ID: 919432567

View in Genome Browser
Species Human (GRCh38)
Location 1:197514682-197514704
Sequence TTCAAACATATGCAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919432567_919432569 9 Left 919432567 1:197514682-197514704 CCTTCCTTCTGCATATGTTTGAA 0: 1
1: 0
2: 6
3: 33
4: 313
Right 919432569 1:197514714-197514736 ATAAAGTTGTTTTTTTTTAATGG 0: 3
1: 0
2: 27
3: 261
4: 1765
919432567_919432570 28 Left 919432567 1:197514682-197514704 CCTTCCTTCTGCATATGTTTGAA 0: 1
1: 0
2: 6
3: 33
4: 313
Right 919432570 1:197514733-197514755 ATGGCCCCATCTGTTACCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919432567 Original CRISPR TTCAAACATATGCAGAAGGA AGG (reversed) Intronic
901212585 1:7534905-7534927 TTGAAAAAGATGCAGAAAGAAGG + Intronic
901363041 1:8720460-8720482 ATTAAACATATGCAGAGGGTAGG + Intronic
901431527 1:9218223-9218245 CCCATACAAATGCAGAAGGATGG + Intergenic
902061630 1:13648704-13648726 ATCAAACAAATGCAGAATGTGGG - Intergenic
902170058 1:14602904-14602926 TTCTAACAAATGCAGTAGGCAGG - Intronic
903471643 1:23591707-23591729 TTCAAGCAGATGCGGGAGGAAGG + Intronic
903968954 1:27106731-27106753 TCCAAACCTATGCAGCAGGCCGG - Intronic
904444849 1:30562175-30562197 TTTAAAAATGTGCAGAAGAATGG - Intergenic
907834811 1:58098725-58098747 CACAAACATGTACAGAAGGAAGG + Intronic
907920232 1:58904739-58904761 TTCAAACAGCTTCAGAAGGTGGG + Intergenic
908560243 1:65299104-65299126 TTCAAACATATTCAAAAGTAGGG - Intronic
908806659 1:67939148-67939170 TTCAAGGAGATGCAGAGGGAAGG + Intergenic
909550303 1:76892645-76892667 TTCAAACATATGCAGTTGTGTGG - Intronic
910202917 1:84718455-84718477 TTTAACCATATACAGAAGTAAGG - Intergenic
911211640 1:95145593-95145615 TTCTAACATATGAAGATAGATGG + Intronic
911689648 1:100818523-100818545 TTCAAGCATATTCAGGTGGAGGG + Intergenic
912257692 1:108078105-108078127 TTCAAACATCTGAAGCATGAAGG - Intergenic
912339609 1:108899499-108899521 GTCAAATATAGGCAGAAAGAGGG - Intronic
912373975 1:109195191-109195213 TTTAAAAATATGCAGGAGGAAGG + Intronic
912688939 1:111789203-111789225 TTCATCCATATGAAGAAAGAGGG + Intronic
914920252 1:151841879-151841901 TTCAAACACTCCCAGAAGGAAGG - Intergenic
915338626 1:155163453-155163475 TTCAAATATATACAAAAGGAGGG + Intergenic
915749857 1:158196193-158196215 TTCAAACAACAGCAAAAGGAAGG - Intergenic
916520179 1:165556589-165556611 TTAGAAAATATGCAAAAGGATGG + Intronic
916958245 1:169862712-169862734 TTCAAACAACTGGAGAAGCACGG + Exonic
916975126 1:170068594-170068616 TACCAACATATGCATAATGAGGG + Intronic
917128111 1:171709592-171709614 TTCAAACACATGAAGAAAAAAGG - Intronic
917155158 1:171989683-171989705 TTTAAACATACGCATAAGAAAGG - Intronic
917614744 1:176730458-176730480 TTCAAAAATATACACAAGAAAGG - Intronic
918292636 1:183123473-183123495 TTCAAACCCATGTAGAAGCATGG - Intronic
918878697 1:190084880-190084902 TTCACACATTTGCAGCAGGGAGG + Intergenic
919432567 1:197514682-197514704 TTCAAACATATGCAGAAGGAAGG - Intronic
919890922 1:201973673-201973695 GTCAAACATAGGGAAAAGGAGGG - Intergenic
