ID: 919424912

View in Genome Browser
Species Human (GRCh38)
Location 1:197417818-197417840
Sequence CTGAAGATGGAGACAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919424909_919424912 13 Left 919424909 1:197417782-197417804 CCAAGTTCAGTCTTCTAGGGGAC 0: 1
1: 0
2: 0
3: 6
4: 86
Right 919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG No data
919424903_919424912 27 Left 919424903 1:197417768-197417790 CCCTTTTTTTGCCACCAAGTTCA 0: 1
1: 0
2: 2
3: 21
4: 265
Right 919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG No data
919424904_919424912 26 Left 919424904 1:197417769-197417791 CCTTTTTTTGCCACCAAGTTCAG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG No data
919424901_919424912 29 Left 919424901 1:197417766-197417788 CCCCCTTTTTTTGCCACCAAGTT 0: 1
1: 0
2: 0
3: 25
4: 273
Right 919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG No data
919424902_919424912 28 Left 919424902 1:197417767-197417789 CCCCTTTTTTTGCCACCAAGTTC 0: 1
1: 0
2: 2
3: 28
4: 210
Right 919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG No data
919424906_919424912 16 Left 919424906 1:197417779-197417801 CCACCAAGTTCAGTCTTCTAGGG 0: 1
1: 0
2: 0
3: 6
4: 125
Right 919424912 1:197417818-197417840 CTGAAGATGGAGACAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919424912 Original CRISPR CTGAAGATGGAGACAATGGA AGG Intronic
No off target data available for this crispr