ID: 919422590

View in Genome Browser
Species Human (GRCh38)
Location 1:197389201-197389223
Sequence CTGGATACACACCTTAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919422586_919422590 -2 Left 919422586 1:197389180-197389202 CCACATGATTCCACAATTCTGCT 0: 1
1: 0
2: 8
3: 68
4: 438
Right 919422590 1:197389201-197389223 CTGGATACACACCTTAAAGAGGG 0: 1
1: 0
2: 3
3: 8
4: 145
919422585_919422590 24 Left 919422585 1:197389154-197389176 CCTCAGAAAATTAAACATAGTTA 0: 1
1: 0
2: 21
3: 180
4: 1107
Right 919422590 1:197389201-197389223 CTGGATACACACCTTAAAGAGGG 0: 1
1: 0
2: 3
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919422590 Original CRISPR CTGGATACACACCTTAAAGA GGG Intronic
901251081 1:7780944-7780966 CAGGATCCACAGCTTAAAGATGG + Exonic
901949929 1:12735723-12735745 CTAGAAACACTTCTTAAAGATGG - Intergenic
902357005 1:15911097-15911119 TTAGATACAAGCCTTAAAGATGG + Exonic
902469839 1:16641244-16641266 CTGGGTATATACCTGAAAGAAGG + Intergenic
905607736 1:39318362-39318384 CTGGATACATGGGTTAAAGAGGG + Intronic
906385743 1:45367286-45367308 ATGCATACACAGCTGAAAGAAGG + Intronic
906507025 1:46387889-46387911 CTGGATACATTCCTTACTGAGGG + Intergenic
906801560 1:48742093-48742115 CTGCATACACAGCTTGAAGGAGG + Intronic
907133625 1:52119011-52119033 CTGGAAAAACTCCTTACAGATGG - Intergenic
909039111 1:70628861-70628883 CTGGGTTCACACCATGAAGAAGG + Intergenic
910168832 1:84356653-84356675 CTGTATACACACCATACGGAAGG - Intronic
910658912 1:89649493-89649515 CTGGACACACAACAAAAAGAGGG - Intronic
911566573 1:99469288-99469310 CTGCATTTACACCTTAAAAAAGG - Intergenic
911713622 1:101104824-101104846 CTAGATACACACCTCTAAAATGG - Intergenic
912748521 1:112266256-112266278 CTGGAGACAGGCTTTAAAGATGG - Intergenic
913285265 1:117220501-117220523 CTGGATACATAACGAAAAGAAGG + Intergenic
916516061 1:165517768-165517790 CTGAGTACACACATAAAAGATGG + Intergenic
919357130 1:196537879-196537901 CTGGGTTCACACCGTAAAGAAGG - Intronic
919422590 1:197389201-197389223 CTGGATACACACCTTAAAGAGGG + Intronic
919680300 1:200427852-200427874 CTGGTGACACAACATAAAGAAGG + Intergenic
922370636 1:224907294-224907316 CTGGAGACAGCCCTCAAAGAAGG - Intronic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
1063706399 10:8435204-8435226 CTGGAAACACAGGTTACAGAAGG - Intergenic
1063906727 10:10787809-10787831 CTGGATAGTCACCTTATAAATGG - Intergenic
1068548167 10:58376052-58376074 CTGGAGACACACATTTAAAAAGG - Intergenic
1068791602 10:61036276-61036298 CTGGATACATTCCTTACTGAGGG + Intergenic
1068853908 10:61777093-61777115 CTGGAGACAGACATTAAACATGG - Intergenic
1071188621 10:83074989-83075011 CTGAATAAACACCATGAAGATGG + Intergenic
1071803464 10:89090861-89090883 CTGGATATACAGCCAAAAGAAGG - Intergenic
1073755705 10:106578650-106578672 CTGGATACAGCTCTTAAGGAGGG - Intronic
1074711387 10:116180829-116180851 CTGCAGACACAGCTTATAGAAGG - Intronic
1075556059 10:123433618-123433640 CTGGAGACACCTGTTAAAGACGG - Intergenic
