ID: 919431889

View in Genome Browser
Species Human (GRCh38)
Location 1:197504133-197504155
Sequence ACTTTGCCTGCCACCATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 385}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919431889_919431893 25 Left 919431889 1:197504133-197504155 CCTTTGATGGTGGCAGGCAAAGT 0: 1
1: 0
2: 6
3: 38
4: 385
Right 919431893 1:197504181-197504203 AGCGGAATCTTAGGCTTGCAGGG 0: 1
1: 0
2: 0
3: 6
4: 68
919431889_919431892 24 Left 919431889 1:197504133-197504155 CCTTTGATGGTGGCAGGCAAAGT 0: 1
1: 0
2: 6
3: 38
4: 385
Right 919431892 1:197504180-197504202 TAGCGGAATCTTAGGCTTGCAGG 0: 1
1: 0
2: 1
3: 0
4: 41
919431889_919431891 16 Left 919431889 1:197504133-197504155 CCTTTGATGGTGGCAGGCAAAGT 0: 1
1: 0
2: 6
3: 38
4: 385
Right 919431891 1:197504172-197504194 AACAAAAATAGCGGAATCTTAGG 0: 1
1: 0
2: 1
3: 13
4: 219
919431889_919431890 7 Left 919431889 1:197504133-197504155 CCTTTGATGGTGGCAGGCAAAGT 0: 1
1: 0
2: 6
3: 38
4: 385
Right 919431890 1:197504163-197504185 ATCAAAATCAACAAAAATAGCGG 0: 1
1: 0
2: 5
3: 90
4: 1211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919431889 Original CRISPR ACTTTGCCTGCCACCATCAA AGG (reversed) Intergenic
900433978 1:2618306-2618328 CCTTTACCTTCCACCATGAATGG + Intronic
903573055 1:24320532-24320554 CCTTTTCCTGCCACCCTCAGAGG + Intronic
904889091 1:33764455-33764477 GCTCTGCCTGCCACTAGCAAAGG + Intronic
905330855 1:37195710-37195732 TCTTTGCCTTCTACCATGAATGG + Intergenic
906307733 1:44730873-44730895 TCTTTGCCTGCCGGCTTCAAGGG - Intergenic
907405518 1:54251405-54251427 ACTCTGCCTGCCATCTGCAAGGG + Intronic
908786813 1:67742981-67743003 ATTTTGTATGCCACCATCAGAGG - Intronic
909828777 1:80159175-80159197 AGTTTGGCTGCCACCTTCAATGG - Intergenic
910072740 1:83238643-83238665 CCTTTGCCTTCCACAATCAGTGG + Intergenic
911754472 1:101537080-101537102 CCTTTGCCTTCCACCATGATTGG + Intergenic
911820385 1:102411971-102411993 ACTTTGCCTGGATCCATTAAAGG - Intergenic
911832104 1:102563591-102563613 ACTTTGCCTAAATCCATCAAAGG - Intergenic
912195376 1:107391642-107391664 CCTTTGCCTTCCACCATGAGTGG - Intronic
912609344 1:111027720-111027742 TCTTTGCTTGCCGCCATCCATGG + Intergenic
913083276 1:115409787-115409809 ACTTAGCCTGCAACCACAAAGGG + Intergenic
914726153 1:150329416-150329438 ACTTTGCTTGCCACAGTAAATGG - Intronic
915012824 1:152705182-152705204 CCTTTGCCTTCCACCATGAGTGG - Intergenic
915719326 1:157972733-157972755 ACTTTGCCTTCCACCATGATTGG - Intergenic
915925216 1:160012230-160012252 ACAATGCCTGCCCCCATCGAGGG + Intergenic
916682909 1:167120548-167120570 GCATTGCCTGTCACCACCAATGG + Intronic
917877083 1:179295720-179295742 ACTTTGCCTCCCAGGTTCAAGGG + Intronic
918498277 1:185163938-185163960 ACTTTGCCTGGATCCATCAGAGG + Intronic
919431889 1:197504133-197504155 ACTTTGCCTGCCACCATCAAAGG - Intergenic
919453829 1:197800739-197800761 ACTTTGCCTGCCACCACTGCAGG + Intergenic
919727979 1:200896010-200896032 TCTCTGACTGCCAGCATCAAAGG - Intronic
920607579 1:207404343-207404365 CCTTTGCCTTCCACCATGATTGG + Intergenic
921183641 1:212651910-212651932 ACAGTGCCTGCCACAATCAGGGG - Intergenic
921933903 1:220778357-220778379 CCTTTGCCTTCCACCATGATTGG - Intronic
921960399 1:221027859-221027881 CCTTTGCCTTCCACCATGAGTGG + Intergenic
922325761 1:224526829-224526851 GCTTTGCCTTCCACCATAATTGG - Intronic
922972203 1:229752146-229752168 ACTTTTCCTGAGACCATGAAGGG - Intergenic
923818740 1:237410716-237410738 ACTTTCATTGCCACCATGAAAGG - Intronic
1063006341 10:1974609-1974631 CCTTTGCCTTCCACCATGATTGG - Intergenic
1065112933 10:22457856-22457878 ACTTTGCCTGCCACCAATGTTGG + Intergenic
1065378438 10:25065489-25065511 CCTTTGCCTTCCACCATTATTGG + Intergenic
1065497034 10:26340098-26340120 CCTTTGCCTTCCACCATGACTGG + Intergenic
1065521241 10:26575443-26575465 ACTTTGCCTTCTGCCATGAATGG - Intergenic
1065526660 10:26629101-26629123 ACTTTGCCTTCTGCCATGAATGG - Intergenic
1067128529 10:43540893-43540915 CCTTTGCCTTCCAGCATCATTGG + Intergenic