923612888 1:235511050-235511072 TTCAAAAATGTGCTCAAGGAGGG + Intergenic
924138488 1:240997526-240997548 ATCAAAAAAATTCAGAAGGATGG + Intronic
1063281968 10:4639617-4639639 TACATAAAGATGCAGAAGGAAGG + Intergenic
1063334942 10:5203175-5203197 TGCAGACAAATGCAGAAGGCTGG - Intronic
1063983521 10:11476435-11476457 TTCAAACATATTCAGAAGTAAGG - Intronic
1064470530 10:15630729-15630751 TTAAAAAACATGCAGAGGGAGGG + Intronic
1064494189 10:15890315-15890337 TTCAAACATATGGAAAAGTAGGG - Intergenic
1065145208 10:22761799-22761821 TGCTGACATATGGAGAAGGAGGG - Intergenic
1066500701 10:35991541-35991563 TGCAAACAAATTCAGAAGGGTGG - Intergenic
1067736711 10:48860204-48860226 GTGAAAAATAAGCAGAAGGAAGG - Intronic
1068694001 10:59946486-59946508 TTCAAACAAATACAAAAGAAAGG - Intergenic
1069407738 10:68120244-68120266 TTCAAACATTTACTAAAGGATGG - Intronic
1069669416 10:70189194-70189216 TTAAAACATATGCACAAGGTGGG + Intergenic
1069754916 10:70768339-70768361 TTCTAACATATACTGCAGGATGG + Intergenic
1069833452 10:71294684-71294706 TCCTAGCATATGCAGAAGGATGG + Intronic
1070286863 10:75089974-75089996 TTCAAACACAGGTAGATGGAGGG - Intergenic
1070546555 10:77457338-77457360 TGCCACCAAATGCAGAAGGAGGG - Intronic
1071788334 10:88928201-88928223 TTCAAACATATACAGGAATATGG - Intronic
1073255562 10:102148806-102148828 TCCAAACATAGGAAGAAAGAAGG + Exonic
1073788294 10:106914170-106914192 TTACAACATTTGCTGAAGGAAGG + Intronic
1075834210 10:125439667-125439689 TTCAAACATACACAGAAGCAGGG - Intergenic
1075987335 10:126799203-126799225 TTAAATCTTATGCAGAAGGGTGG - Intergenic
1078648768 11:13167646-13167668 TACACACATATGCAAAGGGAGGG + Intergenic
1078705489 11:13739870-13739892 TTTAAATACATGCAAAAGGAGGG - Intergenic
1080040527 11:27754883-27754905 CTTAAACAGATGCAGAAAGAGGG + Intergenic
1080541523 11:33270278-33270300 TTCAAACATAAACAAAAGGCAGG - Intronic
1080952166 11:37046995-37047017 TTAAAACTCAAGCAGAAGGAGGG - Intergenic
1081026624 11:38022744-38022766 TTCAAAAAAATTGAGAAGGAGGG + Intergenic
1083162392 11:60862741-60862763 AGCAAATAAATGCAGAAGGAAGG + Intergenic
1085344693 11:75760954-75760976 TTCAAACATTAGCAGAGGGCTGG - Intronic
1086509305 11:87539464-87539486 TTAAAACATATTGAGAAGCATGG + Intergenic
1086636012 11:89086890-89086912 TTCAAACTTGTGCACAAGGAGGG - Intergenic
1090481341 11:127071392-127071414 TACAAACCTATCCAGATGGATGG + Intergenic
1091880274 12:3971638-3971660 TTCAAACATTTGCAAAAGTAGGG - Intergenic
1092048707 12:5452526-5452548 TTCAAATGTATGTAAAAGGATGG - Intronic
1092142787 12:6195398-6195420 TGCAAACATCTGCAGAATGACGG - Intergenic
1093543121 12:20311327-20311349 TACAGACATATATAGAAGGAAGG - Intergenic
1094391958 12:29961245-29961267 GCCACACATATGCAGAAGCAAGG + Intergenic
1097772786 12:63608068-63608090 TTCCCAAATATGCAGATGGATGG - Intronic
1097949681 12:65413888-65413910 AGCAAACATATGCAGAAGAAAGG + Intronic
1098054392 12:66489077-66489099 TTCAAACAAATTGAAAAGGAGGG + Intronic
1098759478 12:74404895-74404917 TTCAAAAATATGAAAAAGGTAGG - Intergenic
