 TTGTTTGGGAATAGGCACGAGGG + Intronic
943383156 2:187174658-187174680 CTGTTTCTGGTTAGGAAAAAAGG + Intergenic
945820468 2:214658453-214658475 TTGTTGGTGTATAGGAATGCTGG + Intergenic
945865943 2:215175784-215175806 AGGTGTGTGGATAGGAGAGAGGG - Intergenic
945897894 2:215505083-215505105 TTGTCTGTGGATGAGATAGAAGG - Intergenic
946124890 2:217553833-217553855 TTGTTTCTTGAGAAGAAAGAAGG + Intronic
946686338 2:222274932-222274954 TTGTCTGTGGATATGGAAAAGGG + Intronic
947401196 2:229732980-229733002 TTGTTCGTGGTTAGGAAATCGGG - Intergenic
947490413 2:230589936-230589958 GTGTTTATGCAAAGGAAAGAGGG + Intergenic
1169385676 20:5147381-5147403 AGGTTTGGGGATAGGAAAGAGGG + Intronic
1170086119 20:12534195-12534217 TTGTTTGCAAATAGGAAACACGG - Intergenic
1170143805 20:13151407-13151429 TTGTCTGTGGTCAGGATAGAGGG + Intronic
1170514263 20:17111643-17111665 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1171046526 20:21813289-21813311 TTGTTTCTGGATAGGAGTGTAGG - Intergenic
1172263492 20:33590273-33590295 CTGTTTGTGCACAGGAAAAAAGG - Intronic
1174756819 20:53167124-53167146 TTCTTTCTGGAAAAGAAAGATGG + Intronic
1174931953 20:54826028-54826050 TGGTTTGTGGTAAGCAAAGAGGG - Intergenic
1177124817 21:17182439-17182461 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
1177585469 21:23088480-23088502 TTGTTTGTGTTTAGGAAGAATGG + Intergenic
1178956330 21:37025395-37025417 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1179389419 21:40974025-40974047 TTGTTTGTGGCCAGTCAAGAAGG + Intergenic
1179426916 21:41288001-41288023 TTGTTTGTGAATACGAAAACTGG + Intergenic
1182495064 22:30700917-30700939 TTTTTTGTATATAGTAAAGACGG - Intronic
1182597254 22:31431339-31431361 TTTTTTCTGAATAGGAAAAAGGG + Intronic
1182914540 22:34017097-34017119 TTGTTTGGGGAAAGAAAATAAGG - Intergenic
1183057723 22:35317357-35317379 TTTTTTGTAGTTAGTAAAGACGG + Intronic
1183532573 22:38369104-38369126 TTGTTTGGAGTCAGGAAAGAAGG + Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184995727 22:48206022-48206044 TTGTCTCTGGATTGGGAAGAGGG + Intergenic
1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG + Intergenic
949497171 3:4643313-4643335 TTATTTTTGGTTAGAAAAGATGG - Intronic
949799847 3:7891769-7891791 TGCTTGGTGGAAAGGAAAGATGG - Intergenic
950971223 3:17190362-17190384 GTGTATGTGGAAAGGAAAGGAGG + Intronic
951918741 3:27829941-27829963 TTATTTTAGGATAGAAAAGATGG + Intergenic
952384562 3:32830733-32830755 TTGTTTCTGCAAAGGAATGAAGG - Intronic
953076977 3:39580420-39580442 TGGTTTTTGGATAGGTAAAATGG + Intergenic
953112830 3:39959981-39960003 TTTGTTGTGTATAGCAAAGAAGG + Intronic
953270815 3:41442246-41442268 TTGTTTGTGCTAAGGAAAAACGG + Intronic
953562413 3:44002325-44002347 TAGTTTGTGGATTTAAAAGAGGG - Intergenic
955510897 3:59679393-59679415 GTGTTTCCAGATAGGAAAGAAGG + Intergenic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
956050498 3:65243094-65243116 TTTTTGGTGGTTAGGAAAGAAGG - Intergenic
957691680 3:83579130-83579152 TTGTTTCTGAACAGGAAAAATGG - Intergenic
957743694 3:84308907-84308929 TTGTGTGTATATAGTAAAGATGG + Intergenic
957973135 3:87408306-87408328 TTGTTTGTGTATAGAAAAGCTGG - Intergenic
