ID: 919422327

View in Genome Browser
Species Human (GRCh38)
Location 1:197385478-197385500
Sequence GAGGAGAAAGACTCTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 483}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919422327_919422331 2 Left 919422327 1:197385478-197385500 CCTCCTCCAGAGTCTTTCTCCTC 0: 1
1: 0
2: 2
3: 44
4: 483
Right 919422331 1:197385503-197385525 ACTTCTCCTCCTGACTCCTCAGG 0: 1
1: 0
2: 0
3: 24
4: 289
919422327_919422332 3 Left 919422327 1:197385478-197385500 CCTCCTCCAGAGTCTTTCTCCTC 0: 1
1: 0
2: 2
3: 44
4: 483
Right 919422332 1:197385504-197385526 CTTCTCCTCCTGACTCCTCAGGG 0: 1
1: 1
2: 3
3: 51
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919422327 Original CRISPR GAGGAGAAAGACTCTGGAGG AGG (reversed) Intronic
901531729 1:9857968-9857990 GATGGGAAAGACTGTGGAGCAGG - Intronic
901737574 1:11322205-11322227 GAGGAAGCAGACTCTGGAGCTGG - Intergenic
901762115 1:11478474-11478496 AAGGAGAAAGAGCCTGGGGGAGG - Intergenic
902139710 1:14342679-14342701 GAGGAGAAAGAGGTTGGGGGAGG + Intergenic
903974817 1:27142532-27142554 CAAGAGAAAGCCTCTGAAGGTGG - Intronic
905224094 1:36467925-36467947 GAGGACAAAGCCACGGGAGGAGG + Exonic
905284112 1:36868182-36868204 GAGGAGCAAGACTGGGAAGGTGG - Intronic
905587666 1:39133518-39133540 GAGGAGAAAGGATGAGGAGGAGG - Intronic
905656741 1:39690704-39690726 GAGGAGAAAAACTGGGGAAGGGG + Intronic
905731161 1:40300396-40300418 AAGGACAGAGGCTCTGGAGGGGG - Intergenic
905828879 1:41048398-41048420 TAGGAGAAAGAATCCAGAGGGGG - Intronic
905852018 1:41281618-41281640 GAGGAGAAAGGTTGTCGAGGGGG + Intergenic
906792908 1:48674330-48674352 GAGGAATAAGACTCAAGAGGTGG + Intronic
906843487 1:49164946-49164968 GAGTAGAGAGACTATGGAGCTGG - Intronic
906973581 1:50545359-50545381 CAGGAGAATCACTCGGGAGGCGG - Intronic
908267706 1:62395310-62395332 GAGCAGAGAGACTCTTGAGTAGG - Intergenic
908634930 1:66153222-66153244 GAGGAGAGAGAATCTAGAGTAGG - Intronic
909742854 1:79054212-79054234 GAAGAGGAAGACTGGGGAGGGGG + Intergenic
909844329 1:80372640-80372662 CAGGGGTAAGACTCTGGTGGAGG - Intergenic
910000371 1:82333899-82333921 GAGGAGAAACATTCCAGAGGTGG - Intergenic
911105567 1:94128810-94128832 GAAGAGCAAGACCCTGGAGATGG + Intergenic
912944686 1:114075159-114075181 GGGGAAAAAGATTGTGGAGGTGG + Intergenic
912963659 1:114218070-114218092 GAGGAGAGTGACTCTGAAGGAGG + Intergenic
913338436 1:117732977-117732999 GGTGAGAAAGGATCTGGAGGGGG - Intergenic
913573056 1:120140820-120140842 GAGGAGACAGGCTCTTGAGTAGG - Intergenic
914060994 1:144207889-144207911 ATGGAGGAGGACTCTGGAGGAGG + Intergenic
914118156 1:144758480-144758502 ATGGAGGAGGACTCTGGAGGAGG - Intergenic
914294317 1:146305617-146305639 GAGGAGACAGGCTCTTGAGTAGG - Intergenic
914555361 1:148756400-148756422 GAGGAGACAGGCTCTTGAGTAGG - Intergenic
914842876 1:151262974-151262996 TAGGAGAATGGGTCTGGAGGTGG + Intronic
915996723 1:160571372-160571394 GAGGAGAAAGAGTCTCAAGGAGG + Intronic
916455296 1:164965045-164965067 GAGAAGAAAGACTCTTTAGGAGG + Intergenic
916925046 1:169510325-169510347 TAGGAGAATGACACTGGAGTGGG - Intergenic
918177967 1:182061707-182061729 GCAGAGAGAGCCTCTGGAGGTGG + Exonic
919422327 1:197385478-197385500 GAGGAGAAAGACTCTGGAGGAGG - Intronic
919741146 1:200982420-200982442 GAGGAGCAAGACTCAGGACCTGG - Intronic
919797749 1:201331615-201331637 GAAGAGGAAGACTTGGGAGGAGG - Exonic
920402854 1:205687600-205687622 GAAGGGGAAGACTCAGGAGGAGG - Intergenic
920548508 1:206838644-206838666 GAGGAGAAAGAATCTGAAGATGG - Intronic
920739713 1:208569041-208569063 ATGGGGAAAGACCCTGGAGGGGG + Intergenic
920752920 1:208698550-208698572 GAGATGAAATACTCTGGATGTGG - Intergenic
921340645 1:214130415-214130437 TGGGAGAAAGAGTCTGGTGGTGG - Intergenic
921490021 1:215763710-215763732 GAGGAAAAAGAATCAGGATGTGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922649034 1:227320771-227320793 GGGGAAAAATAGTCTGGAGGAGG + Intergenic
922749208 1:228062866-228062888 GAGGAGCAGGGCTCTGGTGGGGG - Intergenic
922989802 1:229896979-229897001 AAGGAGGAAGCCTCTGGAGAAGG + Intergenic
923188465 1:231596795-231596817 GAAGAGAAAGACTCTGAATGAGG + Intronic
924143142 1:241046970-241046992 GAGGAACAAGCCTTTGGAGGAGG - Intronic
924725185 1:246663107-246663129 CAGGAGGAAGACTTGGGAGGAGG - Intronic
1062926768 10:1321928-1321950 GAGGAGAGAGGCTCTGGGGGAGG + Intronic
1063201489 10:3788202-3788224 GAGAAGAAAAACAGTGGAGGAGG - Intergenic
1063394944 10:5677998-5678020 GAGGAGAGGGAAGCTGGAGGTGG - Intergenic
1063646595 10:7889925-7889947 GAGGAAAACGACACTGGAAGAGG - Intronic
1067043386 10:42970333-42970355 GCAGAGAGAGACTCTGGAGCTGG + Intergenic
1067749568 10:48961853-48961875 GAGGACCAATACTCTGGAGGTGG + Intronic
1068059217 10:52045882-52045904 GAGGAGAAAGGCTCTGACTGTGG + Intronic