1099127513 12:78781942-78781964 TTCAAATGTATGCAGAAATAAGG + Intergenic
1099197413 12:79634051-79634073 TTCAATCATATACAGATGTAAGG - Intronic
1101185433 12:102271504-102271526 TTCAAACAAATGCACAAAGAGGG - Intergenic
1102416921 12:112771534-112771556 TTCAAACATATGCCCAAAGATGG - Intronic
1106565113 13:30877782-30877804 ATAAAACATATTCAGAAAGAAGG - Intergenic
1106747950 13:32723885-32723907 TTCAAACATATACAGAAGTAGGG + Intronic
1106968701 13:35107514-35107536 ATAAAACATTTGCAGAAGGATGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108305513 13:49128186-49128208 TTTAAATATATGCAGAATGTGGG + Intronic
1108438432 13:50424615-50424637 TTCAAACATGTACTGAAGTAGGG + Intronic
1108693182 13:52878530-52878552 ATCAAGCATATGCAAAAGTAGGG - Intergenic
1109018428 13:57051541-57051563 TTCAAAAATATTTAGGAGGAGGG + Intergenic
1109637891 13:65147329-65147351 TACTAAGATATGCAGAAAGATGG - Intergenic
1110322379 13:74174799-74174821 TTCAAACATCTGCATCAGTAGGG + Intergenic
1110442903 13:75545151-75545173 TACAAACCCATGCAGCAGGAAGG + Intronic
1111278937 13:85992466-85992488 TTCAAATATATAAAGAAGTAGGG - Intergenic
1112369237 13:98780481-98780503 TTCAAACATATAAAAAAGAAAGG - Intergenic
1112674075 13:101677856-101677878 GTCAAACATATGCAGAACCTGGG - Intronic
1115043883 14:28965734-28965756 TTCAAAGATTTGCAAAAGAATGG - Intergenic
1117220670 14:53602222-53602244 TTGAAAAATATGCAGAAGAGAGG - Intergenic
1119409783 14:74423286-74423308 CCCAAACAGCTGCAGAAGGAAGG + Intronic
1119768286 14:77204516-77204538 TACAAATATTTGCAGAAGAAAGG - Intronic
1121987341 14:98520220-98520242 TTTAAAAAAATGTAGAAGGAGGG + Intergenic
1122385472 14:101342632-101342654 ATTAAACATTTGAAGAAGGAAGG + Intergenic
1124356890 15:29002422-29002444 TTCATACATCTGCAGAGGAAAGG + Intronic
1126222955 15:46236108-46236130 TTCATACATATGAAGAAGTTGGG + Intergenic
1126533764 15:49738261-49738283 GTCCAACAAATGAAGAAGGAGGG + Intergenic
1127367347 15:58303787-58303809 TTCAAACATTTAAAAAAGGAAGG + Intronic
1128882947 15:71260313-71260335 TTCAAACATAGGTAAAAGTAGGG + Intronic
1129421731 15:75433256-75433278 TTCAAACAGGGGCAAAAGGAGGG + Intronic
1129580073 15:76799567-76799589 TTCAAACATATCCACAATGCAGG + Intronic
1130835761 15:87648267-87648289 TTCAAACTTATGTGAAAGGAGGG - Intergenic
1131027965 15:89161247-89161269 TTTCAAAATATGCAGAAGTAGGG + Intronic
1131156165 15:90077034-90077056 TTGATGCGTATGCAGAAGGAAGG + Intronic
1134908041 16:17998908-17998930 TCCACAGATATGCTGAAGGAAGG - Intergenic
1136003211 16:27311902-27311924 CACAAACAGATGCCGAAGGATGG + Intergenic
1136502787 16:30681731-30681753 TTAAAAAATATGCATAGGGACGG + Intergenic
1138228661 16:55322574-55322596 TGCAAACATTTCCAGAGGGAAGG - Intergenic
1138487026 16:57352439-57352461 TTTAAACAAAAGAAGAAGGAAGG + Intergenic
1138684740 16:58715191-58715213 TACAAACATATGCAAAAATACGG + Intronic
1139471392 16:67179828-67179850 CGCAAATACATGCAGAAGGAGGG - Exonic
1140016626 16:71192996-71193018 CTCAAGAATCTGCAGAAGGAAGG + Intronic
1140871663 16:79112323-79112345 CTCAAAAATATTCAGAATGAAGG - Intronic