959116134 3:102180840-102180862 TTGTTTGTGGAGTGGGTAGAGGG - Intronic
959926889 3:111932112-111932134 TTGTTAGTGGCTAGGATAAAGGG - Intronic
960015738 3:112885600-112885622 TTGTTGGTTTACAGGAAAGAGGG + Intergenic
960036435 3:113107246-113107268 TGGTTTGTGGTAAAGAAAGAGGG + Intergenic
960089389 3:113623742-113623764 TTGTTTTTGGATAAGAAAACTGG - Intronic
961912937 3:130339648-130339670 TTGTTGGTGTATAGGAATGGTGG + Intergenic
962048193 3:131783743-131783765 TTGCTTGGGGACAGGAAAAAGGG + Intronic
962048340 3:131785276-131785298 ATGTTTGAGGATAGCAAAGAGGG - Intronic
962306154 3:134288211-134288233 TGTTTTCTGGATAGAAAAGATGG - Intergenic
962672081 3:137718628-137718650 TTGTTGGTGTATAGGAATGATGG + Intergenic
962735907 3:138325088-138325110 TTTTTTCTGGGTAGGGAAGAAGG - Intronic
963761669 3:149291479-149291501 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
964282600 3:155082468-155082490 TTGGTTGGGCAAAGGAAAGAGGG - Intronic
964673958 3:159256959-159256981 TATTTTATGGATAAGAAAGAGGG + Intronic
964894275 3:161576399-161576421 TTCTTTGTGGAAAGTAAAAAAGG + Intergenic
965064947 3:163836077-163836099 TTGTTTGTTTTTAGTAAAGATGG - Intergenic
965197733 3:165622482-165622504 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
965630448 3:170727167-170727189 AAGTTTGTGGATAGGAAAAAAGG - Intronic
967812682 3:193773919-193773941 TTCTTAGTGGATGGGAAATAGGG - Intergenic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
970248257 4:14086810-14086832 TTGTTTGTGTACAGGAATGCTGG + Intergenic
970289013 4:14551513-14551535 TTGTTTGTAGCAAGGGAAGAAGG - Intergenic
970633741 4:17983571-17983593 TTGTTGGTGTATAGGAATGAGGG + Intronic
970737065 4:19184447-19184469 ATGTTTGTTTATAGGAAAGATGG - Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
970792166 4:19871108-19871130 GTGTGTGTGTATAGAAAAGAAGG - Intergenic
971108644 4:23556881-23556903 GTGTTTGGGGATAGGAAATCAGG + Intergenic
972057480 4:34822280-34822302 TTATTTGAAGATAGTAAAGATGG - Intergenic
972416154 4:38842486-38842508 ATGTTTGTGACTGGGAAAGAGGG + Intronic
973137280 4:46724183-46724205 CTGTTTGCGGATAGGATAGGGGG + Intergenic
974531451 4:63113280-63113302 TTGTTAGGGGTTAGCAAAGAGGG + Intergenic
974676028 4:65090374-65090396 TGGTCTCTGAATAGGAAAGATGG + Intergenic
974705727 4:65513077-65513099 TAATTTGTGGTTAGGAAATATGG + Intronic
976678990 4:87734236-87734258 TTGTTTATGGAAGGGAAAGGAGG + Intergenic
977502337 4:97856467-97856489 TTGTTGGTGTATAGGAATGCTGG + Intronic
978090169 4:104706347-104706369 TTCTTTCTGGAAAAGAAAGATGG + Intergenic
978293156 4:107170317-107170339 TTGTTGGAGGAAAGGAAATAAGG - Intronic
978336871 4:107678819-107678841 GCTTTTGTGGATATGAAAGAAGG - Intronic
979938002 4:126721953-126721975 TTTCTTGTGAATAGGAAAAATGG - Intergenic
980021742 4:127718791-127718813 TTGTTGGTGTATAGGAATGCTGG + Exonic
980257291 4:130398671-130398693 TTGTTGGTGTATAGGAATGCTGG + Intergenic
980406549 4:132360253-132360275 TAGTTTGTGGCTAGGCAAGGTGG - Intergenic
980496039 4:133588171-133588193 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
981054521 4:140346549-140346571 TTGTTTGAGGAAAGGATTGAAGG + Intronic
981813624 4:148803760-148803782 TTGTTTGTTAGTAGGAAAGGGGG + Intergenic