1068416472 10:56729677-56729699 GAGGAGAAAGTCAGTGGAGCAGG - Intergenic
1069405716 10:68095812-68095834 GATGAAAAAGATTCTGGAGGTGG + Intergenic
1069694464 10:70376656-70376678 GGGGAGAAGGATGCTGGAGGGGG - Intronic
1070019265 10:72567818-72567840 GACTAGAAGGACCCTGGAGGAGG - Intronic
1070922523 10:80197120-80197142 GAGCAGAAAGACTCTGCCTGAGG + Intronic
1071463197 10:85917932-85917954 CAGGAGAGAGGCTCTGGATGGGG - Intronic
1071721405 10:88150179-88150201 GAGGCCAGAGTCTCTGGAGGTGG - Intergenic
1071787820 10:88922152-88922174 GAGGAGAGAAACCCAGGAGGAGG - Intronic
1071998277 10:91168293-91168315 GAGAAGAAAGAAGCAGGAGGGGG + Intronic
1072422885 10:95304251-95304273 GTGAAGAAAGCCTCTGCAGGAGG + Intergenic
1074775059 10:116761788-116761810 GAGGAGAGAGATGCTAGAGGTGG + Intergenic
1075008163 10:118845269-118845291 GTGGGGAAAGGATCTGGAGGAGG + Intergenic
1076451109 10:130557604-130557626 GCGGAGACAGCATCTGGAGGAGG - Intergenic
1076729598 10:132431790-132431812 AAGGAGAAATATTCTGGAGAGGG + Intergenic
1078593375 11:12665240-12665262 GAGGAGAAAGAAGGAGGAGGTGG + Intergenic
1079536161 11:21517788-21517810 GAGAAGAAAGACTGTTGAGAGGG - Intronic
1079819220 11:25104734-25104756 CAGGAGACAGACTGTGAAGGGGG + Intergenic
1079864362 11:25716536-25716558 GAGCACAAAGACTGGGGAGGTGG + Intergenic
1079902739 11:26208173-26208195 GAGGTGATAGTGTCTGGAGGTGG - Intergenic
1080264715 11:30388650-30388672 GAGGAAACAGACTGGGGAGGTGG - Intronic
1080380291 11:31763477-31763499 AAGCAGAAAGACTCTGCATGGGG + Intronic
1080608440 11:33884194-33884216 GAGGAGAAAGAGCCTGGTGCTGG + Intronic
1080894219 11:36435646-36435668 GAGGATCAAGACCCAGGAGGAGG + Intronic
1081338534 11:41898860-41898882 GAGGAAAAAGAATCTGAAAGAGG + Intergenic
1081647059 11:44797396-44797418 GAGGGGAAAGGCTTTGGTGGGGG + Intronic
1081762505 11:45586237-45586259 TAGGAGAATGTCTCTGGTGGAGG - Intergenic
1082752805 11:57038800-57038822 GAGTATAAAGACTCAGCAGGGGG + Intergenic
1082763110 11:57145597-57145619 GGGGAGCAGGACTCAGGAGGCGG - Intergenic
1083179894 11:60978433-60978455 GAGGAGAAGGAACCTTGAGGAGG + Intronic
1084395167 11:68904512-68904534 GCGGGGAAAGAGCCTGGAGGAGG + Intronic
1084617128 11:70244041-70244063 TCCAAGAAAGACTCTGGAGGTGG + Intergenic
1085052225 11:73385672-73385694 GAGGAGAAGGGCTGTGGAGAAGG + Intronic
1085172768 11:74463146-74463168 GAGGGGATAGACTCTGCAGAAGG + Intronic
1085251529 11:75147308-75147330 GGGGCGAAAGAGCCTGGAGGTGG + Intronic
1085457200 11:76671813-76671835 GAAGAGAAACACTGTGGAAGAGG - Intergenic
1086029454 11:82336420-82336442 GAAGAGAAAGACTGGAGAGGTGG - Intergenic
1086427511 11:86700636-86700658 GAGGAGAAATACTTTAGAGCAGG + Intergenic
1086998919 11:93392988-93393010 GAGGAGAAAGAAGGAGGAGGAGG - Intronic
1087130505 11:94665760-94665782 GATGAGGAAGACTCTGCTGGTGG + Intergenic
1087324695 11:96707099-96707121 GAGGAAAAAAATTCTGAAGGTGG - Intergenic
1088949624 11:114554313-114554335 GAGGAAAGAGAACCTGGAGGAGG - Intronic
1089216217 11:116836263-116836285 GATGAGCAAGGATCTGGAGGAGG - Exonic
1089895862 11:121929318-121929340 GAGGAGGAAGGCGCTGGAGTTGG + Intergenic
1090202604 11:124866837-124866859 GGGGAGAAAGACGATGGGGGAGG + Intronic
1090864544 11:130687280-130687302 GAGGAAAAAGAATTTGGATGAGG - Intronic
1091227951 11:133969182-133969204 GAGAATACAGATTCTGGAGGCGG - Intergenic
1091628599 12:2141265-2141287 GAGCAGGAAGGATCTGGAGGAGG + Intronic
1091680801 12:2525247-2525269 AAGGAGAGAGAAGCTGGAGGCGG + Intronic
1092974791 12:13734276-13734298 GAGGATAGTGACTCTGCAGGTGG + Intronic
1093093725 12:14949197-14949219 GAGGAGAGAGACTGGGAAGGGGG - Intronic
1095537049 12:43261571-43261593 GAGGAGAAATACTTTAGAGAGGG - Intergenic
1095791274 12:46170185-46170207 GAGGACAAAGTCACTGAAGGAGG + Intergenic
1096200887 12:49681965-49681987 CAGGAGAAAGACCCTGTAAGTGG + Intronic
1096427625 12:51517504-51517526 AAGCGGAAAGAATCTGGAGGTGG - Intergenic
1096653040 12:53071475-53071497 GAGGAGGTAGACTCTTTAGGAGG + Intronic
1096817675 12:54211562-54211584 GAGGAGAAAGATTCTGAAGCTGG + Intergenic
1096850253 12:54430900-54430922 TAGGGGAAAGGCTCTGTAGGGGG + Intergenic
1098850848 12:75594259-75594281 GAGGAGAAAGGCAATGGAGAGGG - Intergenic
1102071265 12:110021912-110021934 CAGGAGAAAGGCTATGAAGGTGG - Intronic
1102295256 12:111731349-111731371 GTGGAGAAAGAAGATGGAGGAGG - Intronic
1103044842 12:117727465-117727487 GAGGAGAAAGAAGAAGGAGGAGG + Intronic
1103094589 12:118122608-118122630 AAAGAGGAAGTCTCTGGAGGAGG + Intronic
1103734987 12:123055228-123055250 CAGGAGAAAGACGCTGCAGCTGG + Intronic
1104012094 12:124939120-124939142 GGGGAGAAGGACTCGGGTGGTGG - Intergenic
1104032308 12:125073742-125073764 GAGGAGAAATGGTCTGGGGGAGG - Intronic
1104754472 12:131260458-131260480 GAGGAGAATGAGTCTGGTGAAGG + Intergenic
1105699305 13:22924104-22924126 GATGAGAATTCCTCTGGAGGTGG + Intergenic