1141078106 16:81027153-81027175 TTTAAACATATACAAAAGTAAGG - Intronic
1141258691 16:82430299-82430321 TTCAAAAAAATTCAGGAGGATGG + Intergenic
1141421491 16:83920724-83920746 TTCAAACATATGTAAAAGCAGGG + Exonic
1141887962 16:86905823-86905845 TTCAAACATCTACAGAAGCCAGG + Intergenic
1142552591 17:750241-750263 TCCCCACATATGCAGAAGGAAGG - Intronic
1142721403 17:1778415-1778437 CTCAAACATTTGTAGAATGAAGG - Intergenic
1143940853 17:10539887-10539909 TTCAAACAAATGCAAAATCATGG + Intronic
1144701021 17:17340018-17340040 TTCAGAAATATACAGAAGGAAGG - Intronic
1148934441 17:51153640-51153662 TTCAAACCTAAGCAGCTGGAAGG + Exonic
1150631462 17:66883383-66883405 TTCAAACATAAGTACTAGGAAGG + Intronic
1152845206 17:82595597-82595619 TTCAAACACAAGGAGAAGGCTGG - Intronic
1153504059 18:5777860-5777882 AACCAAAATATGCAGAAGGAAGG - Intergenic
1153640397 18:7151867-7151889 TTCAGACTTATGAAGGAGGAAGG + Intergenic
1154326459 18:13394882-13394904 ATCAAACATGTGCAGAAAGCAGG + Intronic
1154939932 18:21102040-21102062 TTCAAATATACGCAGAAGTAGGG - Intronic
1154976492 18:21462359-21462381 TTCAAAAATAAGCAGAGGCAAGG - Intronic
1156095100 18:33520904-33520926 TTCTAAAATCTTCAGAAGGAAGG + Intergenic
1156572966 18:38279799-38279821 AGCAAACATATGCCCAAGGATGG - Intergenic
1157716508 18:49891520-49891542 TTCAAACACCTGCTGAATGAAGG + Intronic
1159086336 18:63795903-63795925 TTGAAAAATTTGCAGCAGGAAGG + Intronic
1162062275 19:8103464-8103486 TTCAAGCCTATGGAGAGGGAGGG - Intronic
1165212693 19:34248439-34248461 CACATACATATGGAGAAGGAGGG - Intergenic
1166346632 19:42170319-42170341 CTCAAACAGATGCACAAAGACGG + Intronic
925315775 2:2922011-2922033 TTCAAACACATACAAAAGAATGG - Intergenic
927936912 2:27081262-27081284 TTCAAACAGCTGCAGGAGAAAGG + Intronic
929049149 2:37819934-37819956 TTCAAGCAAATGCAGATTGAGGG - Intergenic
930857076 2:56030353-56030375 TACAACCATATGTAGAAGAAAGG + Intergenic
932929281 2:76014517-76014539 TTCAAACATATGTAGGATCATGG - Intergenic
933654444 2:84876056-84876078 TTAACAGATATGGAGAAGGACGG + Intronic
933673755 2:85034473-85034495 TTCAAATAAATGAAGGAGGATGG + Intronic
933687393 2:85153808-85153830 TTCACACATATGCAGAAAGAAGG - Intronic
933761488 2:85675299-85675321 CTCAATCAAAGGCAGAAGGAAGG + Intergenic
934880277 2:97971061-97971083 TTTAAACATATGAAGAAGATGGG + Intronic
935342109 2:102067741-102067763 TTCCACCATAAGCAGAAGTAGGG - Intronic
935363081 2:102264111-102264133 TTCAAAAGTATGCAGAGGGCTGG - Intergenic
935915146 2:107941598-107941620 TGCAAACATATGCAGGGGGCTGG + Intergenic
939260423 2:139801319-139801341 TTTAAACATAAGCTGAAGCAGGG + Intergenic
940378516 2:152986462-152986484 TTCAAACATAGGCAGTTGTATGG + Intergenic
940630085 2:156227530-156227552 ATCAAAAACAAGCAGAAGGAAGG + Intergenic
941442384 2:165554487-165554509 TTCAAAGATTTTCAGAATGATGG - Intronic
942780806 2:179640017-179640039 ATCAAACAAATCCAAAAGGAAGG + Intronic
943632033 2:190264743-190264765 CCAAAACATATGCAGAAGAATGG - Intronic