983693224 4:170497913-170497935 CTGTTTCTAGATAGGAAATAGGG + Intergenic
983738747 4:171100268-171100290 TTGTATTTCTATAGGAAAGAAGG - Intergenic
984809172 4:183779029-183779051 TTGTTTGTGGAAATGGAGGATGG - Intergenic
985666619 5:1184481-1184503 GAGTTTGTGGATGGGACAGAAGG - Intergenic
985909133 5:2865244-2865266 TTGTTTGTAGAGAGAAAACAGGG - Intergenic
986017755 5:3772677-3772699 ATGTTGCAGGATAGGAAAGATGG - Intergenic
987010869 5:13762737-13762759 TTCTTTGTTTATAGAAAAGAAGG + Exonic
987566063 5:19588093-19588115 TTGTTGGTGTATAGGAATGCTGG + Intronic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
990193897 5:53291052-53291074 TTGTTTGTAAAAAGAAAAGAAGG + Intergenic
990230538 5:53708529-53708551 TTGTTGGTGTATAGGAATGCTGG + Intergenic
990231762 5:53720290-53720312 TTGTTGGTGTATAGGAATGCTGG - Intergenic
990307845 5:54510612-54510634 TTGTTTGATGAAAGGAAAGAGGG + Intergenic
990348572 5:54892755-54892777 TTGTTGGTGTATAGGAATGCTGG - Intergenic
992087770 5:73293660-73293682 TTATCTGTTGATGGGAAAGATGG - Intergenic
992443459 5:76814455-76814477 GTGTGTGTGGATGGGGAAGAGGG + Intergenic
993271546 5:85803491-85803513 TTGTTTGTGTTTAAGAAACAGGG + Intergenic
993365891 5:87033818-87033840 TTGTTTCAGGAGAGTAAAGATGG + Intergenic
993995051 5:94712767-94712789 TTGCTTGTGGAGAGAACAGAAGG + Intronic
994348437 5:98716282-98716304 TTGTTAGTGTATAGGAATGATGG + Intergenic
994512005 5:100716029-100716051 TTGTTGGTGTATAGGAATGCTGG + Intergenic
996102351 5:119457034-119457056 TTGTTTGTGGAGGGGTCAGATGG + Intronic
996278560 5:121698567-121698589 TTATTTGAGGATAAGAAAGAAGG - Intergenic
997689737 5:135819577-135819599 TTGTCTGTGGATGGGAATGGAGG + Intergenic
998031270 5:138870638-138870660 TTGTTTGTGGTTTGAAATGATGG + Exonic
998074926 5:139228131-139228153 ATGTTTGTGGGAGGGAAAGAGGG - Intronic
998299706 5:141005980-141006002 GTGTTTGAGGATCTGAAAGAAGG + Intronic
998947277 5:147353145-147353167 TTGTTTTAGGACATGAAAGAAGG - Intronic
1002448197 5:179302872-179302894 ATGTTTGAGGAAAGGGAAGAAGG + Intronic
1002686576 5:181016198-181016220 TTTTTTGTGTATAGGAATGCTGG - Intergenic
1002828500 6:795767-795789 TTTTCTTTGGATAGGAAAAATGG + Intergenic
1004596787 6:17106560-17106582 GTGCTTGGGGCTAGGAAAGAAGG - Intronic
1004976140 6:20968934-20968956 TGGTTTGTGCACAGGAAAAAAGG - Intronic
1005948962 6:30617067-30617089 TTGTTTGGGGACAACAAAGATGG - Intronic
1006366711 6:33620601-33620623 TTTTTTTTTGAAAGGAAAGACGG + Exonic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008001912 6:46369883-46369905 TTCTTTTTGGTTTGGAAAGATGG - Intronic
1008183212 6:48359487-48359509 TTGTTGGTGTATAGGAATGCTGG - Intergenic
1009563656 6:65280199-65280221 TTGTTTGTGGATTGGAAGAGTGG - Intronic
1009701534 6:67189020-67189042 TTGTGTGTGGTTAGAAAATATGG + Intergenic
1010573960 6:77509976-77509998 TTGTTTCTGGTTAGGAAAAATGG + Intergenic
1011071268 6:83387087-83387109 TTGTTTATGGAAAAGAAACATGG - Intronic
1011300636 6:85869157-85869179 CTGTTTGTGGATAGGAACGGGGG - Intergenic
1011476856 6:87756863-87756885 TTCTCTGAGGATAGGAAACATGG + Intergenic
1011932408 6:92730722-92730744 TTATTTGTGTATAGGAATGCTGG + Intergenic
1012165626 6:95947275-95947297 TTGTTTAGGGATGGGAAAGTGGG + Intergenic
