ID: 919429754

View in Genome Browser
Species Human (GRCh38)
Location 1:197477850-197477872
Sequence AGTCTCTCCATTGCAGGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919429754_919429761 9 Left 919429754 1:197477850-197477872 CCACCCCCTGCAATGGAGAGACT 0: 1
1: 0
2: 1
3: 14
4: 163
Right 919429761 1:197477882-197477904 GCATTGTGTCCCTTCGAGATGGG 0: 1
1: 0
2: 0
3: 4
4: 48
919429754_919429762 10 Left 919429754 1:197477850-197477872 CCACCCCCTGCAATGGAGAGACT 0: 1
1: 0
2: 1
3: 14
4: 163
Right 919429762 1:197477883-197477905 CATTGTGTCCCTTCGAGATGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
919429754_919429760 8 Left 919429754 1:197477850-197477872 CCACCCCCTGCAATGGAGAGACT 0: 1
1: 0
2: 1
3: 14
4: 163
Right 919429760 1:197477881-197477903 AGCATTGTGTCCCTTCGAGATGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919429754 Original CRISPR AGTCTCTCCATTGCAGGGGG TGG (reversed) Exonic
900156904 1:1206812-1206834 GGTGTCCCCAGTGCAGGGGGCGG + Intergenic
901004363 1:6164743-6164765 AGGCTCTCAAATGCAGGGGAGGG + Intronic
902280457 1:15370737-15370759 AGTCTCACCATTGCATGCTGCGG - Intronic
902951151 1:19883466-19883488 AGGATCCCCATTGCAGGGGCAGG + Intronic
904462037 1:30686010-30686032 GGTCTTTCCATTGTTGGGGGCGG - Intergenic
905081445 1:35324615-35324637 AGTCTCTCCCTTGAATGGGGTGG + Intronic
905548419 1:38817855-38817877 AGTCTCTCCCTAGCTGGGAGAGG - Intergenic
905902091 1:41588458-41588480 AGGCTCTCCTTGGCAGGTGGTGG + Intronic
906273789 1:44501194-44501216 ATTTTCTACATTGCTGGGGGTGG + Intronic
906289206 1:44609135-44609157 AGTCTTTCCATTGCAGGGGTTGG + Intronic
906295548 1:44646940-44646962 AGTCCCTCCAGGGCATGGGGTGG - Intronic
907390599 1:54155688-54155710 AGTCTATCAAGTGCAGGGTGAGG - Intronic
909011823 1:70343577-70343599 AGTCTCTCTATTGCCCAGGGTGG + Intronic
912429135 1:109620006-109620028 AGCCTCTCGATTGCAGGGTTGGG + Intronic
914518090 1:148391148-148391170 AGTTTTTCCATGGAAGGGGGTGG + Intergenic
915357971 1:155267949-155267971 AGTCTCTCCCGTGTAGGGGTTGG + Intronic
916843918 1:168629022-168629044 AGTCTCTGAATTCAAGGGGGAGG + Intergenic
917804613 1:178602217-178602239 AGTCCCTGCAATGCAAGGGGGGG + Intergenic
918434763 1:184500143-184500165 AGGCTCTCTATAGCAGGAGGGGG - Intronic
919429754 1:197477850-197477872 AGTCTCTCCATTGCAGGGGGTGG - Exonic
920056921 1:203199549-203199571 AGGCTCTGCTTTTCAGGGGGAGG - Intergenic
920365856 1:205448113-205448135 AGTCTCTTCATTCCAGAGTGAGG + Intronic
920600685 1:207321429-207321451 ACTCTCTCCACTGCTGGGTGGGG - Intergenic
924802493 1:247337651-247337673 AGGCTCTGCAGTGCAGGTGGGGG + Intergenic
924938661 1:248793898-248793920 AGGCTTCCCACTGCAGGGGGTGG + Intergenic
1064037443 10:11926253-11926275 AGGGTCTCCAGTGCAGGGAGAGG - Intronic
