ID: 919423883

View in Genome Browser
Species Human (GRCh38)
Location 1:197405796-197405818
Sequence TCTCAGACGGGGCAGCTACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4569
Summary {0: 1, 1: 215, 2: 514, 3: 1103, 4: 2736}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919423883_919423897 24 Left 919423883 1:197405796-197405818 CCCGGTAGCTGCCCCGTCTGAGA 0: 1
1: 215
2: 514
3: 1103
4: 2736
Right 919423897 1:197405843-197405865 GCCACCCCGTCTGGGAAGTGAGG 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
919423883_919423895 16 Left 919423883 1:197405796-197405818 CCCGGTAGCTGCCCCGTCTGAGA 0: 1
1: 215
2: 514
3: 1103
4: 2736
Right 919423895 1:197405835-197405857 ACCTGGCAGCCACCCCGTCTGGG 0: 4
1: 88
2: 752
3: 3393
4: 5268
919423883_919423889 -1 Left 919423883 1:197405796-197405818 CCCGGTAGCTGCCCCGTCTGAGA 0: 1
1: 215
2: 514
3: 1103
4: 2736
Right 919423889 1:197405818-197405840 AAGTGAGGAGCCCCTCCACCTGG 0: 116
1: 1406
2: 4833
3: 6054
4: 6908
919423883_919423894 15 Left 919423883 1:197405796-197405818 CCCGGTAGCTGCCCCGTCTGAGA 0: 1
1: 215
2: 514
3: 1103
4: 2736
Right 919423894 1:197405834-197405856 CACCTGGCAGCCACCCCGTCTGG 0: 7
1: 129
2: 1039
3: 1526
4: 3222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919423883 Original CRISPR TCTCAGACGGGGCAGCTACC GGG (reversed) Intronic
Too many off-targets to display for this crispr