1108757649 13:53523124-53523146 GACGAGAAAGGCACTGGATGGGG - Intergenic
1108848082 13:54699160-54699182 GAGGAGAAGGTGCCTGGAGGAGG + Intergenic
1109297148 13:60547938-60547960 GAGGAGAAAGATTTTGGCAGAGG + Intronic
1112708413 13:102099045-102099067 GAGGGGCAGGGCTCTGGAGGGGG + Intronic
1112743096 13:102496680-102496702 CAGGAGAAAGAGTGTGAAGGGGG + Intergenic
1113061704 13:106329306-106329328 CAGGAGTAAGACAGTGGAGGGGG + Intergenic
1113519633 13:110930578-110930600 AAGGTGTAAGACTCTGGAGGTGG - Intergenic
1113921139 13:113912558-113912580 GAGGAGAAAGAGGATGGAGCTGG - Intergenic
1113983935 13:114298900-114298922 GAGGAGATTGATACTGGAGGTGG + Exonic
1114566901 14:23639558-23639580 GGGGAGAATCACTGTGGAGGAGG + Intronic
1114725808 14:24935792-24935814 GAGAAGAAAGACTTTCTAGGTGG - Intronic
1115235517 14:31206443-31206465 AAGGAGAAACAATTTGGAGGGGG - Intronic
1115409911 14:33062148-33062170 GAGAAGAATTACCCTGGAGGTGG + Intronic
1115801769 14:37002255-37002277 GAGAACAAAGACCCTGGAGCTGG - Intronic
1116014462 14:39389543-39389565 GGGGAGAAAAGTTCTGGAGGGGG + Intergenic
1116318642 14:43431232-43431254 AAGGAAAAATTCTCTGGAGGTGG + Intergenic
1117159789 14:52977623-52977645 AAGATGAAAGACTCTGGAGTTGG - Intergenic
1118202693 14:63691471-63691493 GAGAAGAAAGTTTATGGAGGAGG - Intronic
1119449934 14:74700923-74700945 AATGTGAAAGACTCTGAAGGGGG + Intronic
1119483730 14:74975224-74975246 GAAGAGATAGAGGCTGGAGGGGG + Intergenic
1119821304 14:77618333-77618355 GAGCTGAATGACTCTGGAGAAGG + Intergenic
1120419749 14:84268800-84268822 AGGGAGAAAGATTCTGGAGGTGG - Intergenic
1120945717 14:89994846-89994868 GAGGACAAAGGCCATGGAGGTGG + Intronic
1121863601 14:97341910-97341932 AATGAGAAAGACTCAAGAGGAGG - Intergenic
1122355338 14:101119844-101119866 GAGGAGAAAGACTCCTTTGGGGG - Intergenic
1122882319 14:104695647-104695669 GAGGAGGGTGACTCTGTAGGGGG - Intronic
1123428501 15:20193410-20193432 GAGGAGAAAGAACTTGAAGGAGG - Intergenic
1124002560 15:25771078-25771100 GAGGGGAGAGAGTCTGGTGGTGG - Intronic
1125995241 15:44153596-44153618 GATGAAAAAGACTGTGGAGGTGG + Intronic
1127343479 15:58069537-58069559 GAGGAGAAACACTGTAAAGGTGG - Intronic
1128005394 15:64234937-64234959 GAGGAGAAGGGCTATGCAGGAGG + Intronic
1128711808 15:69877887-69877909 GGGGAGAAGGACTGGGGAGGGGG - Intergenic
1128754266 15:70170751-70170773 TAGGAGAAAGGCTAGGGAGGAGG + Intergenic
1129872130 15:78947317-78947339 GAGGAGAGAGACTGTGGGGGAGG - Intronic
1129990349 15:79956626-79956648 GAAGAGACAGACTCCGGAGGAGG + Intergenic
1130323893 15:82863234-82863256 GAGCAGAAAGATTGTCGAGGGGG - Intronic
1130987231 15:88852407-88852429 GAGGAGAAAGAATCAGGGAGGGG + Intronic
1131456528 15:92586391-92586413 GAGGAGGAAGAGTTGGGAGGAGG - Intergenic
1131463706 15:92637949-92637971 GAGGGGACAGGCTCTGGACGTGG - Intronic
1131585585 15:93689561-93689583 GAGGAGAGAGGCTCAAGAGGAGG + Intergenic
1131785378 15:95906453-95906475 CAGGAGAATGACTTCGGAGGTGG + Intergenic
1132185391 15:99798583-99798605 GAGAAGAGGGACACTGGAGGGGG - Intergenic
1132431597 15:101765945-101765967 GAGAAGAGGGACACTGGAGGGGG + Intergenic
1133325622 16:4940573-4940595 GGGGAGAAAGACCCTGGGAGAGG + Intronic
1133805836 16:9125492-9125514 GAGAAGAGGGGCTCTGGAGGAGG + Intergenic
1133891740 16:9885671-9885693 GAGGGGAAAGACTGCTGAGGAGG - Intronic
1133982011 16:10640005-10640027 GAAGAGAAAGACTGAGGAGGAGG - Intronic
1134758818 16:16695045-16695067 GAGGAGTTAGACTATGGAGAAGG - Intergenic
1134987257 16:18664126-18664148 GAGGAGATAGACTATGGAGAAGG + Intergenic
1135786187 16:25351392-25351414 TAGGAAAAAGATTCTGGAAGAGG + Intergenic
1135913169 16:26579360-26579382 GTGGAGAAAGACTCTTGAATAGG + Intergenic
1135916475 16:26609609-26609631 TAAGAGAAAGACTTTGGCGGTGG - Intergenic
1136855816 16:33656352-33656374 GAGGAGAAAGAACTTGAAGGAGG + Intergenic
1137944500 16:52720775-52720797 TAGGACAAACACTCAGGAGGAGG - Intergenic
1138347507 16:56328976-56328998 GAGGAGAAAGAGGCCAGAGGAGG + Intronic
1140322225 16:73964213-73964235 GAGGAAAAAGATTTTGGAGGTGG + Intergenic
1140457070 16:75111805-75111827 AAGGACAGAGACCCTGGAGGGGG + Intergenic
1203117401 16_KI270728v1_random:1504831-1504853 GAGGAGAAAGAACTTGAAGGAGG + Intergenic
1143290753 17:5826126-5826148 GAGGAGAAATGATCTGGAGAAGG - Intronic
1143554804 17:7653362-7653384 GAGGATAAAGGCTAGGGAGGAGG - Exonic
1144613441 17:16746133-16746155 GAGGAGATTGATACTGGAGGTGG - Intronic
1145133109 17:20376209-20376231 GAGGAGATTGATACTGGAGGTGG - Intergenic
1146179307 17:30687106-30687128 AAGGAAAAAGACTGTGAAGGAGG - Intergenic
1147567453 17:41546471-41546493 GAGGGGAAGGACCCTGCAGGTGG - Intergenic
1147891476 17:43720585-43720607 CAGGAGGAAGGCTCCGGAGGTGG + Intergenic
1148491629 17:48027129-48027151 GAGGAGGGAGACTGTGCAGGAGG - Intronic
1148543935 17:48502555-48502577 GAAGAGTAAGACTGTGAAGGGGG + Intergenic