944937723 2:204586678-204586700 TTCCAACATACCCACAAGGATGG + Intronic
1170346744 20:15395231-15395253 TTCAAACATAAGCAGAACACTGG + Intronic
1171497169 20:25563659-25563681 TTCAAATATAAGTAGAAGGATGG + Intronic
1180207541 21:46270824-46270846 TTCAACCATACTGAGAAGGAGGG + Intronic
1180903509 22:19392174-19392196 TTCAAAAAGAAGCAGAAGAATGG - Exonic
1182426615 22:30276616-30276638 AACAAGCATATACAGAAGGAAGG + Intergenic
1182816382 22:33167951-33167973 TTCAAATATTTGCAGGAGGGTGG - Intronic
1182964920 22:34511860-34511882 GTCACACAGATGCAAAAGGAAGG - Intergenic
1185223764 22:49641856-49641878 TTTAAACACATACATAAGGATGG + Intronic
949651174 3:6161324-6161346 CTCAAATATATGCATTAGGATGG - Intergenic
949992764 3:9592568-9592590 TTCAAACATACTCAAAAGTAGGG - Intergenic
951513419 3:23529904-23529926 TTCAAACACATACATTAGGAAGG - Intronic
951613785 3:24520945-24520967 TTCAACCATAGGCAAAAGCATGG + Intergenic
952212012 3:31237383-31237405 TTCCAGCACATGCAGAAGGCAGG + Intergenic
952767729 3:36969641-36969663 TTTAAAAAAATGAAGAAGGAAGG + Intergenic
952984572 3:38766763-38766785 TTCCAAAAGATGCAGAAAGAGGG - Intronic
953269080 3:41422927-41422949 TTCAAACATCTTCTGATGGATGG - Intronic
953948222 3:47166792-47166814 TTTAAACATGTGCAGAAAGTAGG - Intergenic
955075712 3:55611208-55611230 TTCAAACCAATCCTGAAGGAGGG - Intronic
955429393 3:58826950-58826972 TTCAGAAATAAGCAAAAGGAGGG + Intronic
956305681 3:67821864-67821886 ATCAAACATATGGAGAAAGTTGG + Intergenic
957252521 3:77792120-77792142 TTCAAATATATGCACAATGGAGG + Intergenic
957506090 3:81122960-81122982 GTCAAATATATTCAGAATGATGG - Intergenic
958409609 3:93800465-93800487 TTCCAAAATATGCAGAAGGAGGG + Intergenic
960625952 3:119682406-119682428 TTGAAAGACATGCAGAAGGCCGG + Intergenic
961015692 3:123466532-123466554 TTCAAATATATACAAAAGTAGGG - Intergenic
961388707 3:126539122-126539144 TTCAAGCATATGCAAGAAGAAGG + Intronic
961390035 3:126547029-126547051 CTCACACCTATGCAGGAGGAGGG - Intronic
961409271 3:126706649-126706671 TTCAAACACAAGCAGAAGGAAGG - Intronic
962076797 3:132090683-132090705 AATAAATATATGCAGAAGGAAGG + Intronic
962935411 3:140076101-140076123 GTCAAACACATACAGAAGGCCGG - Intronic
963660861 3:148127486-148127508 ATCAAAGATTTGCACAAGGAAGG + Intergenic
965131764 3:164709683-164709705 TTTATGCATAAGCAGAAGGAAGG - Intergenic
965579867 3:170256219-170256241 TTCCAAAATATGGAGGAGGAGGG - Intronic
965781048 3:172286576-172286598 TTGAAACACATGCAGAATCAAGG - Intronic
966129082 3:176616070-176616092 TTAAAACATATCCAGATGGAGGG + Intergenic
968630031 4:1645556-1645578 TCCACACAGAGGCAGAAGGAGGG + Intronic
969113423 4:4857344-4857366 GCAAAACATTTGCAGAAGGAGGG + Intergenic
970653620 4:18205672-18205694 TTCAAACATAGGCAAAAACAAGG - Intergenic
972294779 4:37726655-37726677 TTGAAACAAATGCAAATGGAAGG - Intergenic
972444258 4:39128464-39128486 GTGGAACATGTGCAGAAGGATGG + Intergenic
973278292 4:48333002-48333024 GTTAAACAAATGGAGAAGGAGGG - Intergenic
973589535 4:52426846-52426868 GTCAAATATATGAAGAGGGAAGG + Intergenic