1067146123 10:43695074-43695096 TCTTTGCCTGCTGCCATCCACGG + Intergenic
1068331155 10:55571222-55571244 ACTTTGCCTTTCACCATGATTGG + Intronic
1068384089 10:56300969-56300991 ATTTTGCCTGCCACAAAAAAGGG - Intergenic
1068921205 10:62486269-62486291 CCTTTGCCTGCCACCATGATAGG + Intronic
1069008923 10:63349158-63349180 CCTTTGCCTTCCACTATAAAAGG + Intronic
1069168950 10:65201170-65201192 CCTTTGCCTTCCACCATGATTGG - Intergenic
1069336773 10:67360662-67360684 TCTTTGCCTTCCACCATGATTGG - Intronic
1069352673 10:67548233-67548255 CCTTTGCCTTCCACCATGATTGG + Intronic
1069767031 10:70869994-70870016 ATTCTGGCTGCCACAATCAAAGG - Intronic
1069772822 10:70910399-70910421 CCTTTGCCTGCCATCATGACTGG - Intergenic
1070349076 10:75574997-75575019 CCTTTGCCTTCCACCATGATTGG - Intronic
1070868129 10:79722484-79722506 ACTTTGCCTTCCATCATGATTGG + Intergenic
1071053954 10:81487130-81487152 GCTTTGCCTTCCACCATTATTGG - Intergenic
1071119599 10:82262017-82262039 CCTTTGCCTTCCACCATAATTGG + Intronic
1071396141 10:85225911-85225933 CCTTTGCCTTCCACCATGATTGG - Intergenic
1071635039 10:87244685-87244707 ACTTTGCCTTCCATCATGATTGG + Intergenic
1071660202 10:87493311-87493333 ACTTTGCCTTCCATCATGATTGG - Intergenic
1072746233 10:97941083-97941105 GCTTTTCCTGCTACCATCATCGG + Intronic
1073599836 10:104835903-104835925 ACTTTCCCTGCCACGCTCACAGG - Intronic
1073676660 10:105654994-105655016 CCTTTGCCTTCCACCATGATTGG + Intergenic
1073701606 10:105934023-105934045 CCTTTGCCTTCCACCATGATTGG + Intergenic
1073701938 10:105936356-105936378 CCTTTGCCTTCCACCATTATTGG + Intergenic
1073726697 10:106240203-106240225 ACTTTGCCTGCTGCCATGACTGG - Intergenic
1074112641 10:110433420-110433442 GCTTTGCCTTCCACCATGATTGG + Intergenic
1074820941 10:117177931-117177953 CCTTTGCCTTCCACCATAATTGG - Intergenic
1075562227 10:123476392-123476414 CCTTCGCCTCCCACCATGAATGG + Intergenic
1077280170 11:1740995-1741017 ACTTTGCCCTCCACCATGACTGG + Intronic
1077399728 11:2348287-2348309 CCTTTGCCTTCCACCATGATTGG + Intergenic
1078584158 11:12566498-12566520 ACTTTGCCCAGCTCCATCAAAGG + Intergenic
1078684070 11:13510389-13510411 CCTTTGCCTTCCACCATGACTGG - Intergenic
1079140827 11:17808350-17808372 CCTTTGCCTTCCACCATGATTGG - Intronic
1079209550 11:18449119-18449141 TCTTCCCCTGCCACCATCAGAGG + Intronic
1079214795 11:18499147-18499169 ACTTTTCCTGCCACCACTATTGG - Intronic
1080236874 11:30080037-30080059 CCTTTGTCTGCCTCCATCAAAGG - Intergenic
1080301835 11:30793061-30793083 TCTTCGCCTTCCACCATCATTGG - Intergenic
1080440394 11:32288956-32288978 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1082822995 11:57557327-57557349 CCTTTGCCTTCCACCATGAGTGG + Intronic
1084067703 11:66714825-66714847 ACTCTGCCTGCCTCCCCCAATGG - Intronic
1084294103 11:68199310-68199332 ACACTCCCTGCCACCATAAATGG - Intronic
1086011190 11:82105434-82105456 TCTTTGCCTTCCACCGTCATTGG - Intergenic
1087709564 11:101533296-101533318 GCTTTGCCTTCCACCATGATTGG - Intronic
1088545504 11:110954922-110954944 CCTTTGCCTTCCACCATGATTGG - Intergenic
1089338137 11:117739712-117739734 ACTTTCCCAGCCACCACTAATGG - Intronic
1089427928 11:118395243-118395265 CCTTTGCCTCCCAGGATCAAGGG - Intronic
1090822693 11:130357869-130357891 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1090846337 11:130532861-130532883 ACTTTGCCTCCCACCACAATTGG + Intergenic
1091891793 12:4061261-4061283 ATTTTGTTTGGCACCATCAAAGG + Intergenic
1092395028 12:8118520-8118542 ACTTTGCCTTCCACCATGATTGG - Intergenic
1092824839 12:12389219-12389241 ACTTTGCCTCCCAGGTTCAAGGG + Intronic
1092966063 12:13644101-13644123 ACTTTGCCTACATCCATCAGAGG + Intronic
1093247833 12:16761977-16761999 TCTTTGCCTTCCACCATGATTGG + Intergenic
1093372024 12:18376851-18376873 CCTTTGCCTTCCACCATGATTGG + Intronic
1097238259 12:57554727-57554749 TCTTTGCCTCCCACCATGACTGG - Intronic
1097708762 12:62895782-62895804 CCTTTGCCTTCCACCATGAGTGG + Intronic
1097860986 12:64518395-64518417 TCTTTGCCTTCCACCATGACTGG - Intergenic
