ID: 919429139

View in Genome Browser
Species Human (GRCh38)
Location 1:197471304-197471326
Sequence CAGGGTTTGAAGTCTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919429139_919429144 6 Left 919429139 1:197471304-197471326 CCAGCAAGAGACTTCAAACCCTG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 919429144 1:197471333-197471355 GCAGTCTTACAGCCCTTGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 108
919429139_919429143 5 Left 919429139 1:197471304-197471326 CCAGCAAGAGACTTCAAACCCTG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 919429143 1:197471332-197471354 TGCAGTCTTACAGCCCTTGGAGG 0: 1
1: 0
2: 1
3: 7
4: 102
919429139_919429142 2 Left 919429139 1:197471304-197471326 CCAGCAAGAGACTTCAAACCCTG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 919429142 1:197471329-197471351 AACTGCAGTCTTACAGCCCTTGG 0: 1
1: 0
2: 2
3: 13
4: 262
919429139_919429145 7 Left 919429139 1:197471304-197471326 CCAGCAAGAGACTTCAAACCCTG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 919429145 1:197471334-197471356 CAGTCTTACAGCCCTTGGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 116
919429139_919429146 8 Left 919429139 1:197471304-197471326 CCAGCAAGAGACTTCAAACCCTG 0: 1
1: 0
2: 1
3: 9
4: 112
Right 919429146 1:197471335-197471357 AGTCTTACAGCCCTTGGAGGGGG 0: 1
1: 0
2: 0
3: 37
4: 850

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919429139 Original CRISPR CAGGGTTTGAAGTCTCTTGC TGG (reversed) Intronic
902904545 1:19546023-19546045 CAAGGTTTCAGGTATCTTGCTGG - Intergenic
909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG + Intergenic
909193932 1:72592380-72592402 CAGGGTTTGATGGCTCCTTCTGG + Intergenic
911889476 1:103348926-103348948 CAAAGTATGAAGTGTCTTGCAGG + Intergenic
915786973 1:158624120-158624142 CAGGGGTAGAAGTCTACTGCAGG + Intronic
916451699 1:164927073-164927095 CAGGTTCTGAACTCTCTTCCAGG - Intergenic
919429139 1:197471304-197471326 CAGGGTTTGAAGTCTCTTGCTGG - Intronic
921957312 1:220998104-220998126 CAGGTTTTGATGTGTCTGGCAGG + Intergenic
1063373164 10:5534744-5534766 CAGCGTTTAGAGTCTCTGGCAGG - Intergenic
1066367429 10:34791120-34791142 CAGGTTTTGAATGCTCTTACTGG - Intronic
1068276444 10:54804984-54805006 CAGTATTTTAATTCTCTTGCTGG - Intronic
1068657762 10:59592325-59592347 CTGGGATTGAAATCTGTTGCTGG - Intergenic
1069063423 10:63917568-63917590 AAGTGTTTGAATTCTCTTGAGGG + Intergenic
1070556717 10:77533628-77533650 CAGAGTTTGGTGACTCTTGCCGG - Intronic
1072113809 10:92348827-92348849 TAGGGTGTGATGTCTCTGGCTGG - Intronic
1073038226 10:100579251-100579273 CAGAGTTTGAAGCCTACTGCTGG + Intergenic
1074061173 10:109967194-109967216 CAGGATTTGGGGTCTTTTGCTGG - Intergenic
1075085386 10:119411138-119411160 CATGCCTTGAAGTCTCTTCCTGG + Intronic
1075555762 10:123430675-123430697 TTGGGTTGGCAGTCTCTTGCGGG + Intergenic
1076638416 10:131898503-131898525 CAGGTTTTCAAGTGTCTTCCTGG + Intergenic
1076730912 10:132438472-132438494 CAGGCCCTGAAGTCTGTTGCAGG - Intergenic
1081965413 11:47166311-47166333 CAGGGTGTCAAGTCTGTGGCTGG - Exonic
1084181729 11:67450316-67450338 CAGACTTTGAAGTCCCCTGCAGG + Intergenic
1084702660 11:70797481-70797503 CTGGCTTTGCAGTCTCTAGCAGG - Intronic
1086439397 11:86813214-86813236 CTGGGCTTGAAGCATCTTGCTGG - Intronic
1088171143 11:106998167-106998189 CAAGTTTTGATGTCTTTTGCTGG - Intronic
1088438832 11:109845669-109845691 CAGGGTTTGATGTCCCCAGCTGG - Intergenic