1012789571 6:103676342-103676364 TTGTTTGTGGAAATAAAGGAGGG + Intergenic
1013773983 6:113658567-113658589 TTGTTAGTGGAGTAGAAAGAAGG - Intergenic
1014276844 6:119398057-119398079 TTGTTTCTGGCTAGGAAAGATGG + Intergenic
1014515281 6:122370119-122370141 TGGTTTGTGTAAAGGAAATATGG - Intergenic
1015161246 6:130154260-130154282 TTTTTCATGGTTAGGAAAGAGGG + Intronic
1015697037 6:135992080-135992102 ATGTTTGTGGAAAGGAATGAAGG - Intronic
1015698317 6:136006717-136006739 TTGTTAGTGTATAGAAAAGCTGG + Intronic
1015769148 6:136751484-136751506 TTGTGTATGCATAGGACAGAAGG - Intronic
1016686714 6:146890266-146890288 GGGTTTGTGGATAAGAAAGGGGG - Intergenic
1016779786 6:147944659-147944681 AGATTTGTGGACAGGAAAGAAGG - Intergenic
1017125981 6:151065261-151065283 TTCCCTCTGGATAGGAAAGATGG - Intronic
1017893189 6:158656191-158656213 TTGTGTGAGGATTGGAAAGGAGG - Intronic
1018052549 6:160023824-160023846 TTGGGTGTAGACAGGAAAGAGGG + Intronic
1020240649 7:6392020-6392042 CTGTTTGCGGATAGGATAGGGGG - Exonic
1020969425 7:14916009-14916031 TAGTTTATGGATAAGTAAGATGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1022367671 7:29740899-29740921 TTGTTGGTGGAAATGAAAAATGG + Intergenic
1022501014 7:30882429-30882451 TTGGTGGTGGATAGGAAGGCTGG - Intronic
1022682569 7:32563675-32563697 TTTTATGTGGAAAAGAAAGATGG + Intronic
1023023472 7:36031156-36031178 TTTTTAGAGGGTAGGAAAGAGGG + Intergenic
1023129209 7:36985938-36985960 GTATTTGTGGTTGGGAAAGATGG - Intronic
1023439397 7:40170681-40170703 TTCTTTGTGGTTAAGAAAGGTGG - Intronic
1023486530 7:40693295-40693317 TTATTTGTGGATGAGAATGATGG + Intronic
1027299360 7:76814232-76814254 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1027810893 7:82896019-82896041 TTGTTTGTGGATATTCATGAGGG - Intronic
1028181338 7:87729008-87729030 GTCTTTGTGGATAGACAAGATGG - Intronic
1028202770 7:87981533-87981555 TGGTGTGGGGATAGGGAAGAGGG + Intronic
1029547106 7:101216401-101216423 ATGTTTGTGGATAGGTAACGGGG - Exonic
1029852433 7:103477179-103477201 TTGTTTCTGCATAGGAAATATGG + Intronic
1029881771 7:103820337-103820359 TTGTGTGTGGGACGGAAAGATGG - Intronic
1030211895 7:107005148-107005170 ATGTTTTTGGAACGGAAAGAAGG - Intergenic
1033625721 7:143107901-143107923 TGGTTTTTGGATAGGTAAAATGG - Intergenic
1033710871 7:143942291-143942313 TTGTTGGTGTATAGGAATGCTGG - Intergenic
1033857669 7:145584659-145584681 TTGTTGGTGGTTTGCAAAGAAGG + Intergenic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1034004254 7:147451661-147451683 TTGGGTGGGGATAGGCAAGAAGG - Intronic
1034680592 7:152925104-152925126 TGGTTTGTGGATGTGGAAGAGGG + Intergenic
1035142931 7:156782415-156782437 TTGTTGGTGGAAAGGTAAAACGG - Intronic
1035994489 8:4530845-4530867 TTCTTTGTGAAAAGGAAATAAGG - Intronic
1036966943 8:13309600-13309622 GTGTTTTTGGATGTGAAAGATGG + Intronic
1037012317 8:13858968-13858990 TTGTTTGGAGAGAGGAAAGGAGG - Intergenic
1037390886 8:18390368-18390390 TTGTTACTGGAGAGAAAAGAGGG + Intergenic
1037666910 8:20977652-20977674 TTGTTTGTGGTTCACAAAGACGG + Intergenic
1037741211 8:21610633-21610655 CTGGTTCTGGATGGGAAAGAGGG - Intergenic
1037929347 8:22868505-22868527 TTGTTTGTGTATATGAAATTGGG - Intronic