1099697863 12:86044289-86044311 ACTTTGGCTGGCACCATCCATGG - Intronic
1100278048 12:93090047-93090069 CCTTTGCCTTCCACCATGATTGG + Intergenic
1102448431 12:113022198-113022220 CCTTTGCCTTCCACCATAATTGG - Intergenic
1102788266 12:115621781-115621803 ACTTTGCCAGCCACCACAATTGG - Intergenic
1103322774 12:120101607-120101629 TCTTTGCCAGTGACCATCAAAGG + Intronic
1103833328 12:123798333-123798355 ACTTTGCCTTCCACCATGATTGG - Intronic
1104218869 12:126762642-126762664 TCTTTGCCTGCTGCCATCCATGG - Intergenic
1104923085 12:132301223-132301245 CCTTTGCCTGCCACCATACAGGG - Intronic
1105281950 13:18970018-18970040 ACTTTGCCTTCCGCCATGATTGG - Intergenic
1106202853 13:27556315-27556337 ACTTCCCCTGCCCCCAGCAACGG + Exonic
1106463506 13:29992993-29993015 CCTTTGCCTTCCACCATGATTGG - Intergenic
1106623820 13:31398055-31398077 ACTTTGCCTTCTACCATGATTGG + Intergenic
1107382067 13:39867539-39867561 CCTTTGCCTTCCACCATGATGGG - Intergenic
1108968650 13:56343497-56343519 TCTTTGCCTTCCACCATGATTGG + Intergenic
1109647019 13:65272270-65272292 CCTTTGCCTTCCACCATGAAAGG - Intergenic
1110276449 13:73646764-73646786 CCTTTGCCTTCTACCATGAATGG + Intergenic
1110423149 13:75335750-75335772 CCTTTGCCTTCCACCATGATTGG + Intronic
1110495388 13:76161991-76162013 CCTTTGCCTTCCACCATGATTGG - Intergenic
1110502933 13:76249940-76249962 GCTTTGCCTTCCACCATAATTGG + Intergenic
1110805189 13:79746259-79746281 ACTATGCCTAGCACCATCACAGG - Intergenic
1110924098 13:81128696-81128718 GCTTTGCCTTCCACCATGAGCGG + Intergenic
1111528550 13:89506514-89506536 CCTTTGCCTTCCACCATGATTGG + Intergenic
1112769882 13:102783491-102783513 ACTTTGCCTTCCACCATGATTGG - Intergenic
1112885190 13:104162053-104162075 TCTTTGCCTTCCACCATGATTGG - Intergenic
1114223683 14:20719363-20719385 ACTTTGCCTGTCTCTATAAATGG - Intergenic
1114378613 14:22176430-22176452 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1114598536 14:23934947-23934969 TCTTTGCCTTCCACCATGAGTGG - Intergenic
1115282724 14:31682927-31682949 CCTTTGCCTTCCACCATGAGTGG - Intronic
1115602130 14:34965481-34965503 GCTTTGCCTGTCACCATCCAAGG - Intergenic
1116526955 14:45917345-45917367 CCTTTGCCTTCTACCATGAATGG - Intergenic
1118233246 14:63974327-63974349 CCTTTGCCTTCCACTATGAATGG - Intronic
1118301613 14:64621758-64621780 CCTTTGCCTTCCACCATGATTGG + Intergenic
1120290968 14:82570082-82570104 CTTTTGCCTTCCACCATAAATGG + Intergenic
1120464071 14:84833642-84833664 CCTTTGCCTTCCACCATGATTGG - Intergenic
1121372791 14:93375629-93375651 CCTTTGCCTTCCACCATGACTGG - Intronic
1121870762 14:97404725-97404747 ACTTTTCCTGCCACCTTAAATGG + Intergenic
1121991359 14:98560746-98560768 ACTCTGCCTGCCAGGTTCAAGGG - Intergenic
1122104145 14:99438877-99438899 ACTTTGCTTTCCAACATCATAGG + Intronic
1122431868 14:101656140-101656162 ACTTTGCCTAGCTCCATCAGGGG - Intergenic
1123794264 15:23755886-23755908 AATTTGTCTTCCACCATGAATGG - Intergenic
1123808894 15:23903663-23903685 CCTTTGCCTTCCACCATGATTGG - Intergenic
1123848937 15:24334123-24334145 CCTTTGCCTTCCACCATGATTGG - Intergenic
1123867996 15:24541632-24541654 CCTTTGCCTTCCACCATGATTGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124783583 15:32658725-32658747 ACTACCCCTGCCACCATCGAGGG - Intronic
1124892107 15:33743012-33743034 ACTTTGCCTGCCAGTGTTAAAGG - Intronic
1125843081 15:42823976-42823998 GCTTTGCCTTCTACCATGAATGG - Intronic
1126447299 15:48762568-48762590 AGTTTGGCTGCCACAATCTAAGG + Exonic
1126626506 15:50690526-50690548 ACTCTGCATGCCAGAATCAAAGG - Intergenic
1127052158 15:55095831-55095853 CCTTTGCCTTCCACCATGAGTGG - Intergenic
1127256714 15:57299358-57299380 GCTGGGCCTGCCACCACCAAAGG + Intergenic
1127721786 15:61709117-61709139 CCTTTGCCTTCCACCATGATTGG - Intergenic
1128598913 15:68978743-68978765 AATTTTCCTGCCACCATAAAGGG - Intronic
1128892669 15:71344809-71344831 CCTTTGCCTGCCAGCATCTTTGG + Intronic
1129256957 15:74339118-74339140 ACTTAGACTGCTGCCATCAAGGG + Intronic
1129927250 15:79375563-79375585 ACTTTGCCTTCCACCATGAATGG - Intronic