1148830804 17:50429811-50429833 GGGGAGAAAGACTCTGGGCCGGG - Intronic
1149534426 17:57421525-57421547 GAGGAGAATGAATGGGGAGGAGG - Intronic
1151525550 17:74664037-74664059 GAGGAGAAGGACTCTGGGTAGGG + Intergenic
1152217425 17:79041961-79041983 GAGGAGAAAGAGTCTGGCCCAGG + Intronic
1154254699 18:12772355-12772377 GAGGAGAGAGTCTCGGGGGGTGG - Intergenic
1155254812 18:23985835-23985857 GGAGAGAAAGACTGTGAAGGGGG - Intergenic
1155279512 18:24225075-24225097 GAAGAAAAAGACTGTGGTGGCGG - Exonic
1155777900 18:29791427-29791449 GAGAAGAAAGACACTGGGGAAGG - Intergenic
1155828382 18:30479612-30479634 AAGCAGACAGACTCTGGTGGAGG + Intergenic
1156382888 18:36579900-36579922 GAGGAGAAGGACCACGGAGGAGG + Intronic
1156956314 18:42968878-42968900 GAGGAGAAGTACATTGGAGGAGG + Intronic
1157312383 18:46561789-46561811 TAGGAGAAAGGCTCTGGACCTGG + Intronic
1157660201 18:49434562-49434584 GTGGAAAAGGACTCTGGAGTGGG + Intronic
1157892132 18:51427856-51427878 GAGGAAAAAAACTCTAGAGATGG + Intergenic
1158861350 18:61595052-61595074 GAGGAGAAAGAAGGAGGAGGAGG + Intergenic
1160779969 19:873209-873231 GAAGAGACAGACTCAGGAAGTGG + Intronic
1161146787 19:2683721-2683743 CAAGAGAGAGACCCTGGAGGAGG + Intronic
1161313518 19:3607486-3607508 GAGGAGGAACAGTCTGGAGCCGG + Intergenic
1162145635 19:8611008-8611030 GGGGAGAAAGAATCAGGTGGGGG + Intergenic
1162661054 19:12169337-12169359 GAGAATTAAGACCCTGGAGGAGG + Intronic
1162979318 19:14228463-14228485 AAGGAAAAAGACTGTGAAGGAGG + Intergenic
1163564893 19:18045233-18045255 GAGGAGAAGGAGGGTGGAGGAGG + Intergenic
1163767755 19:19172712-19172734 GAGGGGAGAGAATCTGGAGGAGG - Intronic
1164441545 19:28283660-28283682 GGGGAGAAAGAGTGAGGAGGAGG - Intergenic
1165441383 19:35830294-35830316 AAGGTGAAAGAATGTGGAGGAGG - Intronic
1166545476 19:43632374-43632396 GTGGAGAATGGCCCTGGAGGAGG - Intronic
1166916074 19:46196821-46196843 GAAGAGGAGGGCTCTGGAGGAGG - Intergenic
1167569269 19:50276784-50276806 GCTGAAGAAGACTCTGGAGGAGG + Exonic
1167619165 19:50551599-50551621 GAGGGGGGAGACTCAGGAGGGGG - Intronic
1167700710 19:51043525-51043547 GAGGAGAAAGACCCTGGTGCTGG + Intergenic
1167852029 19:52209612-52209634 GAGGTGAAAAATTCTGGAGATGG - Intronic
1168448406 19:56444333-56444355 AAGGAGAGAGAGTGTGGAGGAGG + Intronic
1202700402 1_KI270712v1_random:159777-159799 ATGGAGGAGGACTCTGGAGGAGG + Intergenic
925146634 2:1587076-1587098 AAGGAGAAGGAATGTGGAGGTGG + Intergenic
925389950 2:3487821-3487843 GAAGACAGAGACACTGGAGGAGG - Intergenic
925642351 2:5998273-5998295 GAAGAGAAAGACTGGAGAGGGGG + Intergenic
925808055 2:7672048-7672070 GAGTAGAGATACTCTGGAGCAGG - Intergenic
925940841 2:8816289-8816311 GAGGAGAAAGCCTTTGGAGCAGG + Intronic
927991136 2:27447966-27447988 GAAGAGAAAGTCACTGGAAGTGG + Intronic
928525876 2:32139897-32139919 GAGGTGAAAGAATCTGTATGAGG + Intronic
928531668 2:32198925-32198947 GAGGAAAAAGGTTCTGGAGATGG - Intronic
929015007 2:37485221-37485243 GAGGAGAAGGAATATGGAGGAGG - Intergenic
929055782 2:37875080-37875102 GTGGAGACAGAGTCTGCAGGGGG + Intergenic
929944981 2:46363446-46363468 GAGAAGAAATCCTCTGGAAGGGG + Intronic
930285653 2:49424325-49424347 GAAGAGAAAGACACCAGAGGTGG - Intergenic
931487234 2:62705755-62705777 GAGGAGAAAGGCGGGGGAGGGGG + Intronic
931618532 2:64186622-64186644 GAAGAGAAAGTCTTGGGAGGAGG + Intergenic
931799295 2:65742831-65742853 AAGGAGTAAGAATATGGAGGAGG + Intergenic
932216604 2:69970164-69970186 CAGGAGAGAGACTCAGGAGGAGG - Intergenic
932733207 2:74235034-74235056 GAGGGGAAAGAATCTGCAGCTGG + Intronic
932819872 2:74890422-74890444 GAGGAGCACAACTCTGGAGGGGG - Intronic
933469604 2:82704875-82704897 GAGGAGAATAACAGTGGAGGAGG - Intergenic
934171330 2:89543250-89543272 GAGATGGAGGACTCTGGAGGAGG + Intergenic
934281639 2:91617568-91617590 GAGATGGAGGACTCTGGAGGAGG + Intergenic
934566214 2:95343032-95343054 GAGGAGAACCACAGTGGAGGTGG + Intronic
934747673 2:96770273-96770295 GAGCAGAAAAACACTGGAGCGGG - Intronic
936557349 2:113508287-113508309 TAGCAGAAAGAAGCTGGAGGTGG + Intergenic
936619630 2:114082111-114082133 GAGGAGAAAGGCTATGCGGGTGG - Intergenic
937267434 2:120625336-120625358 GAGGAGAGAGGTTCTGGATGAGG + Intergenic
937637767 2:124176102-124176124 GAGGAGAAAGATCCTGGAAATGG - Intronic
938377547 2:130818776-130818798 AAGGACAAAGACAATGGAGGTGG + Intergenic
939021131 2:136959839-136959861 GTCAAGAAAAACTCTGGAGGGGG + Intronic
939984119 2:148813717-148813739 GAGAAGCAAAACCCTGGAGGGGG + Intergenic
939998548 2:148943489-148943511 GAGGGAAAAAAATCTGGAGGAGG + Intronic
940151647 2:150608961-150608983 TAGAAGAAAGTCTCTGGGGGTGG - Intergenic
940840182 2:158570960-158570982 GAGAAGCAAGGCTCTGGATGAGG + Intronic
941417522 2:165240412-165240434 GAGTGGAATGACTCAGGAGGTGG + Intronic
941756115 2:169188119-169188141 GAGGATAATGACTGTGGAGACGG - Exonic