1037938142 8:22928774-22928796 TTGTTTGTGAAAAGGAAAAGTGG - Intronic
1038033656 8:23666983-23667005 TTGCTTGTGGAAATGAAAAATGG - Intergenic
1038197264 8:25379814-25379836 TTGTTTGTGGAGATGGAAAAAGG - Intronic
1038518618 8:28209394-28209416 TTGTTTGTTTATAGGAATGCTGG - Intergenic
1039080858 8:33732821-33732843 GTGTTTGTAGATGAGAAAGATGG + Intergenic
1040040621 8:42913292-42913314 TTGCTTGGGGATGGGAAAGAGGG - Intronic
1042018562 8:64344555-64344577 TTCTTTGTGGAAAATAAAGAAGG - Intergenic
1046072973 8:109281477-109281499 GTGTTTGTTTAAAGGAAAGAAGG - Intronic
1048129487 8:131678627-131678649 TTGTGTTTGAATTGGAAAGAAGG - Intergenic
1048949033 8:139477814-139477836 GTGGTTGTGGGTGGGAAAGAGGG - Intergenic
1050579171 9:7032749-7032771 TTGTTTTTGGAGGGGAAAGAAGG + Intronic
1050806375 9:9683564-9683586 TTGCTTTTGGAAAGGAAAAAGGG + Intronic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1051326777 9:15980579-15980601 TGGTTTGGGGCTATGAAAGATGG - Intronic
1051981924 9:23030851-23030873 TTGTTTGTTTTTAGTAAAGATGG + Intergenic
1052514443 9:29462096-29462118 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1052551769 9:29959844-29959866 TTGTTTATGGATAAGAAATCTGG + Intergenic
1054892172 9:70262567-70262589 GTGGTTTTGGATGGGAAAGATGG + Intronic
1056245001 9:84686220-84686242 TTAATTGTGGAAAGGAAAAAAGG + Intronic
1056251631 9:84754250-84754272 TTATTTGTGTGTAGGAATGAGGG - Intronic
1056537847 9:87546496-87546518 TTGGGTCTGCATAGGAAAGATGG + Intronic
1056671498 9:88632145-88632167 TTGTTGGTGTATAGGAATGCTGG + Intergenic
1057008651 9:91582819-91582841 TTTTTAATGGATAGGAAAGGTGG + Intronic
1057718834 9:97516584-97516606 TTGAGTGAGGATAGGAAGGAGGG + Intronic
1058024029 9:100120611-100120633 TTATTTGTGGAAAGAAAGGATGG - Intronic
1059839721 9:118200401-118200423 TTGTTTGAGGAACAGAAAGAGGG - Intergenic
1060428966 9:123531864-123531886 TTGTTTGTGGAAGGGGCAGAGGG + Intronic
1060869753 9:127030148-127030170 TTGTCTGTGGATGCCAAAGAAGG + Intronic
1185484472 X:471908-471930 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1186643291 X:11480116-11480138 TTTTGTGTGGATAGGCAAAACGG - Intronic
1188872517 X:35390428-35390450 CTGTTTAGGTATAGGAAAGAAGG + Intergenic
1189414448 X:40802267-40802289 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1191636759 X:63386376-63386398 TTATTTCTGAATAGGAATGAAGG - Intergenic
1191734061 X:64370203-64370225 ATGTTTCTGAAAAGGAAAGATGG - Intronic
1191841521 X:65516624-65516646 GTGTGTGTGTATAGGAAAAAGGG - Intronic
1192293218 X:69819560-69819582 TTGTTGGTGTATAGGAATGCTGG - Intronic
1194481256 X:94427631-94427653 TTGTTTGTGCATAGGTTATAAGG + Intergenic
1194928080 X:99851540-99851562 CTGTTAGTGGGTAGAAAAGATGG + Intergenic
1195326715 X:103764400-103764422 TGGTTTTTGGATAGGTAAAATGG + Intergenic
1195853476 X:109307469-109307491 TTGTCTCTGGTTAGGAAAGGAGG + Intergenic
1196227725 X:113186594-113186616 TTGTTAGTGTATAGGAATGCTGG + Intergenic
1197517786 X:127457379-127457401 GTGTTAGTGGAAAGGAAAGGAGG + Intergenic
1197790926 X:130253099-130253121 TTGTTGGTGTATAGGAATGCCGG - Intronic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic
1201724669 Y:17139327-17139349 TGGTTTCTGGACAGGTAAGATGG + Intergenic