1065344613 10:24737040-24737062 AGTCTTTCTAATTCAGGGGGAGG - Intergenic
1066984469 10:42453112-42453134 AGTCTCTACACTGCTGGGAGAGG - Intergenic
1072789605 10:98308707-98308729 CGGCTCTTCATGGCAGGGGGAGG - Intergenic
1072968963 10:100000201-100000223 AGTTTCCACATTGCAGGGGAGGG + Intronic
1076379625 10:130015999-130016021 AGTCTCTCCCACGCAGAGGGAGG - Intergenic
1079111520 11:17607804-17607826 AGGCTCTCCTTTGCAGGGTGAGG - Intronic
1080443343 11:32315008-32315030 CATCTCTACATTGCAGGGGAGGG + Intergenic
1084742633 11:71149627-71149649 AATTTCTCCTCTGCAGGGGGAGG + Intronic
1086443294 11:86849270-86849292 AGTCTCCCAATTGCAGCTGGAGG - Intronic
1088917315 11:114237472-114237494 CGTCTCTCCATAGCAGAGGACGG + Intronic
1089742582 11:120594945-120594967 AGTGTCTCCCTCGCTGGGGGTGG - Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1091299494 11:134498413-134498435 AGGCTCTTCACTGCAGAGGGAGG - Intergenic
1094513893 12:31117226-31117248 AGGATCCCCATTGCAGGGCGGGG + Intergenic
1094514194 12:31118224-31118246 AGGACCCCCATTGCAGGGGGGGG + Intergenic
1094515025 12:31120943-31120965 AGGACCCCCATTGCAGGGGGGGG + Intergenic
1096252000 12:50039549-50039571 TGTCTCTCCAGAGCTGGGGGAGG + Intergenic
1100871716 12:98916763-98916785 AGTTTCTTCATTGCAGAGTGAGG + Intronic
1101138066 12:101766258-101766280 AGTCGCTATATTGCAGGAGGTGG - Exonic
1101928044 12:108989599-108989621 ATGCTCTCCACTGCTGGGGGTGG - Intronic
1103926391 12:124425763-124425785 AGCCTCTCCATTCCAGCTGGAGG + Intronic
1104071870 12:125352959-125352981 AGTCACTCCACTGGAAGGGGTGG + Intronic
1107021398 13:35756147-35756169 AGTCTCTGCATCCCAGTGGGGGG - Intergenic
1109172261 13:59111665-59111687 AGTCTGTACATTCCTGGGGGAGG - Intergenic
1109545889 13:63838964-63838986 AGGACCCCCATTGCAGGGGGGGG + Intergenic
1114802686 14:25796332-25796354 CGTCTCCCCCTTGCAGGGGGTGG + Intergenic
1115922213 14:38388293-38388315 ATACTCTCCATTCCAGGAGGAGG + Intergenic
1118010207 14:61603003-61603025 AGTCTGTGTATAGCAGGGGGAGG + Intronic
1124150674 15:27175202-27175224 AGGCTCCACATTGCAGGTGGAGG - Intronic
1128530073 15:68438945-68438967 AGTCTCTCCATTGGCAGAGGAGG + Intergenic
1129660607 15:77550882-77550904 CGTCTCTCCAGAGCAGGGTGGGG + Intergenic
1132998332 16:2835909-2835931 AGTCCCACCATTGTCGGGGGAGG + Intronic
1135836483 16:25830433-25830455 GTTCTCTCCTCTGCAGGGGGAGG + Intronic
1136556745 16:31011414-31011436 CGGCGCCCCATTGCAGGGGGTGG - Intergenic
1137060377 16:35787841-35787863 AGTTGCTTCTTTGCAGGGGGAGG + Intergenic
1137061498 16:35794866-35794888 AGTGGCTCCTTTGCAGGGGAAGG + Intergenic
1137827806 16:51514669-51514691 AGTCTCTGCATTGTATGGGTAGG + Intergenic
1141452200 16:84112170-84112192 AGTCTCTCCATTGCCCAGGCTGG - Intronic
1141493857 16:84393328-84393350 AGTCTCCCAAATGCAGGGCGAGG + Intronic
1141700360 16:85639448-85639470 AATCTGTCCAGCGCAGGGGGTGG - Intronic
1142708529 17:1710721-1710743 AGCCTCTGCCTTGCAGGGTGTGG - Intergenic
1143905526 17:10206025-10206047 AAGCTCTCCATTGCAGAGAGGGG - Intergenic
1145009330 17:19358638-19358660 GGTCTCTCCACTGCACAGGGTGG + Intronic
1145728915 17:27157808-27157830 AGTGGCTTCTTTGCAGGGGGAGG + Intergenic
1145782474 17:27572056-27572078 ATTCTCTCCAGTGGAGGGTGAGG - Intronic
1147659604 17:42110601-42110623 AGGCTCTCCATGGCAGGGTCTGG - Intronic
1148160500 17:45447266-45447288 AGGTTGTCCATTGCTGGGGGAGG - Intronic
1148271398 17:46264794-46264816 TGTCTCTACATTTCAGGGTGTGG + Intergenic
1150380005 17:64712955-64712977 AGTCTCTCTGTTGCTGGCGGGGG - Intergenic
1150391789 17:64794146-64794168 AGGTTGTCCATTGCGGGGGGAGG - Intergenic
1150776723 17:68087200-68087222 AGTCTCTCTGTTGCTGGCGGGGG + Intergenic
1151221455 17:72615910-72615932 AGTGTCTCCAGAGTAGGGGGAGG - Intergenic
1151285146 17:73105481-73105503 AGTCTCCACATTGCCAGGGGAGG - Intergenic
1151399290 17:73845171-73845193 AGCTTCTCCATTGCAGAGGCAGG + Intergenic
1152225688 17:79091573-79091595 AGTCTCCCTAATGCAGGGAGGGG + Intronic
1152901964 17:82947442-82947464 CCTCACTCCATTGCAGGGGTGGG - Intronic
1155315550 18:24567380-24567402 ACTGTCTCCACTGCAGGGGATGG - Intergenic
1159406513 18:68009702-68009724 ATTTTCACCATTGCAGTGGGAGG - Intergenic
1162182981 19:8883288-8883310 ATTCTCTCGATTGATGGGGGAGG + Intronic
1164468096 19:28505217-28505239 AGTCTGTCCAGGGCAGGAGGAGG - Intergenic
1164718832 19:30416464-30416486 AGGCTCTCCATGGCATGGGAGGG + Intronic
926496330 2:13592787-13592809 AGGCACTCCATTGGCGGGGGGGG + Intergenic
926757254 2:16245964-16245986 AGCCTCTCCAGGGAAGGGGGAGG + Intergenic
927313695 2:21658042-21658064 AGACTGTCCAGTGCATGGGGTGG + Intergenic
928077109 2:28274947-28274969 AGTAGCTCCACTGCAGGGGGTGG + Intronic
932750912 2:74371170-74371192 GGCCTCTCCTTTGCAGGAGGAGG - Exonic
934614425 2:95762520-95762542 AGTTTCTTCATTGCCTGGGGTGG + Intergenic
934646480 2:96061979-96062001 AGTTTCTTCATTGCCTGGGGTGG - Intergenic
934771816 2:96912314-96912336 ACTCTTTCCACTGCTGGGGGTGG - Intronic
938176463 2:129135805-129135827 TATCTCTCCATTGGAGTGGGAGG + Intergenic
941042151 2:160634699-160634721 AGTCTGACCATTGGAGGGAGGGG - Intergenic
947142536 2:227032534-227032556 ACTCTCTCCATTGTAGAGGTGGG - Intronic
948509772 2:238456019-238456041 AGTCTCTCCAGGGCTGGGGATGG - Intergenic
948850732 2:240704143-240704165 AGTCTGTCCAGTGCAGCGGGTGG + Intergenic
1168844634 20:935475-935497 GGTCTCTACCATGCAGGGGGTGG + Intergenic
1170880857 20:20295753-20295775 ACTCACACCATTGCATGGGGTGG - Intronic
1171171397 20:23018410-23018432 AGTCCCTACCTTGCAGGGGAAGG + Intergenic
1171445049 20:25196839-25196861 ACTCTCTCCAAGGCAAGGGGAGG - Intronic
1172197693 20:33103297-33103319 AATCGCTCCATTTCAGGGTGGGG + Intronic
1172362783 20:34325791-34325813 AGTGTGGCCATTGCAGTGGGTGG - Intergenic
1174300777 20:49580479-49580501 AGTCTGTCCACTGTAGGGGGAGG - Intergenic
1175115184 20:56677019-56677041 AGCTTCTCCATTGCTCGGGGAGG + Intergenic
1183098415 22:35568453-35568475 AGTCTCTCCACTGCCCAGGGCGG + Intergenic
1183151000 22:36037412-36037434 TGTGTCTACATTGCAGGGGCTGG - Intergenic
1183599234 22:38830460-38830482 AGTGTCCCCATTTCAGGGGCAGG + Intronic
949117082 3:339594-339616 AGGCTTAACATTGCAGGGGGCGG - Intronic
954576976 3:51681724-51681746 AGTGTCTGCATGGCAGAGGGAGG - Intronic
956440434 3:69275624-69275646 GGTCTCTACATTGCCCGGGGTGG + Intronic
956748100 3:72325426-72325448 AGTCTATCCATTGCATGGACTGG - Intergenic
956787911 3:72657787-72657809 AACCGCTCCACTGCAGGGGGTGG - Intergenic
961064882 3:123866864-123866886 AGTTTCCCCATTGAAGGGTGAGG - Intronic
961444513 3:126972846-126972868 AGGCTCTCCATGGCTGGGGCTGG + Intergenic
961457352 3:127030820-127030842 AGCCTCCCCATTGCAGTGTGGGG + Intronic
963042676 3:141081001-141081023 AGTTTCTCCACTGCAAGGAGGGG + Intronic
963865068 3:150351427-150351449 AGCCTCACCATTGCTGGGTGGGG + Intergenic
965685217 3:171295382-171295404 AGTCTCTGCATTTCTTGGGGAGG - Intronic
966435640 3:179880994-179881016 AGTCTCTCCAGTGCAGTGCCAGG - Intronic
967787554 3:193513865-193513887 AGTCACTCCAGTGCAGGGAGTGG + Intronic
970559673 4:17270210-17270232 ATTCTTTCCATTGTAGTGGGTGG + Intergenic
971234000 4:24825192-24825214 AGTCTCTCAAATGCAGGGACAGG - Intronic
973772787 4:54222085-54222107 AGTCTCTCCAGGGCATGGTGAGG + Intronic
990019965 5:51114257-51114279 GTTCTCTCCATTGAAGGGGTTGG + Intergenic
990097523 5:52135519-52135541 TTTCTCTCCATTCCAGAGGGTGG + Intergenic
990947237 5:61262110-61262132 GGCTTCTCCATTGCAGGGGTGGG + Intergenic
992589508 5:78278938-78278960 AGTTTTTCCATGGAAGGGGGTGG - Intronic
993354319 5:86887094-86887116 AGTTTCTCCTGTGCAGGGGCTGG + Intergenic
994670757 5:102758816-102758838 AGTTTCTCCAGGGTAGGGGGAGG + Intronic
996321543 5:122222553-122222575 AGTCTCTGGATTCCAGGGGGTGG - Intergenic
997845523 5:137282719-137282741 AGTCTCTTCATGGCAGGGACCGG - Intronic
1000952323 5:167499464-167499486 AGTTGCTCCATTGTAGGGTGGGG + Intronic
1001534574 5:172489658-172489680 TTTCTCTCCATTTCAGGGGTTGG + Intergenic
1003103266 6:3193697-3193719 AGTCTCTCCAGTTCGGGGGTAGG + Intergenic
1006672522 6:35738231-35738253 AGTCTGGCCATTCCAGGGGCAGG - Intronic
1007775544 6:44222666-44222688 AGTCCCTCCAAGGGAGGGGGAGG - Intronic
1009615694 6:66002642-66002664 AGTTTTTCCATTGCCTGGGGTGG - Intergenic
1012624890 6:101393417-101393439 AGTCTCCCCATCCCAGGAGGCGG + Intergenic
1013053265 6:106558274-106558296 AGTTTCTCCATTGCATAGGAAGG - Intronic
1013411466 6:109887757-109887779 AGTCCCTCCCTCCCAGGGGGAGG - Intergenic
1014824165 6:126029393-126029415 AGTGGTTACATTGCAGGGGGAGG - Intronic
1015660412 6:135567923-135567945 AGTCCCTCCCTTGAAGGGAGTGG + Intergenic
1017051924 6:150401440-150401462 AGACCCTCCATTCCAAGGGGCGG - Exonic
1019729478 7:2622430-2622452 TGTGGCTCCATTCCAGGGGGAGG - Intergenic
1019943883 7:4311676-4311698 TGTCTCTGCATTGCTGGGGGCGG - Intergenic
1023018180 7:35986274-35986296 AGCCTCTCAAGTGCAGGGGTGGG + Intergenic
1023853795 7:44167670-44167692 TGACTCTCAATTGCAGGGAGGGG + Intronic
1024563378 7:50662695-50662717 AGTCTCTCCCTTGCAGCATGTGG + Intronic
1024699146 7:51888050-51888072 AATCTCTGCAATGCAGGGGGTGG + Intergenic
1025811450 7:64878253-64878275 AGTGGCTCCATTGCAGGGAAAGG - Intronic
1026432996 7:70366833-70366855 AGTATGTCCAATACAGGGGGAGG + Intronic
1027725901 7:81805836-81805858 ATCCTCTCTATTGCAGCGGGAGG - Intergenic
1029549661 7:101231008-101231030 GATCTCTCCATTCCAGGGGAGGG + Intergenic
1030019983 7:105264019-105264041 AGTCTTTGCATTGCAACGGGGGG + Intronic
1033872480 7:145772181-145772203 AGACTTTCCATTGCAGGGGAAGG - Intergenic
1036206698 8:6810981-6811003 AGTCTCTCCTATGCATGGGTGGG + Exonic
1039617681 8:38969488-38969510 ACTCTATCCTGTGCAGGGGGCGG + Exonic
1039804202 8:40984768-40984790 ATTCTCTCCATTCCCGGGGGTGG - Intergenic
1045426973 8:102077116-102077138 TGTCTCTCCTTTGCAGAGGCTGG + Intronic
1046521346 8:115330598-115330620 AGGCGCTCCAGAGCAGGGGGTGG + Intergenic
1049732301 8:144184940-144184962 ACCCTCTCCAGTGCAGGGGGTGG - Intronic
1053145643 9:35710408-35710430 AGTGTCTCCACTTCAGGAGGAGG + Intronic
1053437334 9:38084793-38084815 TTTCTCTCCCTTGCAGGGGTGGG + Intergenic
1056074890 9:83028313-83028335 AATCTCTCCATGTCAGGGGCAGG - Intronic
1056475661 9:86948677-86948699 AGTCTCTCCACGGAAAGGGGAGG - Intergenic
1056708840 9:88973508-88973530 TGTGTCTGCATTGCAGGGGCCGG - Intergenic
1056972239 9:91215739-91215761 CCTCTCTACATTGCAGTGGGAGG + Intronic
1058056624 9:100455258-100455280 AGTACCTCCATTGCAGCTGGTGG + Intronic
1060254015 9:122010583-122010605 TGTCCCTCCATTGCAGAGGATGG - Intronic
1061089539 9:128419308-128419330 ACTATCTCCACTGCAAGGGGAGG - Intronic
1061936396 9:133860010-133860032 AGTCTATCCATGGCCGGGCGAGG + Intronic
1192509505 X:71713574-71713596 AGTCTCTCGGTTGGAGGTGGGGG - Intergenic
1192517192 X:71767979-71768001 AGTCTCTCGGTTGGAGGTGGGGG + Intergenic
1194426483 X:93745177-93745199 AGTTCCTTCATTGCAGGGGGAGG + Intergenic
1201145978 Y:11066065-11066087 AATTTCTCCTCTGCAGGGGGAGG + Intergenic