974110658 4:57521635-57521657 TTCCATCATTTGCAGCAGGATGG + Intergenic
974555256 4:63438149-63438171 TTCAAAAAAATTAAGAAGGAGGG - Intergenic
976492691 4:85690344-85690366 TTCAAAAATATCAAGGAGGAGGG - Intronic
976871360 4:89797357-89797379 TTCAAAGGGAGGCAGAAGGAAGG - Intronic
977709228 4:100105695-100105717 TTCAAACTTGCTCAGAAGGAGGG - Intergenic
978032744 4:103955810-103955832 TTCCAAAATATACAGCAGGAGGG + Intergenic
978064013 4:104373624-104373646 TTTAAATATTTGCAGAAAGAAGG + Intergenic
979039100 4:115764163-115764185 TTCAAACATATGCAGTACCTAGG - Intergenic
981058319 4:140390471-140390493 TTAAAACATATCCATAAGGAAGG - Intronic
983097647 4:163583273-163583295 TTCAAACAAATTCACATGGATGG + Intronic
983936379 4:173505662-173505684 TTGAAAAATTTGCAGAAGGTAGG - Intergenic
984367292 4:178815806-178815828 TACAAACACATGCAGCAGGCTGG + Intergenic
984557269 4:181229610-181229632 TTGAAACATATGCAGTAAAAGGG - Intergenic
984580603 4:181505395-181505417 TTCCTACAAATGCACAAGGATGG + Intergenic
984855079 4:184188193-184188215 TTGAAACATAAACATAAGGATGG - Intronic
987222365 5:15803752-15803774 ATCAAACAAATACAGGAGGAGGG - Intronic
987533646 5:19155139-19155161 TTAAGATATATACAGAAGGAGGG - Intergenic
987637225 5:20559416-20559438 TTCAAACATAAGCAGAGCAATGG + Intronic
988645502 5:33091286-33091308 TTCCAAAATATTGAGAAGGAGGG - Intergenic
989315378 5:40071841-40071863 TTCTAGCATATCCAGAAGGTGGG + Intergenic
989686787 5:44098637-44098659 TTCAAACATATGGACACTGATGG - Intergenic
990576102 5:57124977-57124999 TTCAAACATACAGAAAAGGAGGG + Intergenic
990816913 5:59795906-59795928 CACACACATATGCAGGAGGAAGG + Intronic
990868795 5:60408564-60408586 TTTAATCATATGCAAATGGAGGG + Intronic
991740088 5:69662629-69662651 TTCATACATATACAATAGGAAGG + Intergenic
991757411 5:69890554-69890576 TTCATACATATACAATAGGAAGG - Intergenic
991791663 5:70242370-70242392 TTCATACATATACAATAGGAAGG + Intergenic
991819551 5:70538746-70538768 TTCATACATATACAATAGGAAGG + Intergenic
991836814 5:70766436-70766458 TTCATACATATACAATAGGAAGG - Intergenic
991884112 5:71242708-71242730 TTCATACATATACAATAGGAAGG + Intergenic
993277179 5:85875283-85875305 TTTAAACCTATGGAGAAAGAAGG + Intergenic
995278260 5:110303359-110303381 TTCAAAAATATAGAGGAGGAGGG - Intronic
995765135 5:115606200-115606222 TTCAAAAAAATTCAAAAGGAGGG + Intronic
996094987 5:119389050-119389072 TTCAGAGAAATGCAGGAGGAAGG + Intronic
996252302 5:121350480-121350502 TTCAAAAGTAAGCTGAAGGAAGG + Intergenic
997339281 5:133130141-133130163 CTAAATCATCTGCAGAAGGATGG - Intergenic
997505962 5:134417149-134417171 TTCAAACATATGGAAAATTATGG + Intergenic
998630997 5:143898501-143898523 CTCAAATATTTGTAGAAGGAAGG - Intergenic
999079360 5:148828172-148828194 TATAGAGATATGCAGAAGGAAGG + Exonic
1000044523 5:157511085-157511107 TACAAATATAAGCAGGAGGAGGG + Intronic
1002877541 6:1225074-1225096 CTCTAAAATATGTAGAAGGAGGG - Intergenic
1003701942 6:8476201-8476223 GATAACCATATGCAGAAGGAAGG - Intergenic
1004153069 6:13139245-13139267 TACAAAAATATGCAGTGGGATGG - Intronic