942002721 2:171664936-171664958 CAGGAGAAAGTCTGTGGGGGAGG + Intergenic
942776991 2:179593888-179593910 CAGGAGAAAGATTATGAAGGGGG - Intronic
944876728 2:203969769-203969791 GAGAACACAGACTCTGGAGGAGG - Intergenic
945488740 2:210429378-210429400 GAGGAGAAAGGCTGAAGAGGAGG + Intergenic
946470479 2:219955880-219955902 CAGGAGAATCACTCAGGAGGTGG - Intergenic
946679596 2:222199391-222199413 GAGGAGAAAGGATCAGGAGAGGG + Intergenic
947639617 2:231699643-231699665 CAGGAGAAAGATGCTGGAAGGGG + Intergenic
947876662 2:233472096-233472118 GATGACAAAGACTCTGGCGATGG - Exonic
948242204 2:236447068-236447090 GATGAGAGAGTCACTGGAGGAGG - Intronic
948558384 2:238834031-238834053 GAGGAAAAAGAAACTGGAGGAGG + Intergenic
1170477495 20:16730217-16730239 GAGGAGACTGACTCTGGGGCCGG + Intronic
1170877268 20:20262156-20262178 GAGGGGCAAGGCTCTGGAAGAGG - Intronic
1170915782 20:20624034-20624056 AAGGAAAAAGACGCTGGACGCGG + Intronic
1171189251 20:23147097-23147119 GAGGAGAAAGTCAATGGAGGAGG - Intergenic
1171299818 20:24050386-24050408 GAGGAGAAGCAGTCTGGTGGGGG + Intergenic
1172509356 20:35489601-35489623 GAGGTGAAGGGCTCTGGAGTTGG - Intronic
1172645342 20:36465647-36465669 GATGAGAAAGCCACGGGAGGTGG - Intronic
1172740407 20:37162053-37162075 GAGGAGAAAAACTCAGAAAGGGG - Intronic
1173823624 20:46033662-46033684 GAAGAGAAGGAGTTTGGAGGTGG - Intronic
1175076979 20:56383603-56383625 GTGGAGAACCACTCTGGTGGTGG + Intronic
1175693075 20:61079970-61079992 GAGAGGAAAGAAGCTGGAGGTGG - Intergenic
1176139329 20:63538170-63538192 GAGGAGGCAGAGGCTGGAGGCGG - Intergenic
1177403803 21:20640052-20640074 GATGAAAAACATTCTGGAGGTGG + Intergenic
1178423449 21:32460199-32460221 GTTGAGAAATACCCTGGAGGGGG - Intronic
1178505254 21:33157395-33157417 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1178505259 21:33157414-33157436 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1178505264 21:33157433-33157455 GAGGAGAAAGAGGGAGGAGGAGG - Intergenic
1178575692 21:33787727-33787749 AAGGAGAAAGACTCAGAAAGAGG + Intronic
1178992876 21:37368685-37368707 GAGGAGAGTGAGTCTGGAGAGGG + Intronic
1179711470 21:43265901-43265923 GAGGAGAAAGCCACTGCAGACGG - Intergenic
1180877378 22:19180901-19180923 CAGGAGAATGACAGTGGAGGAGG + Intronic
1181387814 22:22558130-22558152 GAGAAGAAAGACAGTGGGGGGGG + Intronic
1181410513 22:22715230-22715252 GAGTAGAAAGGCTCTGCAGCAGG - Intergenic
1181418066 22:22774472-22774494 GAGCAGAAAGGCTCTGCAGCAGG - Intronic
1181554104 22:23657745-23657767 GAGGAAAAAGAAACAGGAGGAGG - Intergenic
1181729049 22:24831426-24831448 AAGGAGCAAGACCTTGGAGGAGG + Intronic
1182374264 22:29835007-29835029 GTGGAGAAAAAGTCAGGAGGAGG + Intronic
1182475717 22:30575273-30575295 GAGGAGCAAGACCATGGATGAGG + Intergenic
1182766997 22:32764876-32764898 GAGGAGAGAGACTATGAGGGAGG - Intronic
1183655505 22:39182332-39182354 GAGGAGAGAGACAATGGAGGAGG + Intergenic
1184150636 22:42636350-42636372 GTGGGGAATGACTCTGGGGGAGG + Intronic
1184934830 22:47713751-47713773 GAGGAGAAGGACCCTGGGGTTGG + Intergenic
1203296392 22_KI270736v1_random:46632-46654 GAGAAGGAAGACAGTGGAGGAGG - Intergenic
949239503 3:1853062-1853084 TAGGAGAAAAACTCTGAAAGAGG - Intergenic
950209939 3:11115862-11115884 GAGGAGAAGAAGTCTGCAGGGGG - Intergenic
950650456 3:14403705-14403727 GAAGAGAAATAGTCTGGAGGGGG - Intronic
950904048 3:16521544-16521566 GAACAGAATGAGTCTGGAGGAGG - Intergenic
951029818 3:17869225-17869247 GAGGTGAATGTCTCTGGAGATGG - Intronic
951377585 3:21939774-21939796 TAGGAGAAAGACTTTGGAAAAGG + Intronic
951870419 3:27355648-27355670 AAGCAGAGAGACTCTTGAGGGGG - Intronic
952124916 3:30289369-30289391 GTAGGGAAAGACTTTGGAGGTGG + Intergenic
952125305 3:30292657-30292679 GTAGAGAAAGACTTTGGAGGTGG + Intergenic
952918551 3:38267852-38267874 GAGGGGAAGGCCTCTGCAGGTGG + Intronic
953077972 3:39588229-39588251 GAGGAGAAAGCTTGTGGTGGTGG - Intergenic
953851577 3:46469251-46469273 GAGGAGAAAGCCCCTGGCTGTGG - Intronic
953928873 3:46996259-46996281 GAGGAGAAAGGCTGTGGGGCCGG - Exonic
953944477 3:47134714-47134736 GAGGAGAATCACTTGGGAGGCGG - Intronic
953955202 3:47226687-47226709 GAAGAGAAAGGAGCTGGAGGAGG + Intergenic
954844253 3:53541561-53541583 GAGGAGGATGACTCAGGAGCCGG - Intronic
954914687 3:54138874-54138896 GAGGAGAAATCCTAAGGAGGAGG - Intronic
955411206 3:58656695-58656717 TAGGATAAAGACTCTGGGGTGGG - Intronic
955975423 3:64475329-64475351 GAGTAGAAAAAGTCTGAAGGAGG + Intergenic
956000767 3:64727892-64727914 TAGGAAAAAGAATATGGAGGTGG - Intergenic
956553362 3:70488075-70488097 GAGGGGAAGGGCTCGGGAGGGGG - Intergenic
958094057 3:88918744-88918766 GAGGAGACAGACCCAGTAGGTGG - Intergenic
959984219 3:112555718-112555740 GAGTAGAATGAGCCTGGAGGAGG - Intronic
959991786 3:112639007-112639029 GAGGGGAATGACGGTGGAGGGGG - Exonic