1076093945 10:127714940-127714962 CATGAGACACACCTTAATGAGGG - Intergenic
1076584685 10:131537588-131537610 CTGGATACACACCCAGAAGTGGG + Intergenic
1079875275 11:25848592-25848614 GAGAATACACACGTTAAAGAAGG + Intergenic
1080224393 11:29944270-29944292 ATGCAGGCACACCTTAAAGAAGG - Intergenic
1080280069 11:30546607-30546629 ATGGCCACACACTTTAAAGAAGG - Intronic
1080286332 11:30618101-30618123 CTGGAAAAGCACTTTAAAGAGGG + Intergenic
1080393852 11:31872024-31872046 CAGGTGACACAGCTTAAAGAAGG + Intronic
1082903701 11:58283808-58283830 CTGGATTCACACTTTAGTGAGGG + Intergenic
1086893162 11:92282178-92282200 TTTGAAACAGACCTTAAAGAAGG - Intergenic
1095427340 12:42090983-42091005 ATGAATTCACACTTTAAAGATGG + Intronic
1100040663 12:90313340-90313362 CTGAATGCACACATTAAAGAAGG + Intergenic
1101657274 12:106733823-106733845 TTGGATACACACCCAAAAGAAGG + Intronic
1106100329 13:26689828-26689850 GGGAATACACACCATAAAGAGGG - Intergenic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1108002046 13:45912664-45912686 CTGGAAGCACAGCTTGAAGATGG - Intergenic
1109223973 13:59670418-59670440 CTGGAGACAAACCAAAAAGAAGG - Intronic
1110631823 13:77717523-77717545 CAGGAAACGCACCTTAAACATGG - Intronic
1114544841 14:23491754-23491776 CTGGAAGCACACTGTAAAGAGGG + Intronic
1116810194 14:49532462-49532484 CTGGATAAATACCCAAAAGAAGG + Intergenic
1119699901 14:76747176-76747198 CTGGATACATAACAAAAAGAAGG + Intergenic
1121495405 14:94388621-94388643 CTGGATCCACTGCTTAAATACGG - Exonic
1121672072 14:95717992-95718014 CTCCATATACACCTTAAAGTTGG - Intergenic
1128040745 15:64571151-64571173 TTGGATAAACACCCTACAGAAGG - Intronic
1136385769 16:29925261-29925283 CTGTATACACACATTGCAGAAGG - Intronic
1138831362 16:60379006-60379028 CTGGGTACTTACCTTAATGAAGG + Intergenic
1146167551 17:30601301-30601323 CAGTAAACACTCCTTAAAGATGG + Intergenic
1149035544 17:52130292-52130314 CTGGATATACACCTAGAAGTGGG - Intronic
1150373378 17:64661402-64661424 CAGTAAACACTCCTTAAAGATGG - Intronic
1150778839 17:68102365-68102387 CAGTAAACACTCCTTAAAGATGG + Intergenic
1151342002 17:73477552-73477574 CTGGATGCCCACATCAAAGATGG - Intronic
1153540814 18:6152233-6152255 TTGGATACATACCCAAAAGAGGG + Intronic
1157072563 18:44425117-44425139 CTGGATATATACCCAAAAGAAGG + Intergenic
1160480517 18:79235990-79236012 CTCGGTACACACCTTACAGGAGG - Intronic
1165209142 19:34218806-34218828 CTGGAGAGACACAGTAAAGATGG + Intronic
1167404674 19:49297575-49297597 TTGGATAAACACCTAAGAGAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168476691 19:56680937-56680959 CTAGATAAAGACCTTAAAAATGG - Intergenic
1168652471 19:58100441-58100463 GGGGATAGTCACCTTAAAGAAGG - Intronic
924973915 2:156077-156099 CTGGATACATTCCTCACAGAGGG + Intergenic
927402551 2:22729877-22729899 CTGCATAGACTCCTTAAAGAAGG - Intergenic
927419392 2:22914310-22914332 CTGGATATATACCCAAAAGAAGG + Intergenic
929620908 2:43353179-43353201 CTGGATACACACCCAGAAGCAGG + Intronic