1130815764 15:87430716-87430738 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1131463983 15:92639806-92639828 CCTTTGCCTTCCACCATGATTGG + Intronic
1131526383 15:93155980-93156002 CCTTTGCCTTCCACCATGACTGG + Intergenic
1131920044 15:97316430-97316452 ACTTTGCCTTCTACCATGAGTGG - Intergenic
1132035147 15:98477114-98477136 CCTTTGCCTTCCACCATGAATGG - Intronic
1133753536 16:8744286-8744308 CCTTTGCCTTCCACCATGATTGG - Intronic
1133866850 16:9652129-9652151 CCTTTGCCTTCCACCATGATTGG - Intergenic
1136118836 16:28115554-28115576 ACTTTGCCTGTCTCTATAAATGG - Intronic
1136423162 16:30150054-30150076 ACTCTGCCTACCAGCTTCAAGGG - Intergenic
1136619080 16:31416081-31416103 ACTTTGCTGGACACCAACAAGGG - Intronic
1138073203 16:54014445-54014467 TCTTTGCCTTCCACCATGAGTGG + Intronic
1139690513 16:68638746-68638768 ACTTTGCCTTCCACCATGATTGG - Intronic
1140248973 16:73277846-73277868 ACTTTGCCTTCCACCATGATTGG - Intergenic
1141418605 16:83897102-83897124 CCTTTGCCTTCCGCCATGAATGG - Intergenic
1141492686 16:84385183-84385205 CCTTTGCCTTCCACCATGATTGG - Intronic
1141615366 16:85206873-85206895 ACTTTGCCTGCCATAAAGAAAGG - Intergenic
1144747559 17:17626053-17626075 GCACTGCCTCCCACCATCAAAGG - Intergenic
1144751679 17:17653179-17653201 ATTTTGCCTTCCACCATGAGTGG - Intergenic
1147540968 17:41359276-41359298 CCTTTGCCTTCCACCATGATTGG - Intergenic
1147906362 17:43825632-43825654 ACTTTGCCTGCCACCTCCTCAGG + Intronic
1148018478 17:44538811-44538833 ACTTTTCCTGACCCCACCAAGGG - Intergenic
1149047559 17:52265641-52265663 GCTTTACCTGCTACCAGCAATGG + Intergenic
1149098437 17:52872873-52872895 CCTTTCCCTGGCACCATCAAAGG + Intronic
1149100110 17:52895573-52895595 ACTTTGCCTGAATCCATCACAGG + Intronic
1149372905 17:56013077-56013099 CCTTTGCCTTCTACCATGAATGG - Intergenic
1151018134 17:70580690-70580712 CCTTTGCCTTCCACCATGATTGG + Intergenic
1151248750 17:72817222-72817244 CCTTTGCCTTCCACCATGAGTGG - Intronic
1151895431 17:76977359-76977381 CCTTTGCCTTCCACCATGACTGG - Intergenic
1154183267 18:12156148-12156170 CCTTTGCCTTCCACCATAATTGG + Intergenic
1154371213 18:13764939-13764961 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1155430606 18:25752177-25752199 TCTTTGCCTTCCACCATAATTGG + Intergenic
1156068385 18:33174109-33174131 CCTTTGCCTTCCACCATGATTGG - Intronic
1159265703 18:66075303-66075325 CCTTTGCCTTCCACCATGATTGG + Intergenic
1159360631 18:67397107-67397129 ACTTTGCCTTCTACCATGATTGG + Intergenic
1160344397 18:78120961-78120983 TCTTTGCCTGCCACCATGATTGG + Intergenic
1161674563 19:5637581-5637603 CCTCTGCCTCCCAGCATCAAGGG - Intronic
1162339795 19:10085732-10085754 ACACTGCCTGCCCCTATCAAGGG + Intergenic
1163515464 19:17760490-17760512 ACTTTTTCTGCCACTCTCAATGG - Intronic
1164818619 19:31226440-31226462 TCTTTGCCTGCCACTATGTAAGG + Intergenic
1165133360 19:33647359-33647381 ACCTGGCCTGCCACCAGCATTGG - Intronic
1166017639 19:39994907-39994929 ATTTTGCCTTCCACCATGATTGG + Intronic
1166352175 19:42204481-42204503 CCTTGGCCTTCCACCATGAATGG + Intronic
925071571 2:972789-972811 ACTTTGTCTTCCACCATGATTGG + Intronic
925900828 2:8508456-8508478 CCTTTGCCTTCCACCATGATTGG + Intergenic
928488670 2:31758308-31758330 CCTTTGCCTTCCACCATGATTGG + Intergenic
928705027 2:33940387-33940409 CCTTTGCCTTCCACCAGGAATGG + Intergenic
929243236 2:39674165-39674187 ACAGTGACTGCCAACATCAACGG + Intronic
931083623 2:58804234-58804256 CCTTTGCCTGCCACCATGTGAGG - Intergenic
931406864 2:61987940-61987962 CCTGTATCTGCCACCATCAAAGG + Intronic
931652371 2:64479963-64479985 CCTCTGCCTGCCACTTTCAAGGG + Intergenic
932843088 2:75102620-75102642 ACTTTGCCTTCAAACAACAAAGG + Intronic
933311378 2:80665626-80665648 ACTTTGCCTCCCAAGTTCAAGGG - Intergenic
933799112 2:85945700-85945722 GCTTTGACTTCCACCATGAATGG - Intergenic
934570876 2:95372620-95372642 ACTGTGCCTGCTCCCAGCAAAGG - Intronic
934950577 2:98572613-98572635 TCTTTTACTGCCACCTTCAAAGG - Intronic
937428020 2:121815943-121815965 TCTTTGCCTGTCTCCGTCAAAGG + Intergenic