960168516 3:114431330-114431352 AAGAAGAAAAACTCTGGAAGGGG + Intronic
960195494 3:114762368-114762390 GAGAAGAAAGAATGTGGAGAGGG - Intronic
960941918 3:122940597-122940619 GAGGGGAAAGGCTGTGGAGTGGG + Intronic
961166043 3:124764648-124764670 GAGGAGAAGGCCTTTGGAAGGGG - Intronic
961425922 3:126847777-126847799 AAGGAGAAAGACACTGGTAGGGG - Intronic
963043200 3:141083933-141083955 GAGGGGAAAGACTCTGAAGTTGG + Intronic
964449316 3:156795420-156795442 GCGGAGAAAGAATCTGGATACGG - Intergenic
965836132 3:172854961-172854983 AAGGACAAAGACTCTTGATGGGG - Intergenic
966078062 3:175963172-175963194 TAGGAGAATAACTCTGCAGGAGG + Intergenic
967174995 3:186854664-186854686 GAGAAGAAAGCCTGTGAAGGTGG - Exonic
967815956 3:193798270-193798292 GAGGAGGTAGAACCTGGAGGGGG + Intergenic
967937357 3:194739591-194739613 CAGGAGGAAGCCTGTGGAGGGGG + Intergenic
968273009 3:197419116-197419138 GATGAGAAAGACTTTGGCAGAGG + Intergenic
968361421 3:198149336-198149358 GAGGAGATAGACGATGCAGGAGG - Intergenic
968382592 4:108733-108755 GAGGAGCAGGTCTCCGGAGGAGG - Intergenic
969054033 4:4390559-4390581 GGGGAGAAAGAGCTTGGAGGTGG + Intronic
969842982 4:9897139-9897161 TAAGAGCAAGACTCTGGAGCCGG - Intronic
970363666 4:15336586-15336608 AAGGAGAAAGAATGTGGAGTAGG + Intergenic
970559132 4:17265841-17265863 GAGGAGACAGATTCTAGTGGAGG - Intergenic
971143939 4:23956208-23956230 GAGGAGCAGGAGTCTGGAGCAGG - Intergenic
972561511 4:40232829-40232851 GAGAAGAAAGGCTTTGGGGGTGG - Intronic
973570249 4:52231454-52231476 GAGGAGACAGACTCTTGCAGAGG + Intergenic
976763457 4:88574521-88574543 CAGGTGAAAGATTCTGGAGATGG - Intronic
977155509 4:93568109-93568131 GAGGAAACAGAACCTGGAGGAGG - Intronic
977859586 4:101940716-101940738 GAGGAGAAAGACCATGGAGGTGG + Intronic
978350139 4:107812707-107812729 GTGGAGAATGGATCTGGAGGAGG - Intergenic
978385800 4:108174303-108174325 GAGGAAACAGACTCTGGGAGAGG - Intergenic
978698810 4:111617528-111617550 GAGGAGAAAACCTCTGAATGGGG + Intergenic
979305338 4:119135915-119135937 GTGGAGGAAGACTCTGGAGATGG - Exonic
980722271 4:136714520-136714542 GTAGAGACAGACTGTGGAGGAGG - Intergenic
984463014 4:180059233-180059255 GAGGAGAGAGTCGGTGGAGGTGG - Intergenic
985126688 4:186701675-186701697 CAGGAGAAGGAATGTGGAGGAGG - Intronic
985830783 5:2227773-2227795 CAGGACAGAGACGCTGGAGGTGG + Intergenic
986284057 5:6347148-6347170 GAGGAGAGGGAACCTGGAGGAGG - Intergenic
989204824 5:38800067-38800089 GATGAAAAAGCCTCTGGAGTGGG - Intergenic
990886255 5:60597670-60597692 TAGGAGAAAGACTTTGGTGGTGG - Exonic
991046028 5:62223758-62223780 GAGGAGAAAGAACTTGAAGGAGG - Intergenic
992107491 5:73462021-73462043 AAAGAGAAAAACTCTTGAGGAGG - Intergenic
992189647 5:74278861-74278883 GAGGAGAAAGAAGATGGAGGTGG - Intergenic
992586830 5:78249446-78249468 GAGGAGAAAGAGATTGGAGTAGG - Intronic
992737869 5:79742028-79742050 GAGGAGAAAGAGGGAGGAGGAGG - Intronic
992996617 5:82340220-82340242 GAGGAGCAGAGCTCTGGAGGGGG + Intronic
993106167 5:83603448-83603470 GAGGAAAATGAAGCTGGAGGAGG - Intergenic
995192560 5:109333652-109333674 CAGGAGAATCACTCTGAAGGTGG + Intergenic
995228458 5:109730837-109730859 AAGAAGACAGCCTCTGGAGGTGG - Intronic
996210500 5:120802822-120802844 GAGGAGAAACAGTGTGGAGAAGG - Intergenic
996531699 5:124533939-124533961 GAGGAGAAACACAGTGGAGAAGG - Intergenic
996937598 5:128966079-128966101 GAAGAGAAGGACGCTGGTGGGGG + Exonic
997491023 5:134276148-134276170 GCAGAGAAAGATTTTGGAGGAGG - Intergenic
997589300 5:135063168-135063190 GAGGAGCAGGACTGTGTAGGTGG + Intronic
997602773 5:135151643-135151665 CAGGAGAAAGACACAGGAGTGGG - Intronic
998100028 5:139425025-139425047 GAGGACACAGACTCAGAAGGAGG - Exonic
998136308 5:139676324-139676346 GGGGAGAAGGACTGGGGAGGAGG - Intronic
998206403 5:140159733-140159755 GAGGAGGAGGACTCTGAAAGAGG + Intergenic
999080876 5:148842503-148842525 CAGGTGACAGACTCTGGAAGGGG - Intergenic
1000581222 5:163037006-163037028 GAGGAGAAAAAAGCAGGAGGGGG + Intergenic
1001719895 5:173848234-173848256 GATGAGGAAGTTTCTGGAGGAGG + Intergenic
1001769884 5:174286312-174286334 GAGGAGAAAGATGGGGGAGGAGG + Intergenic
1001809887 5:174619538-174619560 GAGGAGGTCGACCCTGGAGGAGG - Intergenic
1002202554 5:177538326-177538348 GGGGAGAGAGACTCTGGTAGGGG + Intronic
1002419701 5:179139232-179139254 GAGGAGACAGGCAGTGGAGGAGG + Intronic
1003234751 6:4285419-4285441 GTGGTTAAAGAATCTGGAGGGGG + Intergenic
1003730550 6:8818071-8818093 GAGGAGAAAGAGCCAGGAGAGGG + Intergenic
1004721016 6:18267166-18267188 GATGAGAAAGACTTCGGGGGTGG + Intergenic
1004873876 6:19935776-19935798 AAGGAGAAAGAGTGTGGAGGTGG - Intergenic
1005118701 6:22367053-22367075 AAGGGGAAAGACAATGGAGGAGG - Intergenic
1005711150 6:28503800-28503822 GAGGAGAGAGGCTATGAAGGAGG + Exonic
1005989404 6:30893643-30893665 GAGGAGAGAGCCTGTGGAGAGGG + Intronic
1006022372 6:31125019-31125041 GAGGAGGAAAGCTGTGGAGGAGG - Intronic