930449144 2:51512008-51512030 CTGGATAAGCAACTTAAAGTGGG + Intergenic
930583503 2:53242253-53242275 CTGTATACACACCATAAACTTGG - Intergenic
932124737 2:69133461-69133483 TTGGAGACTCACCTTGAAGAGGG + Intronic
934569923 2:95362968-95362990 ATGGATACAAACCCAAAAGATGG - Intronic
937187917 2:120063430-120063452 TTGGAAACACACTTTAAAAAGGG - Intronic
938290678 2:130148291-130148313 CTGGGTACACACCTTCCAGGAGG - Intergenic
938465866 2:131524662-131524684 CTGGGTACACACCTTCCAGGAGG + Intergenic
938610885 2:132946344-132946366 CTGGATCTTCACCCTAAAGATGG - Intronic
942963258 2:181858727-181858749 CTGGTAACACCCTTTAAAGACGG - Intergenic
944392186 2:199228965-199228987 AGGGGTCCACACCTTAAAGAAGG - Intergenic
945344862 2:208701483-208701505 CTGGATCCTCAGCTTACAGATGG - Intronic
945680682 2:212910484-212910506 ATGGAAACACACATAAAAGAAGG + Intergenic
1172929218 20:38571708-38571730 CTGGATATACACCCTGAAGTGGG + Intronic
1174250053 20:49212581-49212603 CTGGATATTCCCCTTAAAAACGG + Intergenic
1176989561 21:15478920-15478942 CTGAAGACACAAATTAAAGAGGG + Intergenic
1179630972 21:42678531-42678553 TTGGACAACCACCTTAAAGAAGG + Intronic
1180575417 22:16768859-16768881 CTGGGTACACAACGAAAAGAAGG + Intergenic
954299594 3:49692970-49692992 CTGGGTATATACCTGAAAGAAGG - Intronic
954889755 3:53914283-53914305 CTGAATACACAATTTAAATATGG - Intergenic
957089057 3:75710151-75710173 ATGGATACACAGTTTAAAAAGGG + Intronic
958515912 3:95115529-95115551 CTGTATACACATCTAAAACACGG + Intergenic
959081044 3:101801485-101801507 CTGGCTTCCCACCTTAAAGAAGG - Exonic
962272246 3:133986441-133986463 CTTGAGACACATCTTATAGAAGG + Intronic
963698814 3:148598146-148598168 CTTGTTACACACCCTAAAGGCGG + Intergenic
964100983 3:152988490-152988512 TTGGATACATACCTAGAAGAGGG - Intergenic
966295101 3:178410766-178410788 GTGGATACACACATTTGAGAGGG + Intergenic
970485869 4:16524316-16524338 CTGGATGCACATAATAAAGAAGG + Intronic
970650444 4:18171534-18171556 CTGCAGACACACCTCAAATAAGG + Intergenic
971762575 4:30786598-30786620 CTGCAAATACATCTTAAAGAAGG + Intronic
973563833 4:52163701-52163723 CTGGAGATACACTTTAAAAATGG + Intergenic
973664430 4:53142909-53142931 TTGGATATACACTTTAAACAGGG - Intronic
980444437 4:132887006-132887028 CTGGATACATTCCTTACTGAGGG - Intergenic
980973919 4:139592667-139592689 ATGGGGACACACATTAAAGATGG + Intronic
981635590 4:146875119-146875141 TTAGATACACACCTGCAAGAGGG + Intronic
981715102 4:147744863-147744885 CTGGAGACACACCATATGGATGG + Intronic
983239619 4:165217458-165217480 CTACACACACACCTTCAAGAGGG + Intronic
986263400 5:6168820-6168842 CTGGATACATACCCAGAAGAAGG - Intergenic
989037068 5:37185966-37185988 CTGAATACACATCATAAAGCAGG + Intronic
991137499 5:63199409-63199431 ATGGATAGAGAGCTTAAAGATGG - Intergenic
992578585 5:78146963-78146985 CTGGATATACTCCTAAAAGTGGG + Intronic
993867330 5:93211041-93211063 CTGGTTACACATCTTAAAGAAGG - Intergenic
994690066 5:103006810-103006832 CTGGATCCAAACAATAAAGAAGG + Exonic