937534969 2:122875068-122875090 ATTTTCCCTGCCTCCCTCAAAGG + Intergenic
937543354 2:122986411-122986433 CCTTTGGCTTCCACCATCACTGG + Intergenic
938141818 2:128800652-128800674 CCTTTGCCTTCCACCATGATTGG - Intergenic
939017102 2:136915390-136915412 ATATTGCCTGCCACTATCACAGG - Intronic
941364102 2:164589481-164589503 CCTTTGCCTTCCACCATTAGTGG - Intronic
941400011 2:165019559-165019581 ACTTCGCCTTCCACCATGACTGG - Intergenic
941553888 2:166951337-166951359 TCTTTGCCTTCCACCATGACTGG - Intronic
941594265 2:167456177-167456199 CCTTTGCCTTCCACCATGATTGG - Intergenic
942417670 2:175775942-175775964 CCTTTGCCTTCCATCATCAGTGG + Intergenic
943034552 2:182726003-182726025 ACTTTGCCTGGATCCATCAGAGG - Intronic
943152076 2:184126401-184126423 GCTTTGCCTTCCACCATGAGTGG - Intergenic
943488855 2:188523679-188523701 ACTTTGCCTGGCACACTCAGAGG - Intronic
944772846 2:202932030-202932052 CCTTTGCCTTCCACCATGACTGG - Intronic
945070023 2:205980236-205980258 ACTTTGCCAGACAGCATTAAGGG + Intergenic
946264903 2:218531624-218531646 ACTTTGCCTAGCTCCATCAGAGG - Intronic
946801661 2:223423793-223423815 ACTTTGCCTTCCACCATGATTGG + Intergenic
947425799 2:229981919-229981941 TCTTTGCCTTCCACCATGACTGG - Intronic
947893571 2:233647053-233647075 TCTTTGCCTGCTGCCATCCATGG - Intronic
948799717 2:240426865-240426887 CCTTTGCCTTCCACCATGAGTGG - Intergenic
949067586 2:242002769-242002791 GCTTTGCCTTCCACCATGATTGG + Intergenic
1169322330 20:4644051-4644073 CCTTTGCCTTCCACCATGATTGG - Intergenic
1169415864 20:5415730-5415752 CCTTTGCCTTCCACCATGATCGG - Intergenic
1169553450 20:6725469-6725491 ACTTTCCATTCCTCCATCAAAGG + Intergenic
1169830032 20:9814994-9815016 TCTTTGCCTTCCACCATAAGTGG - Intronic
1170196269 20:13692715-13692737 TCTTTGCCTCCCACCATGATTGG + Intergenic
1170922513 20:20692029-20692051 CCTTTGCCTTCTACCATGAATGG + Intronic
1171076916 20:22137046-22137068 TCTTTGACTGCCACCATCAATGG - Intergenic
1171362370 20:24596978-24597000 TCTTTGCGTCCCACCAGCAAGGG - Intronic
1173399478 20:42711506-42711528 CCTTTGCCTTCCACCATGATTGG + Intronic
1173721512 20:45262230-45262252 CCTTTGCCTGTCACCTTCCATGG + Intergenic
1173912245 20:46678999-46679021 CCTTTGCCTTCCACCATGATCGG + Intronic
1174673283 20:52328688-52328710 ACTTTGCCTCAATCCATCAAAGG - Intergenic
1174701392 20:52612640-52612662 TCTTTGCCTGCTGCCATCCATGG + Intergenic
1175622530 20:60461153-60461175 CCTTTGCCTTCCACCATGATTGG + Intergenic
1176913313 21:14594964-14594986 CCTTTGCCTTCCACCATGACTGG - Intronic
1177450094 21:21255338-21255360 ACTTTGCCTCCCAGGATCTAAGG + Intronic
1177696609 21:24581123-24581145 TCTTTGCCTTCCACCATGATTGG + Intergenic
1178296853 21:31417418-31417440 CTTTTGCCTGCCACCATGTAAGG - Intronic
1179345829 21:40556590-40556612 CCTTTGCCTTCCACCATGAGTGG - Intronic
1179507753 21:41853004-41853026 ACTGTGCCAGCCACCACCAGAGG + Intronic
1180006739 21:45026154-45026176 CCATTGTCTGCCACCATCCATGG + Intergenic
1183022406 22:35037984-35038006 TTTTTGCCTGCCACCATTCACGG - Intergenic
1184151678 22:42643340-42643362 GCTTTTCCTGCCACCCTCACGGG + Intronic
1184982874 22:48106742-48106764 CCTTTGCCTTCCACCATGATTGG - Intergenic
949903057 3:8835813-8835835 ACTGTGCCTGTCGCCAACAAAGG + Intronic
949944101 3:9176662-9176684 ACTTTGACTTCCACCATGATTGG - Intronic
950832670 3:15890686-15890708 CCTTTGCCTTCCACCATGAGTGG + Intergenic
950863428 3:16170460-16170482 CCTTTGCCTTCCACCATGAATGG - Intergenic
951054463 3:18131813-18131835 ACATTGCCTCCCACCAATAAAGG + Intronic
953228740 3:41044575-41044597 AGTGTGTCTGCCACCAGCAAGGG + Intergenic
953296927 3:41728334-41728356 CCTTTGCCTTCCACCATAAGTGG - Intronic
953606907 3:44418315-44418337 TCTTTGCCTGCCGCCATGTAAGG + Intergenic
953697802 3:45173285-45173307 ACTTTCCCAGCCTCCATCACTGG - Intergenic
954589351 3:51768120-51768142 ACTTTGCCTTCCATCATGATTGG - Intergenic
955288652 3:57669877-57669899 CCTTTGCCTGCCACCATGCCTGG - Intronic
955522099 3:59784990-59785012 ACTTTGCCTTCCACCATGATTGG - Intronic