1009789564 6:68384733-68384755 GAGGAGACAGACTTTGGGGTGGG + Intergenic
1011020059 6:82802975-82802997 GAGTAGAAACAATCTGGAGTGGG + Intergenic
1013029346 6:106316686-106316708 GAGGAGAAACTATCTGGAGTAGG - Intronic
1013677562 6:112482623-112482645 GAGGAAGAAGAAACTGGAGGTGG + Intergenic
1013788872 6:113813339-113813361 GAGGAGAAAGATACTGCAGGAGG + Intergenic
1013987624 6:116214734-116214756 GAGGAGAAACACTGTGGAAATGG + Intronic
1014444852 6:121515094-121515116 GAGCAGATAGAGTATGGAGGAGG + Intergenic
1015559422 6:134498457-134498479 GAGGAGGAGGACACTGGAAGAGG + Intergenic
1015703193 6:136058438-136058460 CAGGAAATAGACACTGGAGGTGG - Intronic
1015805130 6:137101039-137101061 GAGGAGAAAGAATCATGAGTAGG - Intergenic
1016292164 6:142537990-142538012 GAGAAGAAAGAACCTGGAAGTGG - Intergenic
1016890039 6:148996554-148996576 CAAGAGAAAGAGTCTGTAGGAGG - Intronic
1017237840 6:152135873-152135895 GAGAAGAAAGACTGAGGAGGTGG - Intronic
1017451055 6:154554751-154554773 GAGGAGGAGGGCTCTGCAGGTGG - Intergenic
1017729979 6:157306485-157306507 GGGGAGAATGACTCAGGAGTAGG + Intronic
1018038047 6:159898546-159898568 GAGGAGGAAGAGGCAGGAGGAGG - Intergenic
1018061007 6:160089711-160089733 GGGGAGAAAGCCTCTTGAGAGGG + Intronic
1018446302 6:163862126-163862148 AAGGAGCAACACTCTGGAGAGGG + Intergenic
1018606100 6:165599812-165599834 GGGGAGGAAGGCTGTGGAGGAGG - Intronic
1019254269 7:39384-39406 GAGGAGATAGACGATGCAGGAGG + Intergenic
1020439861 7:8205986-8206008 GGGGAGAGAGGCTGTGGAGGGGG - Intronic
1020932387 7:14414243-14414265 GAGTATAAAGAATCTAGAGGGGG + Intronic
1021150713 7:17147712-17147734 AGGGATAAAGACTTTGGAGGAGG - Intergenic
1021601276 7:22366211-22366233 GAGGCTAAAGACGCTGGATGTGG + Intergenic
1022550595 7:31235638-31235660 GAGGAGAAAAACACTGGAAATGG + Intergenic
1022614810 7:31918559-31918581 CAGCAGAAAGACTCAGGAGCTGG - Intronic
1022670087 7:32447394-32447416 GAGGGGAAAGACTCTGTGGGAGG + Intergenic
1024217253 7:47257829-47257851 GGTGAGAAAGACTTTTGAGGTGG - Intergenic
1024554090 7:50588551-50588573 AAGGAGAAAGACACTGGGGTTGG - Intergenic
1025945392 7:66100443-66100465 GAGGAAAAAGAATGAGGAGGAGG + Intronic
1026895844 7:74009680-74009702 GAGGAAACTGAGTCTGGAGGTGG + Intergenic
1027189897 7:75990419-75990441 GAGGGGAAAGACCCAGGAGAAGG - Intronic
1027263150 7:76479234-76479256 AAGGAGAAGGTCTCGGGAGGTGG + Intronic
1027314534 7:76977339-76977361 AAGGAGAAGGTCTCGGGAGGTGG + Intergenic
1027517059 7:79155557-79155579 GAGGAGAAAGAATCCAGAGAAGG + Intronic
1028437513 7:90821542-90821564 GAGGAGGCAGAAACTGGAGGAGG + Intronic
1028716260 7:93973485-93973507 GGGGAGACAAACTCTGGAGAAGG + Intronic
1029029915 7:97456492-97456514 TGGAAGAAAGACTCTGGAGGCGG + Intergenic
1029109398 7:98204815-98204837 GAGGAGACAGAGTGCGGAGGAGG - Intronic
1029381693 7:100219561-100219583 GAGGAGAAAGCCCCTGGGAGTGG - Intronic
1029401858 7:100352009-100352031 GAGGAGAAAGCCCCTGGGAGTGG - Intronic
1029575667 7:101401781-101401803 GAGGAGGAAGACCCTGGAGAGGG + Intronic
1029623903 7:101707684-101707706 GAGGAGAAAGCCTCTGACTGTGG + Intergenic
1029873611 7:103723240-103723262 GAGGAGAAAGATGCTGGGAGGGG + Intronic
1030383191 7:108836792-108836814 CAGGAAAATGGCTCTGGAGGTGG + Intergenic
1030422886 7:109330577-109330599 GAGGAGAGAGATTGTGAAGGAGG - Intergenic
1031072768 7:117180285-117180307 GAGGAGAAAAAATGTGGAAGAGG + Intronic
1032531875 7:132627934-132627956 GAGAAGAAATATTCTGGTGGAGG - Intronic
1034099656 7:148439823-148439845 GAAGAGAAAGAATATGTAGGAGG - Intergenic
1035070417 7:156140574-156140596 GAGGAGAAAGAGGCAGGTGGGGG + Intergenic
1035341489 7:158165412-158165434 GAGGAGAAGGACGGCGGAGGAGG - Intronic
1035352519 7:158256558-158256580 GAGGAGACAGAAGCTGGCGGGGG + Intronic
1035667415 8:1389220-1389242 GAGGAGCGGTACTCTGGAGGAGG + Intergenic
1036811291 8:11868730-11868752 GAGGAGAAGGACCTTGGGGGCGG + Intronic
1037804114 8:22049752-22049774 GAGGAGAAACAGGCTGGAAGGGG - Intronic
1037934486 8:22906068-22906090 AAGGAGAAATGCTATGGAGGTGG + Intronic
1038395461 8:27242732-27242754 GAGGAGACATACTGTGGAGAAGG - Intronic
1038503838 8:28067526-28067548 GAGGGTGATGACTCTGGAGGTGG + Exonic
1038650100 8:29394713-29394735 GAGTAGAAAGACACTGAGGGAGG + Intergenic
1038759865 8:30376363-30376385 GAGGAGAAAGAGGCTGGGTGTGG - Intergenic
1039181259 8:34869307-34869329 GATGAGAAAGACTCTGGCAAAGG + Intergenic
1039542251 8:38382032-38382054 GAAGAGGAAGGCTCGGGAGGTGG + Exonic
1039775743 8:40734502-40734524 TAGGTGAAAGATTCTGGAGATGG + Intronic
1039819276 8:41122072-41122094 GTGGAGAAAGAGACTGGAAGTGG - Intergenic
1040923439 8:52650314-52650336 GAAGAGAGAGACTCTGGAGGTGG + Intronic
1041605628 8:59779622-59779644 GGGGTGCAAGACTCTGGAAGTGG + Intergenic
1041851451 8:62397835-62397857 GAGCAGAAAGAGTTTGGATGTGG + Intronic