1093723345 12:22472476-22472498 GATGGTTTAAAGTCTCCTGCAGG - Intronic
1097538538 12:60905262-60905284 CAGGGCTTGAATTCTTTTACTGG + Intergenic
1098195874 12:68001747-68001769 CATGGTTTGAAATCTCTAGGTGG + Intergenic
1100303094 12:93325874-93325896 CAGCGTTTGTAGTCTCTTAGCGG - Intergenic
1100772382 12:97937704-97937726 CAGGGTCTGAAGTCTATAACAGG - Intergenic
1101082908 12:101207633-101207655 AAGGGTTTGAAGAATCTGGCAGG - Intronic
1112974961 13:105305768-105305790 CAAGGTTTGAATTCTGGTGCCGG - Intergenic
1118129068 14:62941893-62941915 CATGGTGTGCAGTCTCTTCCTGG + Intronic
1118869387 14:69728275-69728297 CTTGGTTTGAAGTATCTTGTAGG + Intronic
1119554472 14:75542637-75542659 AAGGGTTTGACTTCCCTTGCAGG - Intronic
1120905886 14:89620962-89620984 CAGAGTTTGAAGTCTTCTGCCGG - Intergenic
1124838734 15:33221733-33221755 CAGGATTTCAAGTTTCTTCCTGG - Intergenic
1125906281 15:43395815-43395837 CAGAGATGGAAGGCTCTTGCAGG + Intronic
1126369308 15:47928976-47928998 CAGGATTTGGAGTTTCTTGTAGG - Intergenic
1126828840 15:52578540-52578562 CAGTTTTTCAAGTCTCTTCCAGG - Intergenic
1127894690 15:63286464-63286486 CTGGGTTTGAAGTGTCTTGTTGG + Intronic
1129170344 15:73803761-73803783 AAGGGTTTGCAGTCTGCTGCTGG - Intergenic
1130429513 15:83832321-83832343 CAGGGTTTAAAGGGGCTTGCAGG + Intronic
1132763613 16:1523601-1523623 CAGGGTCTGACGTCTCATCCAGG + Exonic
1138527876 16:57619503-57619525 CAGGGATGGAAGCCTCTTCCAGG - Intronic
1140509095 16:75494740-75494762 CCGGTTTGGAAGTGTCTTGCTGG - Intronic
1140514924 16:75534928-75534950 CTGGTTTGGAAGTGTCTTGCTGG - Intronic
1145899607 17:28481794-28481816 GAGGGATGGAAGTCTCTTCCAGG - Intronic
1146162469 17:30567299-30567321 CAGGGTTTGTAGTCTAATGGAGG - Intergenic
1146502425 17:33375437-33375459 CAGGCTATGAAGATTCTTGCAGG + Intronic
1148583476 17:48760034-48760056 CAGGGTTTTTAGTTTCTTCCAGG + Intergenic
1150185737 17:63179562-63179584 CAGTGTTTGAAGTTTATTTCTGG - Intronic
1153770142 18:8408715-8408737 CAGGCTTTGAAGTGTCTGGGGGG - Intergenic
1156302936 18:35851289-35851311 CAGTGTTTTAAGTCTTCTGCAGG - Intergenic
1156414328 18:36871917-36871939 GAGAGCTTGAACTCTCTTGCAGG + Intronic
1156693519 18:39737319-39737341 AAGAGTCTGAAGGCTCTTGCAGG + Intergenic
1159449603 18:68583534-68583556 CAGGGTATGAAGGCTTTTGGTGG - Intergenic
1167913994 19:52725541-52725563 TTGGGTTTGAAGTCGCTTGGAGG - Intronic
925862902 2:8197695-8197717 CAGGTTTTGAAGCCTCTTGCAGG + Intergenic
925932577 2:8721542-8721564 TAGGGTTTGGAGTCTCTTCAAGG - Intergenic
926822619 2:16869865-16869887 CAGAGTGTGAATGCTCTTGCTGG - Intergenic
927152477 2:20203938-20203960 CAGGGGTTGAGGTCTCATGGTGG + Exonic
928786776 2:34897068-34897090 CAGGCTTTGAAGTATATTTCAGG + Intergenic
929959135 2:46483390-46483412 CAGGGTTTGGTGTCTCTTGGAGG - Intronic
933968935 2:87454220-87454242 CAGGCTTTGAACTCTCCTGGGGG + Intergenic
935342297 2:102068850-102068872 CAAGGTTTACAGTCTCTGGCTGG + Intronic
935566723 2:104616839-104616861 CAGGGTTTCAATTCTTTTTCAGG + Intergenic
935848193 2:107189079-107189101 CAGGGCCTGAACTCTCTTTCAGG - Intergenic
936141510 2:109946019-109946041 TAGGGTTTGAATTCTCTTAGAGG + Intergenic
936178199 2:110243967-110243989 TAGGGTTTGAATTCTCTTAGAGG + Intergenic
936203184 2:110425464-110425486 TAGGGTTTGAATTCTCTTAGAGG - Intronic
936324857 2:111496287-111496309 CAGGCTTTGAACTCTCCTGGGGG - Intergenic
937538627 2:122922451-122922473 CTGGGTTTGAAGTCTGTTTATGG + Intergenic
937690809 2:124752875-124752897 CAGCCTTTGACGCCTCTTGCTGG - Intronic
942568381 2:177288890-177288912 CTGGGTTTATAGTCTCTTTCTGG + Intronic
1172854488 20:37991462-37991484 CAGGGTTTGAAGGCACCAGCTGG + Intronic
1175593968 20:60215682-60215704 CAGCATTTGATGTCTCTTCCAGG - Intergenic
1176216391 20:63949970-63949992 CGGGGTTGGAAGGCTCCTGCTGG - Intronic
1181117188 22:20639512-20639534 CAAGGCTTGATGTCACTTGCTGG + Intergenic
1182780391 22:32862845-32862867 CAGGGTTCGAGATCTCTTGTTGG - Exonic
1183244335 22:36682186-36682208 CAGGGCTTGAAGGCCCTTGCAGG + Intronic
950527710 3:13534178-13534200 CAGGGCAGGAGGTCTCTTGCTGG - Intergenic
954694117 3:52411244-52411266 CAAGGTTTTATGTCTATTGCTGG + Exonic
957877975 3:86174126-86174148 CAGTGTTTTAAGTCTCCTGGAGG + Intergenic
959916264 3:111819936-111819958 CATGGTATGAAATGTCTTGCAGG + Intronic
960547011 3:118926926-118926948 CATGGCTTGAAGTTTCATGCTGG + Intronic
961665833 3:128492752-128492774 CAGGGTTTCCGGTCTCTGGCAGG + Intronic
965691416 3:171360902-171360924 AAGGGTTTGAAGTCTCTGGGTGG - Intronic
968213883 3:196871467-196871489 GAAGGTTAGAAGTCACTTGCTGG + Intronic
969486664 4:7476037-7476059 CAGGGGCTGAAGGCTCTCGCTGG + Intronic
970503164 4:16699363-16699385 CAGGGAATGAAGTCTGTAGCAGG - Intronic
978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG + Intergenic
982577121 4:157127393-157127415 CAGGGTTTGCACTCTGTTGTTGG + Intronic
985169048 4:187128627-187128649 CAGGGTTAGCACTCTCTGGCTGG - Intergenic
987942866 5:24564851-24564873 CAGGTTTTGAAACCTCATGCTGG + Intronic
988291406 5:29292957-29292979 TATGTTTTGAATTCTCTTGCTGG - Intergenic
998388120 5:141769881-141769903 CCTGGTGTGGAGTCTCTTGCTGG + Intergenic
1000839958 5:166205923-166205945 CAGGTTCTGAATTCTTTTGCAGG + Intergenic
1001229560 5:169974512-169974534 CAGGATGTGAAGTCTCTGACAGG - Intronic
1001444727 5:171774534-171774556 GTGGGTTTGAAGTTCCTTGCGGG + Exonic
1014617700 6:123624325-123624347 CAGGATTTGAAGTGTCTTGTTGG - Intronic
1015862601 6:137696505-137696527 CAAGGTTTGAGGTTTCTTCCTGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1016496054 6:144663074-144663096 CAAGGCTAGGAGTCTCTTGCAGG + Intronic
1023828218 7:44024069-44024091 CAGGGCTTGAAGTCTCTGGGAGG + Intergenic
1023832985 7:44050923-44050945 CACGGTTTGATGTCTGTTGTTGG + Intronic
1024280911 7:47718880-47718902 CTGGGTTGGAAGTCACTGGCAGG - Intronic
1025957723 7:66195673-66195695 AAGGGCTAGAAGACTCTTGCAGG - Intergenic
1029756519 7:102577515-102577537 CAGGGCTTGAAGTCTCTGGGAGG + Intronic
1029774461 7:102676584-102676606 CAGGGCTTGAAGTCTCTGGGAGG + Intergenic
1031826116 7:126567794-126567816 CAGGGTTGATAGTCTCTTTCTGG - Intronic
1036044670 8:5126572-5126594 CAGGGCTTGAAGCCTTCTGCAGG - Intergenic
1041427993 8:57744915-57744937 CAAGGTTTAAAGTCACTGGCAGG + Intergenic
1042235932 8:66613218-66613240 CAGGGCTCGCAGTCTCCTGCAGG + Exonic
1044891133 8:96836869-96836891 CAGATTCTGAAGTCCCTTGCTGG - Intronic
1049324577 8:142015329-142015351 AAGTCTTTGGAGTCTCTTGCTGG + Intergenic
1051513343 9:17904478-17904500 CATGGTTTGAAGTATGTGGCTGG + Intergenic
1057130494 9:92651163-92651185 CTGGGTCTGCAGTCTCTGGCTGG - Intronic
1059904712 9:118969848-118969870 CAGGGTTTGAATTCAGTTTCAGG - Intergenic
1192615622 X:72618565-72618587 GAGGGTTTGAAGTCACATGATGG + Intronic
1199554373 X:149090522-149090544 CAGGGTGTGAAGTGTCTTCAAGG + Intergenic