957028277 3:75209956-75209978 ACTTAGCCAGCCACCATCTTAGG - Intergenic
957978716 3:87480187-87480209 ACTTTGTCTGGGAGCATCAATGG - Intergenic
960724889 3:120660114-120660136 CCTTTGCCTTCCACCATGATTGG + Intronic
960787061 3:121385278-121385300 TCTTTGCCTTCCACCATGACTGG - Intronic
961787218 3:129354390-129354412 ACTTTTCCTCCCCCCAGCAATGG - Intergenic
962047060 3:131771572-131771594 CCTTTGTCTTCCACCATAAATGG + Intronic
962051891 3:131824965-131824987 ACTTGAACTTCCACCATCAATGG + Intronic
963261966 3:143201988-143202010 ACTTTTCCAGCCACCCTCCATGG + Intergenic
963903436 3:150754289-150754311 CCTTTGCCTTCCACCATGATTGG - Intronic
965251413 3:166348846-166348868 TCTTTGCCTGCCACCATCCATGG + Intergenic
965948085 3:174267272-174267294 TCTTTGCCTCCCACCATGAGTGG - Intronic
966206085 3:177407976-177407998 ACTTTTACTGGCATCATCAATGG + Intergenic
969278287 4:6151723-6151745 ACTTTGCCGTCCAGCTTCAATGG - Intronic
969888409 4:10237209-10237231 ACTTAGGCTGTCACTATCAAGGG - Intergenic
969913547 4:10466997-10467019 CCTTTGCCTTCCACCATGATTGG - Intergenic
969930841 4:10629299-10629321 CCTATGCCTGCCACCCTCACAGG + Intronic
970132159 4:12884205-12884227 GCTTTGCCTTCCATCATGAATGG + Intergenic
970293177 4:14599280-14599302 CCTTTGCCTGCCACCAAGAGTGG + Intergenic
970443908 4:16108486-16108508 ACTTTGCTTGCCAGCAACTAGGG - Intergenic
971499610 4:27304374-27304396 CTCTTGCCTGCCACCATGAAAGG - Intergenic
974397123 4:61351986-61352008 ACTTTGCCTGAATCCATCAGAGG - Intronic
978057193 4:104285193-104285215 ATTTTACCTGCCACCAAGAAGGG + Intergenic
978923412 4:114214995-114215017 CCTTTGCCTTCCACCATGATTGG - Intergenic
979321542 4:119330744-119330766 CCTTTGCCTTCCACCATGATCGG - Intergenic
979891034 4:126095517-126095539 GCTTTGCCTTCCACCATGACTGG - Intergenic
980663476 4:135898358-135898380 CCTTTGCCTTCCACCATGAGTGG + Intergenic
980910431 4:138989126-138989148 GCTTTGCCTTCCACCATGATTGG + Intergenic
980932764 4:139197385-139197407 TCTTTGCCTGCTGCCATCCATGG + Intergenic
981240001 4:142465886-142465908 CCTTTGCCTTCCACCATAATTGG + Intronic
981998520 4:151001261-151001283 ACCTAGGCTGCCACCATTAAAGG + Intronic
982101415 4:151971856-151971878 CCTTTGTCTTCCACCATGAATGG + Intergenic
983554707 4:169049655-169049677 TCATTGTCTGACACCATCAATGG + Intergenic
983698162 4:170558056-170558078 TCTTTGCCTTCCACCATGATTGG + Intergenic
985243005 4:187950771-187950793 CCTTTGCCTTCCACCATGATTGG - Intergenic
985712342 5:1436404-1436426 ACTTTGCCTGCCACCTCCTTGGG - Intronic
988061326 5:26174631-26174653 CCCTTGCCTGCCACCATGTAAGG + Intergenic
988593161 5:32566944-32566966 CCTTTGCCTTCCACCATGAGTGG - Intronic
988717869 5:33845818-33845840 ACTTTGCTTTCCACCATGAGTGG - Intronic
988990086 5:36662176-36662198 ACTTTTCCCGCCACCATCAGTGG + Intronic
989230977 5:39086265-39086287 ACTTAGGCTGCCATCATCGAAGG + Intergenic
989770159 5:45135319-45135341 CCTATCCCTGCCACCATGAATGG - Intergenic
990730355 5:58801775-58801797 ACTTTGTCAGCAACCAGCAAAGG + Intronic
991364418 5:65853464-65853486 CCTTTGCCTTCCACCATGATTGG + Intronic
992208365 5:74452940-74452962 GCTTTGCCTCCCACCATGAGTGG - Intergenic
992623339 5:78615056-78615078 ACTTTGACTTCCACCTACAATGG + Intronic
992879821 5:81096749-81096771 GCTTTGCCTGTCACTAGCAAAGG + Intronic
992956516 5:81915114-81915136 CCTTTGCCTTCCACCATGAGTGG - Intergenic
993003316 5:82404723-82404745 CCTTTGCCTTCCACCATGAGTGG - Intergenic
993468490 5:88277245-88277267 CCTTTGCCTTCCACCATGATTGG + Intergenic
993608237 5:90021255-90021277 ACTTTGCCTGGTACCATCAGAGG + Intergenic
995242024 5:109896123-109896145 ACTTTGCCTTCAACCATAAGTGG - Intergenic
996014432 5:118517155-118517177 TCTTTGCCTTCCACCATGACCGG - Intergenic
996322653 5:122236347-122236369 ATTTTGTCTGCCATCACCAATGG - Intergenic
996401293 5:123065935-123065957 TCTTTGCCTGCTGCCATCCATGG - Intergenic
997406084 5:133648014-133648036 TCTTTGCCTGCTGCCATCCACGG + Intergenic
997515558 5:134486778-134486800 CCTTTGCCTTCCACCATGAGAGG + Intergenic
997828179 5:137126250-137126272 TCTTTGCCTTCCACCATGAGTGG + Intronic
998442430 5:142173773-142173795 CCTTTGCCTTCCACCATGATTGG - Intergenic
998642101 5:144022608-144022630 ACTTTGCCTTCCACCATGATTGG + Intergenic
998900654 5:146849988-146850010 ACTTTACCCTCCACCTTCAAAGG - Intronic
999186467 5:149714252-149714274 ACTATGCCTCCAAGCATCAAGGG - Intergenic
999708476 5:154295158-154295180 AATTTGCCTGCCACCTTTATTGG + Intronic
1000453901 5:161424792-161424814 ACTTTGCCTGGATCCATCAAAGG - Intronic
1000767904 5:165315123-165315145 CCTTTGCCTTCCACCATGATCGG - Intergenic
1000925237 5:167185964-167185986 AATTTCCCTGCCACCACCAAAGG - Intergenic
1001019571 5:168171906-168171928 GGTGTGCCTGCCACCATCTAGGG - Intronic
1002789664 6:427867-427889 TCTTTCCCTGCCACAGTCAAAGG - Intergenic
1003681383 6:8260796-8260818 AATGTCCCTGCCTCCATCAAGGG + Intergenic
1003987137 6:11448193-11448215 CCTTTGCCTTCCACCATGAGTGG - Intergenic
1004506781 6:16253440-16253462 ACTTCGCCTTCCACCATGATTGG - Intronic
1004792165 6:19038641-19038663 CCTTTGCCTTCCACCATGATTGG + Intergenic
1004917036 6:20341772-20341794 TCTGTGCCTGGCACCATCACAGG + Intergenic
1006280222 6:33046570-33046592 TCTTTGCCTGCCACCATCCAAGG + Intergenic
1009323530 6:62320984-62321006 ATTTTGCATTCCACCAACAATGG - Intergenic
1010958949 6:82123666-82123688 ACGTGGCCTGACACCTTCAAGGG - Intergenic
1013489200 6:110628864-110628886 CCATTGCCTGCCACCATAAAAGG + Intronic
1014415404 6:121177385-121177407 CCTTTGCCTTCCACCATGATTGG + Intronic
1014587120 6:123212498-123212520 CCTTTGCCTTCCACCATGATTGG - Intergenic
1015874271 6:137807228-137807250 CCTTTGCCTTCCACCATGATTGG + Intergenic
1016683029 6:146852520-146852542 CCTTTGCCTTCCACCATGACTGG - Intergenic
1017379439 6:153811756-153811778 ACTTTGCATTCCATCATGAATGG - Intergenic
1018328288 6:162698513-162698535 ACTTTGCAAGCCACCATCCTTGG - Intronic
1018682580 6:166276095-166276117 ATATTTCCTGCCACCAACAATGG + Intergenic
1019134002 6:169897057-169897079 ACTTCGAATGCCACCATCAAAGG + Intergenic
1019911935 7:4106050-4106072 ACCTTGGCTGCCACCTTCAGTGG + Intronic
1021659898 7:22909324-22909346 CCTTTGCCTTCCACCATGACTGG + Intergenic
1022381078 7:29860475-29860497 ACTTTGCCTTCTACCATAAGTGG + Intronic
1023154106 7:37230879-37230901 ACATTCCCTGCCACCACCAAAGG + Intronic
1024316562 7:48024689-48024711 CCTTTGCCTTCCACCATGAGCGG - Intronic
1024510793 7:50203257-50203279 ATTTTTCCTGCTACCATCAAAGG - Intergenic
1026342215 7:69444402-69444424 CCTTTGCCTTCCACCATGACTGG - Intergenic
1026500381 7:70938574-70938596 TCTTTGCCTTCCACCATGATTGG + Intergenic
1026837811 7:73649884-73649906 AGCTTGCCTGCCAGCTTCAAGGG + Intergenic
1027290468 7:76703797-76703819 CCTTTGCCTTCCACAATCAGTGG + Intergenic
1027557307 7:79681765-79681787 TCTTTGCCTGCCGCCATCCACGG + Intergenic
1028170069 7:87585613-87585635 ACTTTGGCTGCCATCATCCATGG - Exonic
1028498935 7:91496528-91496550 TCTTTGCCTTCCACCATGATTGG + Intergenic
1029230655 7:99065734-99065756 ACCTTACCAGCCCCCATCAAAGG + Intronic
1030602222 7:111605504-111605526 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1030607676 7:111655313-111655335 CCTTTGCCTTCCACCATGAGTGG - Intergenic
1031133028 7:117855253-117855275 AATTTGCCTGCCACCATGCCTGG + Intronic
1031368508 7:120934783-120934805 ACTTTCCCTGCCACCATCTATGG - Intergenic
1031382256 7:121101717-121101739 ACTTTGCCTTCCACCATCAGTGG - Intronic
1032875842 7:136037494-136037516 ACTTTGCCTCCCACCATGATTGG - Intergenic
1033576284 7:142688137-142688159 ACTTAGCATGCTACCCTCAATGG - Intergenic
1034572112 7:151964523-151964545 TCTTTGCCTGCTGCCATCCATGG + Intronic
1036640533 8:10580661-10580683 CCTTTGCCTTCCACCATGACCGG + Intergenic
1036666187 8:10742134-10742156 ACTTTGCCTTCCACCATGATTGG - Intronic
1038571154 8:28663891-28663913 ATTTAGCCTGCCGCCAGCAATGG - Intronic
1040514589 8:48124516-48124538 ACCAAGCCTGCCACCAGCAATGG - Intergenic
1042839395 8:73108544-73108566 ACTGTGCCTGCCAGCACCATGGG + Intronic
1043700319 8:83279128-83279150 CCTTTGCCTTCCACCATGATTGG - Intergenic
1044801099 8:95957250-95957272 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1045159586 8:99523453-99523475 ACTGTGGCTGCCACCACCATTGG - Intronic
1045418995 8:101995493-101995515 CCTTTGCCTTCCACCATGACTGG - Intronic
1045598480 8:103685275-103685297 TGTTTGCCTTCCACCATGAATGG - Intronic
1046065983 8:109197224-109197246 CCTTTGCCTTCCACCATGATTGG - Intergenic
1046206848 8:111011611-111011633 ACTATGCCTGGCACAATAAAGGG + Intergenic
1046293234 8:112189758-112189780 CCTTTGCCTTCCACCATGAATGG - Intergenic
1046814913 8:118572671-118572693 TCTTTGCCTTCCACCATGATTGG + Intronic
1046993603 8:120489529-120489551 ACTATGCCAGCCACCAGTAACGG + Intronic
1047430681 8:124789128-124789150 CTCTTGCCTGCCACCATGAAAGG - Intergenic
1048922665 8:139245422-139245444 ACTTTGCCTTCTACCATGATTGG - Intergenic
1049304147 8:141890631-141890653 CCTTTGCCTTCCACCATGATGGG - Intergenic
1050599708 9:7238124-7238146 AGTTAGCCTGCCACCATTGATGG - Intergenic
1051269645 9:15343013-15343035 TCTTTGCCTTCCACCATGATTGG - Intergenic
1052542558 9:29829076-29829098 CCTTTGCCTTCCACCATAATTGG + Intergenic
1055187274 9:73471740-73471762 ACTCTGCCTTCCACCATGATTGG - Intergenic
1056012594 9:82347291-82347313 TTTTTGCCTGCCACCATCCATGG + Intergenic
1056860938 9:90181076-90181098 ACCTTGCCTGCCACCTGCAGAGG + Intergenic
1058046538 9:100363591-100363613 CCTTTGCCTGTCACCATGACTGG + Intergenic
1058808642 9:108617589-108617611 CCTTTGCCTTCCACCATGAGGGG + Intergenic
1058852546 9:109026904-109026926 CCTTTGCCTTCCACCATGATTGG + Intronic
1059765384 9:117379024-117379046 TCTTTGCCTTCCACCATGATTGG + Intronic
1059946459 9:119413445-119413467 TCTTTGCCTTCCACCACAAAAGG - Intergenic
1060333166 9:122694384-122694406 GCTTTGCCTGCCCCCATCTGAGG + Intergenic
1060785410 9:126448623-126448645 CCTTTGCCTTCCACCATGATTGG - Intronic
1060870214 9:127033986-127034008 ACTTTGCCTCACACCAGGAATGG + Intronic
1061163605 9:128910072-128910094 ACACTGCCTGCCTCCACCAAGGG - Intronic
1061369510 9:130190596-130190618 CCTTTGCCTGCCAGCACCAACGG + Intronic
1062251493 9:135597948-135597970 TCTTTGCCTGCCGCCATTCACGG + Intergenic
1186415099 X:9376482-9376504 CCTTTGCCTTCCACCATGATTGG - Intergenic
1187089326 X:16078514-16078536 ACTGTGCCTGCCCCCAACATAGG + Intergenic
1187123448 X:16431197-16431219 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1187132669 X:16517789-16517811 CCTTTGCCTTCCACCATGATTGG - Intergenic
1187467716 X:19541790-19541812 ACCATTGCTGCCACCATCAACGG + Intronic
1187686412 X:21819888-21819910 ACTTTGCCTTCCACCATGATTGG + Intergenic
1188767238 X:34109256-34109278 CCTTTGCCTTCCACCATGATTGG + Intergenic
1188927284 X:36060015-36060037 TCTTTGCCTTTCACCATGAATGG + Intronic
1189201094 X:39196260-39196282 CCTTTGCCTTCCACCATGAGTGG - Intergenic
1189298195 X:39933894-39933916 TCTTTGCCTGTCTCCATCCATGG + Intergenic
1189362813 X:40366437-40366459 CCTTTGCCTTCCACCATGATTGG - Intergenic
1189760293 X:44315197-44315219 CCTTTGCCTTCCACCATGATTGG + Intronic
1189891134 X:45603658-45603680 CCTTTGCCTTCCACCATTAGTGG + Intergenic
1191607954 X:63082229-63082251 ACTATGGCTGCTATCATCAATGG - Intergenic
1192527487 X:71860301-71860323 ACGTTGCCTGCCACCATAGGCGG - Intergenic
1193326523 X:80184195-80184217 CCTTTGCCTTCCACCATGAGTGG + Intergenic
1193800925 X:85935127-85935149 TCTTTGCCTTCCACCATTATTGG - Intronic
1193976830 X:88130974-88130996 TCTTTGCCTTCCACCATAACTGG + Intergenic
1194096648 X:89648195-89648217 TCTTTGCCTTCCACCATGATTGG + Intergenic
1195980949 X:110577784-110577806 CCTTTTCCTACCCCCATCAAGGG + Intergenic
1197473282 X:126889960-126889982 ATTTTGCCTTCCACCATGATTGG - Intergenic
1197597109 X:128478584-128478606 ATGATGCCTGCCAGCATCAAAGG + Intergenic
1199296379 X:146163376-146163398 CCTTTGCCTTCCACCATGATTGG + Intergenic
1199746960 X:150777859-150777881 ACTTTGAGTGCCACCACCACGGG + Intronic
1200764029 Y:7065318-7065340 GTTTTGCCTGCCACCATGTAAGG + Intronic
1202108451 Y:21395333-21395355 ACTTTTACTGCCACCACTAAAGG + Intergenic
1202592475 Y:26500914-26500936 CCTTTATCTTCCACCATCAAAGG + Intergenic