1042155696 8:65841986-65842008 GAGGAGCAGGACTCCGGCGGCGG - Intronic
1042719749 8:71814524-71814546 GGGGAGAAATCCTCTGGAGAAGG + Intergenic
1044096903 8:88078093-88078115 GAGGAGAAAGAGACAGGAAGAGG - Intronic
1044575890 8:93768803-93768825 GAGGAGGGAGAATGTGGAGGTGG - Intronic
1045167449 8:99622711-99622733 TATGAGAAAGACTATGGATGCGG - Intronic
1045395660 8:101758307-101758329 CAGGAGACAGCCTATGGAGGGGG - Intronic
1047141319 8:122142744-122142766 GTGGAGGCAGATTCTGGAGGTGG + Intergenic
1048225563 8:132581983-132582005 GAGGAGAAAGTGAATGGAGGGGG - Intronic
1048259655 8:132934967-132934989 GAGGAGAGAGAGGCTGGAGCTGG - Intronic
1048795225 8:138143430-138143452 GAGGAAATAGACTCTGGGAGGGG + Intronic
1049104309 8:140601914-140601936 AAGGGGAAAGACCGTGGAGGAGG - Intronic
1049566503 8:143341848-143341870 GAGGAGAAAGAGGAAGGAGGAGG - Intronic
1049895654 9:109012-109034 TAGCAGAAAGAAGCTGGAGGTGG - Intergenic
1052190334 9:25654101-25654123 AAGGAGAAAGAAGCTGGAGATGG - Intergenic
1052640904 9:31165100-31165122 GAGGAGCAGAACCCTGGAGGTGG + Intergenic
1053002778 9:34586382-34586404 GGGGAGAAAGTAGCTGGAGGAGG - Intronic
1053306546 9:36988062-36988084 GAGGAGAAAGGATCAGGAGCTGG + Intronic
1053455480 9:38230346-38230368 GAGGAGAGATGCTCAGGAGGGGG + Intergenic
1053738831 9:41119190-41119212 TAGCAGAAAGAAGCTGGAGGTGG - Intergenic
1054689513 9:68312125-68312147 TAGCAGAAAGAAGCTGGAGGTGG + Intergenic
1054771431 9:69087903-69087925 AAGAAGAAGGACTCTGCAGGTGG - Intronic
1056616071 9:88167116-88167138 GAGGAGAAACAGTCTGGAGAGGG + Intergenic
1057157236 9:92853746-92853768 GAGGAGAAAGACCCCTGTGGGGG + Intronic
1057239941 9:93399536-93399558 GAAGAGAAAGACTCATGAGCTGG - Intergenic
1058107423 9:100988564-100988586 GAGGAGGGAGACTAGGGAGGAGG + Intergenic
1058398301 9:104581995-104582017 AAGGAGAATGACTTTGGAGTTGG - Intergenic
1058460504 9:105178203-105178225 AAGGAGAAAGTGTTTGGAGGAGG - Intergenic
1058555600 9:106163483-106163505 GAAGAGAAAGACCATAGAGGTGG + Intergenic
1059061058 9:111036408-111036430 GAGGAGAAAAATTCTTGAGCTGG - Intronic
1059161587 9:112040023-112040045 GAGAAGAAAAACCATGGAGGAGG - Intergenic
1059551064 9:115229577-115229599 GAGGAGAAAGAGCAGGGAGGAGG + Intronic
1059575471 9:115483760-115483782 GAGAAGGAAGAGTCTTGAGGGGG - Intergenic
1059711326 9:116870251-116870273 TAGGAGAAAGAATGTGGAGTTGG - Intronic
1059798598 9:117727195-117727217 AAAGAGAAAGACTCTGCAGGAGG - Intergenic
1060045588 9:120337539-120337561 GAGCAGAACGAGTCTGGAGTTGG - Intergenic
1060991276 9:127850549-127850571 GAGGAAAAAGAGCCTGGAGCAGG - Intronic
1061245622 9:129400089-129400111 CCGGAGAAAGATTCTGGTGGTGG - Intergenic
1062049147 9:134438217-134438239 GTGGGGAAAGACTATGGAGAAGG - Intronic
1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG + Intergenic
1062322100 9:135995104-135995126 GTGGAGACAGACGGTGGAGGGGG - Intergenic
1062404700 9:136389904-136389926 AAGGAGAAAGAATCTGGCGGGGG + Intronic
1062502504 9:136857497-136857519 GAGGCCAAGGTCTCTGGAGGCGG + Exonic
1062746133 9:138213157-138213179 GAGGAGATAGACGATGCAGGAGG - Intergenic
1185499044 X:583937-583959 GAGGAGGAGGAGGCTGGAGGAGG + Intergenic
1185499241 X:584705-584727 GAGGAGGAAGAGCCTGGAGGAGG + Intergenic
1186334341 X:8570498-8570520 GCGGAGAAAGACTACGGATGGGG - Exonic
1187025784 X:15434100-15434122 GAGGAGAAAGAAGGAGGAGGAGG + Intronic
1187025790 X:15434123-15434145 GAGGAGAAAGAAGGAGGAGGAGG + Intronic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187631269 X:21175318-21175340 AGGGAGAAAGAGTATGGAGGGGG + Intergenic
1188245002 X:27828969-27828991 AAGGAAAAAGAAACTGGAGGGGG + Intergenic
1188673661 X:32912082-32912104 GAGGAGAAGGAATGGGGAGGAGG + Intronic
1189021919 X:37349821-37349843 GAGGGGAAAGGATTTGGAGGCGG + Intronic
1190214718 X:48472414-48472436 AAGGAGACAGAGGCTGGAGGAGG - Intergenic
1190580740 X:51891681-51891703 GAGGAGAAACACTGTGTTGGTGG + Intronic
1191108380 X:56786597-56786619 GAGGAGAAAGAAGAAGGAGGAGG - Intergenic
1191883995 X:65871061-65871083 GCGGAGAAATACTCTGTTGGTGG - Intergenic
1192005250 X:67204752-67204774 GATTAGGAAGACTCTGGATGGGG + Intergenic
1192699464 X:73452411-73452433 AAGGAGGAAGATCCTGGAGGAGG + Intronic
1193741979 X:85227987-85228009 GAGGGGAAAGAGTGTAGAGGGGG + Intergenic
1196184754 X:112734158-112734180 GAGGAGAAAGAAAGAGGAGGAGG - Intergenic
1197944902 X:131828120-131828142 GAGGAGAAGGGCTCTGGGGGTGG - Intergenic
1198547818 X:137711707-137711729 ATGGAGAAAAATTCTGGAGGCGG + Intergenic
1199471466 X:148200113-148200135 GAGGAGAAAGAGTTTGGGGAAGG - Intergenic
1201412744 Y:13716987-13717009 AAGGAGAAAGAGAATGGAGGAGG + Intergenic
1201856622 Y:18551621-18551643 GAGGAGAGAGAGTGTGAAGGAGG + Intronic
1201876699 Y:18768759-18768781 GAGGAGAGAGAGTGTGAAGGAGG - Intronic
1201928434 Y:19315284-19315306 GAGGAGAAAGAAAGAGGAGGAGG - Intergenic