995324766 5:110877552-110877574 CTGGGTACATACCCTAAAAAAGG - Intergenic
995396179 5:111689435-111689457 CTGGATAGACCCTTCAAAGATGG - Intronic
995931021 5:117444427-117444449 CTAGAAACACACCTTATATAAGG - Intergenic
999374326 5:151076287-151076309 CTGGATACCCTCCCTACAGACGG + Intronic
1002360541 5:178667202-178667224 CTAGAGACACAACTCAAAGAAGG - Intergenic
1004138678 6:12993467-12993489 CTGGATACATACCTAAGACACGG + Intronic
1010218337 6:73425452-73425474 CTGGGTACATACGTGAAAGAAGG + Exonic
1011989923 6:93501813-93501835 CTAGATACATAACTAAAAGAGGG + Intergenic
1022439049 7:30417718-30417740 CTGGATACACAACGAAATGAAGG - Intergenic
1022453849 7:30540368-30540390 CTGGATACACAACGAAATGAAGG + Intronic
1025609264 7:63062987-63063009 CTGGATACACAACGAAATGAAGG + Intergenic
1026393867 7:69930917-69930939 CTGAATACTCACCTTAAAGATGG - Intronic
1031504635 7:122566404-122566426 TTGGATATATACCTTAAAGTGGG - Intronic
1035251336 7:157599433-157599455 CTGAATACACAGTGTAAAGATGG + Intronic
1042060278 8:64809184-64809206 CTGGATACAAAACTTCAGGAAGG + Intergenic
1042913619 8:73852244-73852266 CAGCATACCCACCCTAAAGAGGG - Intronic
1045472049 8:102521243-102521265 CTGTATACACACATTAAGGCTGG - Intergenic
1046162814 8:110389429-110389451 CTGGGTACACAACATAATGAAGG - Intergenic
1052022911 9:23545023-23545045 CTGGAAACAAACCTTAAAGATGG + Intergenic
1053645644 9:40118205-40118227 TTGGATACACACCCTGAAGGTGG + Intergenic
1053760065 9:41345304-41345326 TTGGATACACACCCTGAAGGTGG - Intergenic
1054326659 9:63716106-63716128 TTGGATACACACCCTGAAGGTGG + Intergenic
1054538929 9:66257767-66257789 TTGGATACACACCCTGAAGGTGG - Intergenic
1057718227 9:97512409-97512431 CTGGGTACACACCCAAAAGAAGG + Intronic
1059378291 9:113902975-113902997 CTGGGTACACATCATAAAAAAGG - Intronic
1059507443 9:114812836-114812858 CTGGACACACACTCAAAAGAGGG - Intergenic
1059686626 9:116643781-116643803 CTGGAAACAATTCTTAAAGAAGG - Intronic
1059971252 9:119670887-119670909 CTGGGTACATACCCAAAAGATGG + Intergenic
1203488534 Un_GL000224v1:81811-81833 ATGGATACACAGTTTAAAAAGGG - Intergenic
1203501155 Un_KI270741v1:23707-23729 ATGGATACACAGTTTAAAAAGGG - Intergenic
1187025201 X:15428223-15428245 CTTGAAACACACATAAAAGAAGG + Intronic
1191933237 X:66396820-66396842 CTGGATCCACAGCTTGCAGATGG + Intergenic
1191943818 X:66507982-66508004 CTGGGTATATACCTGAAAGAAGG + Intergenic
1192671304 X:73144796-73144818 CTGGATATATACCCAAAAGAAGG - Intergenic
1193064278 X:77241847-77241869 CTGGATATATACTCTAAAGAAGG + Intergenic
1193182013 X:78469467-78469489 CTGGATACACAACAAAATGAAGG - Intergenic
1193869000 X:86773924-86773946 CTGGGTACATACCCAAAAGAAGG - Intronic
1196617179 X:117779698-117779720 CTGGATACATAACAAAAAGAAGG + Intergenic
1199017879 X:142840556-142840578 CTGGATATACACCCAAAAGAAGG - Intergenic
1199106239 X:143872548-143872570 CTAAATACACATGTTAAAGATGG + Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic