ID: 919428220

View in Genome Browser
Species Human (GRCh38)
Location 1:197460498-197460520
Sequence GCACAACCCTTGGCTGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919428220_919428222 -7 Left 919428220 1:197460498-197460520 CCTCTTTCAGCCAAGGGTTGTGC 0: 1
1: 0
2: 0
3: 27
4: 431
Right 919428222 1:197460514-197460536 GTTGTGCCTTCTCTGATATTAGG 0: 1
1: 0
2: 1
3: 7
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919428220 Original CRISPR GCACAACCCTTGGCTGAAAG AGG (reversed) Intronic
903203123 1:21759619-21759641 GCACAAGAGTTGGCTGGAAGGGG + Intronic
904427307 1:30437298-30437320 GCTCCAGCCGTGGCTGAAAGGGG + Intergenic
905095266 1:35464832-35464854 GCTCAAGCCATGGCTGAAAAGGG + Intronic
907019813 1:51055844-51055866 GAACAACTCTTGGGTCAAAGAGG - Intergenic
907155782 1:52332122-52332144 CTCCAACCCTTGGCTGAAACAGG - Intronic
907392224 1:54165615-54165637 GCTCCAGCCATGGCTGAAAGGGG - Intronic
907625152 1:56022417-56022439 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
907890920 1:58635806-58635828 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
908006902 1:59737011-59737033 GCTCCAGCCATGGCTGAAAGGGG + Intronic
908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG + Intergenic
909060173 1:70870220-70870242 GCACTAGCCATGGCTCAAAGGGG - Intronic
909371184 1:74885110-74885132 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
910817894 1:91311917-91311939 GCTCCAGCCATGGCTGAAAGGGG + Intronic
911009384 1:93263030-93263052 GCTCCACCCATGGCTAAAAGGGG - Intronic
911515801 1:98866691-98866713 GCAATAGCCTTGGCTAAAAGGGG - Intergenic
912907102 1:113718732-113718754 GCTCCAGCCATGGCTGAAAGGGG - Intronic
914230501 1:145761450-145761472 GCTCCAGCCATGGCTGAAAGGGG + Intronic
914444550 1:147738972-147738994 ACACAACACTGGGCTGAGAGGGG + Intergenic
915811724 1:158920322-158920344 GCTCTAGCCATGGCTGAAAGGGG + Intergenic
916286366 1:163109697-163109719 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
916467190 1:165084282-165084304 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
918079469 1:181194761-181194783 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
918718163 1:187818251-187818273 GCTCCAGCCCTGGCTGAAAGGGG - Intergenic
918734175 1:188037829-188037851 GCTCCAGCCATGGCTGAAAGAGG + Intergenic
919175141 1:194010333-194010355 GCTCCAGCCATGGCTGAAAGTGG + Intergenic
919200392 1:194348805-194348827 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
919428220 1:197460498-197460520 GCACAACCCTTGGCTGAAAGAGG - Intronic
919845464 1:201639613-201639635 GAGAAACCCTTGGCTGAAGGAGG + Intronic
920895990 1:210049812-210049834 GCTCCATCCGTGGCTGAAAGGGG - Intronic
921187040 1:212679051-212679073 GCACAGCCCTGGGGTGAAATGGG + Intergenic
923198014 1:231686486-231686508 GCTCCAGCCATGGCTGAAAGGGG - Intronic
923612995 1:235511865-235511887 GAACTGCCCTTGGCTGAAGGTGG + Intergenic
923687354 1:236162624-236162646 GCTCCAGCCATGGCTGAAAGGGG + Intronic
924684939 1:246279150-246279172 ACACACCCCTTGGCTCTAAGTGG + Intronic
1065589227 10:27249346-27249368 GCCCGACCCTTGTCTGAAGGTGG + Intergenic
1066040977 10:31547841-31547863 GCTCCAGCCTTGGCTCAAAGGGG + Intergenic
1068400331 10:56519286-56519308 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1068552961 10:58426587-58426609 ACTCCACCCATGGCTGAAAGGGG - Intergenic
1069351343 10:67530897-67530919 GCTCCAGCCGTGGCTGAAAGGGG + Intronic
1070361273 10:75691847-75691869 GTACCACCTCTGGCTGAAAGGGG - Intronic
1070395602 10:76009193-76009215 GCACCTACCTTGGCAGAAAGGGG - Intronic
1070639647 10:78158488-78158510 CCACAACCCCTGACTGATAGAGG - Intergenic
1071746106 10:88421160-88421182 GGAGGACCCTTGGCAGAAAGGGG - Intronic
1071981045 10:91004521-91004543 GCTCCAGCCATGGCTGAAAGAGG - Intergenic
1072963384 10:99951084-99951106 GCTCCAGCCATGGCTGAAAGGGG + Intronic
1073242167 10:102065944-102065966 GCACACACAGTGGCTGAAAGCGG - Exonic
1073883300 10:108008008-108008030 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1074178298 10:111033011-111033033 GCCTCAGCCTTGGCTGAAAGTGG - Intergenic
1074965820 10:118490019-118490041 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1075089400 10:119435041-119435063 GCTCCATCCGTGGCTGAAAGGGG - Intronic
1075579961 10:123610030-123610052 ACTCAGCCCTTGGCTCAAAGAGG - Intergenic
1077278894 11:1733082-1733104 GGACAAGCCTGGGCTGGAAGAGG - Exonic
1077985053 11:7342990-7343012 GCACTAGCCATGGCTAAAAGGGG - Intronic
1078430503 11:11284485-11284507 GCCCAACCCTTTCCTGAAAGGGG - Intronic
1078712966 11:13813051-13813073 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1079341065 11:19612135-19612157 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1080204917 11:29717331-29717353 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1080341749 11:31272986-31273008 GCTCCAGCCGTGGCTGAAAGGGG - Intronic
1080359021 11:31491446-31491468 GCAGAAAACTTGGCTGAAATGGG + Intronic
1080670788 11:34375033-34375055 GAACAACCGTTGGGTCAAAGAGG - Intergenic
1081008164 11:37774142-37774164 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1081175441 11:39922054-39922076 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1081479928 11:43476644-43476666 GCTCCAGCCATGGCTGAAAGAGG - Intronic
1081939417 11:46928204-46928226 GCTCCAGCCGTGGCTGAAAGGGG + Intergenic
1082268269 11:50142851-50142873 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1082287805 11:50335664-50335686 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084880707 11:72169621-72169643 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1085328939 11:75631074-75631096 GCACACCACTTGGCTCAAGGTGG + Intronic
1085941847 11:81214234-81214256 GCTCTAGCCATGGCTGAAAGGGG - Intergenic
1086154280 11:83648571-83648593 CAGCAACCCTTGGCTGAATGTGG + Intronic
1089001651 11:115056972-115056994 GGACAACCCTTGTCATAAAGTGG + Intergenic
1091811872 12:3406182-3406204 GCTCCATCCTTGGCTAAAAGGGG - Intronic
1092643057 12:10537856-10537878 GCTCCACCCGTGGCTGAAAGGGG - Intergenic
1093536675 12:20231034-20231056 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1093547147 12:20361620-20361642 GCACCACCCTGGGATGGAAGAGG - Intergenic
1093824759 12:23670441-23670463 GCACATTTATTGGCTGAAAGGGG + Intronic
1093837314 12:23850105-23850127 TCACAACCCGTTGCTGGAAGAGG - Intronic
1094379884 12:29831275-29831297 GCTCCAGCCTTGGCTCAAAGAGG - Intergenic
1094421973 12:30280432-30280454 GCTCCAGCCGTGGCTGAAAGGGG + Intergenic
1095928836 12:47606002-47606024 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1096109378 12:49020115-49020137 GCACAAGCTTGGGCAGAAAGGGG + Exonic
1097570549 12:61326232-61326254 GTTCCAGCCTTGGCTGAAAGGGG - Intergenic
1098778543 12:74654143-74654165 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1098837697 12:75441878-75441900 GCTCCAGCCGTGGCTGAAAGGGG + Intergenic
1099490752 12:83284937-83284959 GCTCTAGCCATGGCTGAAAGGGG + Intergenic
1099507743 12:83500155-83500177 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1101187019 12:102290763-102290785 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1101927294 12:108983376-108983398 GCACAACACTTGGCTGAGGATGG - Intronic
1102152635 12:110699296-110699318 GCCCACCCCTTGGCAGGAAGAGG - Intronic
1102211744 12:111132239-111132261 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1102620974 12:114194178-114194200 ACACACCCCTAGGCTGAAAGGGG + Intergenic
1102794700 12:115678816-115678838 GCTCCACTCGTGGCTGAAAGGGG + Intergenic
1103330484 12:120150617-120150639 GCAACACCCTTAGCTGAGAGAGG - Intronic
1103944665 12:124519370-124519392 GCCCAACTCTTGGCTGCTAGGGG - Intronic
1106048160 13:26165145-26165167 GCCCCAGCCATGGCTGAAAGGGG + Intronic
1108419456 13:50233807-50233829 GCTCCAGCCTTGGCTGAAAAAGG + Intronic
1108465382 13:50709811-50709833 GCACATTCCCTGTCTGAAAGTGG + Intronic
1108603676 13:52016557-52016579 GCTCCAGCCGTGGCTGAAAGGGG + Intronic
1108768370 13:53663427-53663449 GCTCCAGCCTTGGCTAAAAGGGG + Intergenic
1109098221 13:58144778-58144800 GCACTAGCCGTGGCTGAAAGGGG + Intergenic
1109285995 13:60409038-60409060 ACTCCAGCCTTGGCTGAAAGGGG + Intronic
1109346962 13:61125986-61126008 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1109480425 13:62945323-62945345 GCTCCAACCATGGCTGAAAGGGG - Intergenic
1109823903 13:67692505-67692527 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1112055255 13:95684768-95684790 GCTCCAGCCATGGCTGAAAGGGG + Intronic
1112180025 13:97069333-97069355 CCACAACCCTCAGCAGAAAGAGG + Intergenic
1112392876 13:99001413-99001435 TCACTACCCATGGCAGAAAGAGG - Intronic
1112583461 13:100696136-100696158 GCAGGACACTTGGCTGTAAGAGG - Intergenic
1112737475 13:102437497-102437519 ACACAACCCTTGGCTGTCTGGGG - Intergenic
1114380493 14:22198550-22198572 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1115132672 14:30072722-30072744 GCACCAGCCATGGCTAAAAGGGG + Intronic
1115298480 14:31857237-31857259 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1115316440 14:32029685-32029707 GGGCAACCCTTGGCCAAAAGAGG - Intergenic
1115820295 14:37206250-37206272 ACGCCAGCCTTGGCTGAAAGGGG + Intronic
1115822362 14:37225530-37225552 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1115990043 14:39141759-39141781 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1116122409 14:40737335-40737357 GCTCTAGCCTTGGCTAAAAGGGG + Intergenic
1116164149 14:41311809-41311831 GCTCCAGCCATGGCTGAAAGTGG + Intergenic
1116387368 14:44348199-44348221 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1118383703 14:65238222-65238244 GAACACCCCTTGACTGAAGGCGG + Intergenic
1118460063 14:65979486-65979508 GCTCCAGCCTTGGCTGAAAGGGG + Intronic
1120132564 14:80824133-80824155 GCTCCAGCCGTGGCTGAAAGGGG - Intronic
1121082375 14:91118740-91118762 GGAATGCCCTTGGCTGAAAGGGG + Intronic
1124171382 15:27376644-27376666 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1125225388 15:37389771-37389793 GCTCCAGCCATGGCTGAAAGAGG - Intergenic
1125233467 15:37484229-37484251 GCTCCAGCCATGGCTGAAAGAGG - Intergenic
1125279252 15:38026800-38026822 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1126411461 15:48376860-48376882 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1126487349 15:49196367-49196389 AAACAACTCTTGGGTGAAAGGGG - Intronic
1127123910 15:55794020-55794042 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1127576278 15:60295374-60295396 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
1128177110 15:65565588-65565610 GCTCCAGCCTTGGCTGAGAGGGG - Intronic
1128410095 15:67387994-67388016 GCAAAGCCCTTGGCTAAATGTGG - Intronic
1130841264 15:87703386-87703408 GCACATCCCTTGGCTGTGACAGG - Intergenic
1132122783 15:99192437-99192459 GCTCCAGCCTTGGCTGAAAGGGG + Intronic
1135138984 16:19905829-19905851 CCACACCCATTGGCTGAGAGTGG + Intergenic
1136408055 16:30060659-30060681 ACAGAACCCATGGCTGAGAGAGG - Intronic
1137424181 16:48363680-48363702 GGAGAACCCTAGGCTGCAAGGGG - Intronic
1138355926 16:56380251-56380273 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1138802014 16:60044596-60044618 GCAAAATGCATGGCTGAAAGTGG + Intergenic
1139113425 16:63919851-63919873 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1141037834 16:80643726-80643748 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1141095556 16:81160407-81160429 CCACCACACTTGGCTGAAAGTGG + Intergenic
1142890631 17:2940422-2940444 GCACAGCCTTTGGCTGGCAGTGG - Intronic
1142960644 17:3550436-3550458 GCACAGCCCTTGGCAGCACGAGG - Intronic
1143210867 17:5186354-5186376 GCTCTAGCCATGGCTGAAAGGGG - Intronic
1146697350 17:34919862-34919884 GCTCCAGACTTGGCTGAAAGGGG + Intergenic
1148536750 17:48445402-48445424 CCACAATCCGTGGCTGTAAGAGG - Intergenic
1149342311 17:55699469-55699491 CCACCACCCTAGGCTGAATGAGG + Intergenic
1150333258 17:64311537-64311559 TGACAACCCTTGGCTGTGAGAGG + Intergenic
1150941472 17:69698464-69698486 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1151122414 17:71807987-71808009 GCAGATCCCAAGGCTGAAAGGGG + Intergenic
1152557279 17:81059736-81059758 CCACCACGCCTGGCTGAAAGAGG + Intronic
1153262869 18:3241362-3241384 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1153426893 18:4975021-4975043 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1156243582 18:35276521-35276543 GCTCCAGCCATGGCTGAAAGGGG + Intronic
1156651094 18:39227999-39228021 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1157420851 18:47546521-47546543 GCCCAAATCTTGGCTGGAAGAGG + Intergenic
1159765210 18:72480784-72480806 GCTCCAACCATGGCTGAAAGGGG + Intergenic
1160096433 18:75877779-75877801 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1160248333 18:77178997-77179019 TCACAAACATTGACTGAAAGAGG + Intergenic
1162880967 19:13659052-13659074 GCAGAACCATTGGCTGAGGGTGG - Intergenic
1163056821 19:14726178-14726200 GCTCCAGCCTTGGCTCAAAGGGG - Intronic
1163618279 19:18342317-18342339 GAAACACCCTTGCCTGAAAGGGG + Intronic
1164561947 19:29298656-29298678 GCACCACCCTTGGGTGCAAGAGG - Intergenic
1164726592 19:30469573-30469595 CAACAACCCTTGGCTGATAGAGG + Intronic
925554407 2:5114201-5114223 GCACAAGTCATGGCTAAAAGAGG + Intergenic
926448537 2:12973605-12973627 GCTCTAGCCATGGCTGAAAGGGG - Intergenic
927100297 2:19782987-19783009 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
927461367 2:23301175-23301197 TCACAAGCCAGGGCTGAAAGAGG + Intergenic
928465563 2:31519574-31519596 GCTCCAACCATGGCTGAAAGGGG + Intergenic
928899577 2:36302930-36302952 GCCCAAGCCTTGGCTCAGAGTGG + Intergenic
929691223 2:44075638-44075660 GCGCAACCCTTGGATGGGAGTGG + Intergenic
930503719 2:52255852-52255874 GCTCCAGCCATGGCTGAAAGAGG - Intergenic
931569389 2:63652295-63652317 GCACAACCTCTGGGTGAAGGTGG + Intronic
932318036 2:70799174-70799196 GCTCCAGCCATGGCTGAAAGAGG - Intergenic
932428311 2:71657731-71657753 GCTCCAACCGTGGCTGAAAGGGG - Intronic
932935698 2:76098638-76098660 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
932976199 2:76602525-76602547 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
933008270 2:77023183-77023205 ACTCCAGCCTTGGCTGAAAGGGG - Intronic
933418793 2:82022472-82022494 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
934106931 2:88703539-88703561 ACTCCACCCCTGGCTGAAAGGGG - Intronic
934151445 2:89151310-89151332 GCTCAACCATGGGATGAAAGTGG + Intergenic
934215813 2:90030596-90030618 GCTCAACCATGGGATGAAAGTGG - Intergenic
934891949 2:98078325-98078347 GCTCAAGCCATGGCTCAAAGGGG - Intergenic
934940358 2:98497095-98497117 GCTCTAGCCGTGGCTGAAAGGGG + Intronic
937589047 2:123591639-123591661 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
938016471 2:127871518-127871540 GCACAGCCCCTGGCTGGAAACGG + Intronic
938849999 2:135250609-135250631 GCTCCAGCCATGGCTGAAAGGGG + Intronic
939752446 2:146064183-146064205 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
940317097 2:152336600-152336622 GCACAAGCCTCGGCTGGGAGGGG - Intronic
940451590 2:153844367-153844389 GCTCCAGCCTTGGCTTAAAGGGG - Intergenic
941424081 2:165320712-165320734 GCTCCAGCCATGGCTGAAAGGGG - Intronic
941535999 2:166722987-166723009 GCTCAAGCTGTGGCTGAAAGGGG - Intergenic
941803618 2:169688042-169688064 GCTCCAGCCATGGCTGAAAGGGG - Intronic
942054266 2:172167920-172167942 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
943205320 2:184886741-184886763 GCTCCAGCCATGGCTGAAAGGGG - Intronic
943565323 2:189509784-189509806 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
943944704 2:194044524-194044546 ACTCCACCCATGGCTGAAAGGGG + Intergenic
945324925 2:208471431-208471453 GCTCCAGCCATGGCTGAAAGGGG + Intronic
945709465 2:213278036-213278058 GCTCTAGCCGTGGCTGAAAGGGG + Intergenic
947701999 2:232242377-232242399 GCAAAGGCCTGGGCTGAAAGGGG + Intronic
947904111 2:233747277-233747299 GCCCAGCCCTGGGCTGAGAGTGG + Intronic
948585795 2:239018966-239018988 GCACAGCCCATGGTGGAAAGGGG - Intergenic
948731553 2:239967007-239967029 ACACAGCCCTAGGCTGGAAGAGG - Intronic
1169198854 20:3697870-3697892 TCACAACCCTTTGCTGGAAGAGG - Exonic
1169766402 20:9152435-9152457 GCTCCAGCCATGGCTGAAAGGGG + Intronic
1170403377 20:16011338-16011360 CCACACCGTTTGGCTGAAAGTGG + Intronic
1170721582 20:18885141-18885163 GAACAACCATTGGGTCAAAGAGG + Intergenic
1170750361 20:19139676-19139698 GCTCCAGCCTTGGCTAAAAGGGG - Intergenic
1170877126 20:20260775-20260797 GAAAAAGCCTTGGCGGAAAGTGG - Intronic
1170878760 20:20275872-20275894 GCATTTTCCTTGGCTGAAAGAGG - Intronic
1170994986 20:21345838-21345860 CAACAACTCTTAGCTGAAAGAGG + Intronic
1171118731 20:22549688-22549710 GCCCCAGCCATGGCTGAAAGGGG - Intergenic
1173675870 20:44835248-44835270 GTCCAAGGCTTGGCTGAAAGAGG + Intergenic
1174677431 20:52371944-52371966 GCCAAGCCCTTGGCTGAACGGGG - Intergenic
1174872435 20:54195624-54195646 GGGCAACCCTTGGCTGAATGGGG + Intergenic
1175195393 20:57239829-57239851 ACTCAAGCCATGGCTGAAAGGGG - Intronic
1176689066 21:9881972-9881994 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1177139677 21:17344625-17344647 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1177204865 21:17998715-17998737 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1177334644 21:19707669-19707691 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1177598476 21:23279175-23279197 GCATAAAGCTTAGCTGAAAGGGG - Intergenic
1177839265 21:26218162-26218184 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1178029285 21:28505875-28505897 GCTCCAGCCTTGGCTCAAAGGGG - Intergenic
1179527910 21:41995840-41995862 GCTCTAGCCATGGCTGAAAGGGG + Intronic
1180138378 21:45875934-45875956 GCACAGCCATTGTCTGCAAGTGG - Intronic
1181369035 22:22401804-22401826 GAGCATCCCTTGGCAGAAAGGGG + Intergenic
1181762490 22:25067780-25067802 TGACACCCCTTGGCTGACAGGGG - Intronic
1183409060 22:37644486-37644508 GCACCAACCTTGGCAGAGAGAGG + Intronic
1183719917 22:39556888-39556910 CCACAGCCCTTGGGTGAGAGAGG + Intergenic
1184311911 22:43651271-43651293 GCTCCAGCCATGGCTGAAAGGGG + Intronic
950700711 3:14743819-14743841 GCTCCAGCCATGGCTGAAAGGGG - Intronic
950800724 3:15550149-15550171 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
952012598 3:28917451-28917473 TCACAACACATGGCTGAAGGAGG + Intergenic
952739701 3:36723603-36723625 GCTCCAGCCATGGCTGAAAGGGG + Intronic
953607592 3:44421649-44421671 GCACACTCCTGGGCTGAAATGGG + Intergenic
954591550 3:51787803-51787825 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
954759584 3:52864362-52864384 GCTCCAGCCATGGCTGAAAGGGG - Intronic
955768767 3:62370182-62370204 GCAAAACCCTTTGCCGCAAGTGG + Exonic
956336906 3:68174980-68175002 GCTCCAGCCATGGCTGAAAGGGG + Intronic
956348883 3:68312093-68312115 GCTCCAGCCATGGCTGAAAGGGG - Intronic
956551186 3:70461544-70461566 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
958149384 3:89670692-89670714 GCTCTAGCCATGGCTGAAAGGGG + Intergenic
958638909 3:96779721-96779743 GCTCCACCTGTGGCTGAAAGGGG + Intergenic
958841440 3:99209838-99209860 GCTCCAGCCTTGGCTCAAAGGGG - Intergenic
959172050 3:102855261-102855283 GCTCTACCCAAGGCTGAAAGGGG - Intergenic
959624317 3:108432673-108432695 GCTCCAGCCATGGCTGAAAGGGG + Intronic
959872194 3:111341295-111341317 GCTCCAGCCATGGCTGAAAGGGG + Intronic
960021798 3:112963955-112963977 GCTCCAGCCATGGCTGAAAGGGG + Intronic
960496718 3:118383993-118384015 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
960953490 3:123014680-123014702 GCACATACGTTGGCTGACAGAGG + Intronic
961035651 3:123639727-123639749 GCACATCCCCTGGCTCACAGTGG + Intronic
961047711 3:123720881-123720903 ACACATCCCCTGGCTCAAAGGGG - Intronic
961257771 3:125571604-125571626 GCTCCAGCCATGGCTGAAAGGGG + Intronic
961789382 3:129364904-129364926 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
962057324 3:131886203-131886225 GCTCCAGCCGTGGCTGAAAGGGG + Intronic
962440210 3:135406440-135406462 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
962589308 3:136872753-136872775 GCTCCAGCCGTGGCTGAAAGGGG + Intronic
962752095 3:138441045-138441067 GCTCTATCCTTGGCTGGAAGTGG + Intronic
962769938 3:138602777-138602799 GCTCCAGCCATGGCTGAAAGAGG + Intergenic
962946283 3:140173787-140173809 GCTCCAGCCATGGCTGAAAGGGG - Intronic
963572503 3:147015645-147015667 GCTCAAGCCGTGGCTGGAAGGGG + Intergenic
963803358 3:149698813-149698835 GCTCCAGCCTTGGCTCAAAGGGG - Intronic
964836144 3:160940522-160940544 ACTCCAGCCTTGGCTGAAAGGGG + Intronic
965013446 3:163126222-163126244 GCTCCAACCATGGCTGAAAGGGG - Intergenic
965198636 3:165629458-165629480 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
965458205 3:168930059-168930081 GCTCCAGCCGTGGCTGAAAGGGG - Intergenic
965854341 3:173070105-173070127 CCACTACACCTGGCTGAAAGTGG - Intronic
965968932 3:174529781-174529803 GCTCTAGCCGTGGCTGAAAGGGG - Intronic
966123411 3:176548125-176548147 GCTCCAGCCGTGGCTGAAAGGGG - Intergenic
966299410 3:178461871-178461893 GCTCTAACCATGGCTGAAAGGGG + Intronic
966665055 3:182463202-182463224 GCTCCACTCATGGCTGAAAGGGG + Intergenic
966733356 3:183168727-183168749 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
966741965 3:183242465-183242487 GCTCCAGCCATGGCTGAAAGGGG + Intronic
967450010 3:189613282-189613304 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
967513683 3:190341452-190341474 GCTCCAGCCATGGCTGAAAGGGG - Intronic
968749709 4:2381964-2381986 GCTCCAGCCATGGCTGAAAGGGG + Intronic
969194611 4:5550852-5550874 GCTCCAGCCATGGCTGAAAGGGG + Intronic
970426919 4:15954182-15954204 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
971778826 4:31004220-31004242 GCACAAAACTTAGCAGAAAGCGG - Intronic
972014477 4:34226366-34226388 GCTCCAGCCATGGCTGAAAGAGG + Intergenic
972301216 4:37787364-37787386 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
972744552 4:41920795-41920817 GCTCTAGCCATGGCTGAAAGGGG + Intergenic
974013016 4:56624608-56624630 GCTCCAGCCTTGGCTGAAAAGGG + Intergenic
974145098 4:57937104-57937126 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
975216485 4:71761707-71761729 GCTCCAACCATGGCTGAAAGGGG + Intronic
975307325 4:72865253-72865275 GCTCTAGCCATGGCTGAAAGGGG + Intergenic
975393969 4:73853634-73853656 GCACAACCTCTGTCTGAGAGAGG + Intronic
975663362 4:76709193-76709215 GCACAGGCCATGGCTGAGAGGGG - Intronic
976003591 4:80401426-80401448 GCTCCAGCCATGGCTGAAAGGGG + Intronic
976017933 4:80581897-80581919 ACACAAACCTTCCCTGAAAGGGG + Intronic
976082109 4:81367331-81367353 GCAGAGCCCTTGGTTCAAAGTGG - Intergenic
976798223 4:88958351-88958373 GCTCCACCCCTGGCTCAAAGGGG + Intronic
976875630 4:89850464-89850486 GCTCCAGCCATGGCTGAAAGAGG - Intergenic
977070315 4:92376835-92376857 ACTCCATCCTTGGCTGAAAGGGG - Intronic
977973046 4:103233032-103233054 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
977996524 4:103502511-103502533 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
980126671 4:128781045-128781067 GCACAAGGATTGACTGAAAGAGG + Intergenic
980201317 4:129658962-129658984 GCTCCATCCATGGCTGAAAGGGG - Intergenic
980352448 4:131699790-131699812 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
980396583 4:132223417-132223439 GCTCAAGCCATGGCTAAAAGAGG + Intergenic
981655648 4:147109933-147109955 GCAAAACCCTTCTCTGAAACTGG - Intergenic
982192920 4:152876817-152876839 GCTCCAGCCATGGCTGAAAGGGG + Intronic
982608137 4:157539366-157539388 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
982666711 4:158273792-158273814 GAAGAACCCAAGGCTGAAAGAGG - Intergenic
982868225 4:160544199-160544221 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
983713940 4:170754452-170754474 GCTCCAGCCTTGGCTAAAAGTGG + Intergenic
984415970 4:179459026-179459048 GCTCCAGCCATGGCTGAAAGAGG + Intergenic
984592815 4:181635688-181635710 GCATCACCCTAGGTTGAAAGCGG - Intergenic
986081128 5:4395217-4395239 GCTCTAGCCATGGCTGAAAGGGG - Intergenic
986246558 5:6012330-6012352 GCACTAGCCATGGCTGAAAGGGG - Intergenic
986473635 5:8101065-8101087 GCAGAAACTTAGGCTGAAAGGGG + Intergenic
986756775 5:10844076-10844098 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
987792108 5:22581297-22581319 GCTCCAGCCATGGCTGAAAGGGG + Intronic
987894361 5:23925717-23925739 GTTCCAGCCTTGGCTGAAAGGGG - Intergenic
988199939 5:28054824-28054846 ACTCAAGCCTTGGCTTAAAGGGG - Intergenic
988379013 5:30477255-30477277 GCTCCAGCCTTGGCTGACAGAGG - Intergenic
988668954 5:33360454-33360476 GCTCCAGCCATGGCTGAAAGAGG - Intergenic
988770463 5:34427692-34427714 GCTCCACCCATGGCTAAAAGGGG - Intergenic
989308152 5:39981196-39981218 GCTCCAGCCTTGGCTCAAAGGGG + Intergenic
990821339 5:59844015-59844037 TCACCACCCTTGGCTGAAGCTGG + Intronic
991104946 5:62833049-62833071 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
992025790 5:72667421-72667443 GCAGAACCCTTGGCAAAAAATGG - Intergenic
992380213 5:76229121-76229143 GCATAAACTTTGGGTGAAAGTGG + Intronic
993309678 5:86313777-86313799 GCAGCAGCCATGGCTGAAAGGGG + Intergenic
993723995 5:91347960-91347982 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
993801769 5:92351460-92351482 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
994271528 5:97783006-97783028 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
994524184 5:100882722-100882744 GCTCCAGCCATGGCTGAAAGGGG + Intronic
994614942 5:102092514-102092536 GCTCCAACCATGGCTGAAAGGGG - Intergenic
994831219 5:104786027-104786049 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
994900447 5:105762853-105762875 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
995220357 5:109641242-109641264 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
995476134 5:112550147-112550169 GCCCAGCCCTTGGCTGGAGGTGG - Intergenic
996030942 5:118703343-118703365 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
996222800 5:120953720-120953742 GCTCCAGCCTTGGCTGAAAGGGG + Intergenic
996617379 5:125457877-125457899 GCTCCAGCCTTGGCTGAAAGTGG + Intergenic
996641614 5:125761655-125761677 GCTCTAGCCATGGCTGAAAGGGG + Intergenic
996967317 5:129321324-129321346 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
997081690 5:130746910-130746932 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
997762620 5:136464089-136464111 GCACAACCCTTGACACAGAGAGG - Intergenic
998144645 5:139720228-139720250 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
999571601 5:152925659-152925681 GCTCTAGCCTTGGCTAAAAGGGG + Intergenic
1000751126 5:165097713-165097735 GCACCAGCCGTGGCTGAAAGGGG - Intergenic
1001181678 5:169526332-169526354 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1001365911 5:171139749-171139771 GCACAATAGTAGGCTGAAAGTGG - Intronic
1004592787 6:17069876-17069898 GCTCCAGCCTTGGCTGAAAGGGG + Intergenic
1005783398 6:29217529-29217551 GCTCCATCCTTGGCTAAAAGAGG + Intergenic
1009289512 6:61866386-61866408 GCTCCAACCATGGCTGAAAGGGG - Intronic
1011041134 6:83031814-83031836 GCACTAGCCATGGCTAAAAGGGG + Intronic
1011835055 6:91421366-91421388 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1012045164 6:94263953-94263975 GCTCCAGCCTTGGCTAAAAGGGG - Intergenic
1012509700 6:99989087-99989109 GCACTTCCAATGGCTGAAAGAGG + Intronic
1012690778 6:102308310-102308332 GCTCTAGCCATGGCTGAAAGGGG - Intergenic
1013149035 6:107426212-107426234 GCTCCAGCCATGGCTGAAAGGGG + Intronic
1013354553 6:109335504-109335526 GCACACCCCTGGCCTGGAAGTGG + Intergenic
1013549218 6:111190721-111190743 GCACCAGCCATGGCTAAAAGGGG - Intronic
1014406980 6:121064594-121064616 GCTCTACCCATGGCTGAAAGGGG + Intergenic
1014730981 6:125031106-125031128 GCTCCAGCCATGGCTGAAAGAGG - Intronic
1014857165 6:126416626-126416648 GCTCCATCCATGGCTGAAAGGGG + Intergenic
1016326933 6:142913555-142913577 CCACAAGCCTTGGAAGAAAGAGG + Intronic
1017587070 6:155938234-155938256 GCACAGCCATTTGCTAAAAGAGG + Intergenic
1018489690 6:164279441-164279463 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1018826514 6:167411519-167411541 GCAGAACATGTGGCTGAAAGGGG - Intergenic
1019002265 6:168764078-168764100 GCTCAAGTCTTGGCTCAAAGGGG - Intergenic
1019098682 6:169609532-169609554 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1019150441 6:170001917-170001939 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1020455967 7:8374162-8374184 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1020936590 7:14473250-14473272 GCACCATCCATGGCTGAAAGGGG + Intronic
1021036858 7:15810072-15810094 GCTCCAGCCTTGGCTGAAAGGGG - Intergenic
1021598609 7:22342226-22342248 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1021646765 7:22796534-22796556 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1022549689 7:31227253-31227275 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1026120144 7:67529640-67529662 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1026532548 7:71212203-71212225 ACTCCAGCCTTGGCTGAAAGGGG + Intronic
1027167420 7:75845209-75845231 GGAATGCCCTTGGCTGAAAGAGG + Intronic
1027764890 7:82327270-82327292 GGGCAACCTTTGGCTGCAAGGGG - Intronic
1028814636 7:95130240-95130262 GTTCCAGCCTTGGCTGAAAGGGG + Intronic
1030784296 7:113641043-113641065 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1031145713 7:117995007-117995029 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1031290479 7:119928323-119928345 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1031652046 7:124303353-124303375 GCTCCAGCCTTGGCTAAAAGGGG + Intergenic
1031795983 7:126175195-126175217 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1032318255 7:130861080-130861102 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1033515208 7:142098491-142098513 GCAATCCCCTTGGATGAAAGGGG - Intronic
1033760009 7:144427653-144427675 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1034020131 7:147633156-147633178 GCGCCAGCCTTGGCTAAAAGGGG + Intronic
1034211610 7:149368466-149368488 GCAGAACTCTTGGCTAAAACTGG - Intergenic
1037205993 8:16320746-16320768 GCTCTAGCCATGGCTGAAAGGGG + Intronic
1038139008 8:24822448-24822470 GCTCCAGCCATGGCTGAAAGTGG + Intergenic
1039657293 8:39423577-39423599 GCTCTAGCCATGGCTGAAAGGGG - Intergenic
1041437989 8:57863057-57863079 GCCCTAGCCATGGCTGAAAGCGG + Intergenic
1041901598 8:62988577-62988599 GCTCCAGCCTTGGCTAAAAGGGG - Intronic
1042432821 8:68727766-68727788 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1043510491 8:80945969-80945991 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1044784684 8:95781580-95781602 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1045940091 8:107728624-107728646 GCTCAAGCCATGGCTGAAAGGGG - Intergenic
1047426872 8:124754542-124754564 GCAAAGCACATGGCTGAAAGTGG - Intergenic
1047865856 8:129023669-129023691 GCTCCAGCCGTGGCTGAAAGGGG + Intergenic
1047869928 8:129071410-129071432 GCTCCACCTTTGGCTAAAAGAGG + Intergenic
1048478936 8:134769929-134769951 GCTCCAACCGTGGCTGAAAGGGG - Intergenic
1048839345 8:138551336-138551358 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1050086540 9:1972133-1972155 GCACCAGCCATGGCTAAAAGGGG + Intergenic
1050255596 9:3789288-3789310 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1050468427 9:5958480-5958502 CCACCACACTTGGCTTAAAGTGG - Intronic
1050905078 9:10993747-10993769 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1050996885 9:12231929-12231951 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1051573143 9:18583263-18583285 GCTCCAGCCATGGCTGAAAGGGG + Intronic
1051619498 9:19036532-19036554 GCTCCAGCCATGGCTGAAAGGGG + Intronic
1052595924 9:30558397-30558419 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1053384193 9:37673811-37673833 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1053780262 9:41599923-41599945 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1053874574 9:42530003-42530025 GCTCTAGCCTTGGCTAAAAGGGG - Intergenic
1054168204 9:61810080-61810102 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1054267760 9:62936752-62936774 GCTCTAGCCTTGGCTAAAAGGGG + Intergenic
1054669324 9:67770738-67770760 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1055264102 9:74475798-74475820 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1056133599 9:83609026-83609048 GCTCCAACCATGGCTGAAAGAGG + Intergenic
1058230327 9:102417154-102417176 GCTCCAGCCGTGGCTGAAAGGGG + Intergenic
1058283695 9:103150266-103150288 GCTCCAGCCATGGCTGAAAGAGG + Intergenic
1059986268 9:119823551-119823573 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1060382614 9:123190828-123190850 ACACATCCCTTTGCTAAAAGAGG + Intronic
1060653640 9:125352491-125352513 GCTCTAGCCATGGCTGAAAGGGG - Intronic
1061621141 9:131812050-131812072 GCACAAGGCTTGGCTCATAGAGG + Intergenic
1186742591 X:12534110-12534132 GCGCCAGCCTTGGCTGAAAGGGG + Intronic
1186797672 X:13062436-13062458 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1186992421 X:15084435-15084457 GCTCCAGCTTTGGCTGAAAGGGG + Intergenic
1187639676 X:21274285-21274307 GCGCCAGCCTTGGCTAAAAGGGG - Intergenic
1188014704 X:25095559-25095581 GAACAACCACTGGGTGAAAGAGG - Intergenic
1188662369 X:32775593-32775615 GCTCCAGCCTTGGCTAAAAGGGG - Intronic
1188748240 X:33873447-33873469 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1189637218 X:43023723-43023745 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1192162448 X:68798658-68798680 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1192697898 X:73437576-73437598 GCTCCAGCCTTGGCTTAAAGGGG - Intergenic
1192705609 X:73526604-73526626 GCTCCAGCCTTGGCTCAAAGGGG + Intergenic
1193438970 X:81515502-81515524 GCTCCAGCCTTGGCTGAAAGTGG + Intergenic
1193759198 X:85443363-85443385 GCTCCAGCCATGGCTGAAAGGGG - Intergenic
1193807989 X:86016481-86016503 GCTCCAGCCTTGGCTGAAAGGGG + Intronic
1194256901 X:91646069-91646091 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1194264511 X:91738425-91738447 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1195050105 X:101089097-101089119 GTAAAACCTTGGGCTGAAAGGGG - Intronic
1196548743 X:116996473-116996495 GCTCAAGCCATGGCTAAAAGTGG - Intergenic
1196558659 X:117121167-117121189 GCTCCAGCCTTTGCTGAAAGGGG - Intergenic
1197160588 X:123318096-123318118 GCTCCAGCCATGGCTGAAAGGGG - Intronic
1197341006 X:125266417-125266439 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1197431899 X:126376914-126376936 GCTCCAACCATGGCTGAAAGGGG - Intergenic
1197910963 X:131482316-131482338 GCTCTAGCCATGGCTGAAAGGGG + Intergenic
1197975651 X:132163320-132163342 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1198734598 X:139772129-139772151 GCTCTAGCCATGGCTGAAAGGGG + Intronic
1198913416 X:141638637-141638659 GCTCCAGCCTTGGCTAAAAGGGG - Intronic
1199357158 X:146875693-146875715 GCTCAAGCCATGGCTAAAAGGGG + Intergenic
1199776133 X:151013483-151013505 GCTCCAGCCTTGGCTAAAAGGGG - Intergenic
1199820792 X:151443514-151443536 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1200575620 Y:4885336-4885358 GCTCCAGCCATGGCTGAAAGGGG + Intergenic
1201495363 Y:14586987-14587009 GCACGACCCTTGGCTGGTGGTGG - Intronic
1201978668 Y:19882335-19882357 GCTCCAACCATGGCTGAAAGGGG - Intergenic