1004158543 6:13192716-13192738 TTAGAAAATATGCAAAAGGAAGG - Intronic
1004386396 6:15176718-15176740 TTCAAACATACTCAAAAGTAGGG - Intergenic
1004947700 6:20634236-20634258 TTCAAATATTTGAATAAGGAAGG + Intronic
1006584347 6:35096815-35096837 TTAAAAAATATGCATAAGAATGG - Intergenic
1008188126 6:48420596-48420618 TGCACACATATGCACAAGAAAGG - Intergenic
1008702387 6:54116700-54116722 TTCAAAAATATTAAGGAGGAAGG + Intronic
1008728120 6:54445955-54445977 TTCAAATGAATACAGAAGGAAGG + Intergenic
1009889250 6:69660324-69660346 TTCCAAAATATGGAGGAGGAGGG + Intergenic
1010842617 6:80665045-80665067 TTCACACATATGCAGAAATAAGG - Intergenic
1012940876 6:105413977-105413999 TTCTAAAATATAGAGAAGGAGGG + Intergenic
1013297028 6:108766829-108766851 TGCAGGCATATGCAGAGGGATGG - Intergenic
1014884847 6:126767140-126767162 TATATAGATATGCAGAAGGAAGG - Intergenic
1015053623 6:128873696-128873718 TCCCAACATAAGTAGAAGGAAGG + Intergenic
1015241536 6:131029372-131029394 TTTAAACAAATGCTGAAGTAGGG - Intronic
1015342771 6:132120967-132120989 TTCAGACATCTGCAAAAGGCTGG - Intergenic
1016225273 6:141727606-141727628 CACAAACATATGCAAAAGCAAGG - Intergenic
1016635386 6:146283201-146283223 TTCACACATCTGCAGATGGCAGG - Intronic
1016920263 6:149285641-149285663 TCCAAACATGTGGATAAGGAAGG + Intronic
1017062550 6:150498900-150498922 TTCACACATATGCAGCAGAGAGG + Intergenic
1017305330 6:152911722-152911744 TTCAAAAAAATTGAGAAGGAGGG - Intergenic
1018669674 6:166168092-166168114 TGCAAACATTTGGAGAAGGGCGG - Intronic
1019967455 7:4511469-4511491 TTCAAAGCTATTCAGGAGGAAGG + Intergenic
1021850315 7:24801632-24801654 TTCAGAGATACGCAGAAGGCTGG - Intronic
1022365445 7:29710596-29710618 TTCCCAAATATGCAGATGGATGG + Intergenic
1022728048 7:32998425-32998447 TTCAAACACAAGCAGGAGGCAGG - Intronic
1022932348 7:35131762-35131784 TTCCCAAATATGCAGATGGATGG - Intergenic
1023471650 7:40528870-40528892 TTCAAACATGTGTAGCAAGATGG + Intronic
1023692815 7:42809321-42809343 TTCAAACATATAGAGAAAGAGGG + Intergenic
1023762617 7:43480556-43480578 ATCAAAAATATGGAGTAGGAAGG + Intronic
1026274650 7:68865928-68865950 TTGGAACATATCCAGAGGGAAGG + Intergenic
1026713019 7:72759511-72759533 TTGAAAAATGTGCAGAAGAATGG - Intronic
1027251871 7:76403957-76403979 TCCAAACATAAGAAGAAGGCCGG - Intronic
1028074890 7:86500074-86500096 TTCACACATATGCAGAACCCAGG + Intergenic
1028927834 7:96379296-96379318 TTGAAACATATACAGAATGAAGG - Intergenic
1029322756 7:99779532-99779554 TTCAAAGCTGTCCAGAAGGAAGG + Intronic
1029828275 7:103224557-103224579 TTCCCAAATATGCAGATGGATGG - Intergenic
1030873183 7:114782512-114782534 GTCAAACTTTTGCAGAAGGCTGG + Intergenic
1031611159 7:123829095-123829117 TTCAGGCATATGCAGATAGAAGG - Intronic
1032402313 7:131632108-131632130 TTCAAAACAATTCAGAAGGATGG - Intergenic
1033079044 7:138277905-138277927 TTTAAAGTTATCCAGAAGGAAGG + Intergenic
1034812107 7:154141610-154141632 TTCTAACAGAAGCAGAAGAAAGG - Intronic
1034884319 7:154786554-154786576 TGCCACCATATGAAGAAGGATGG + Intronic
1036556425 8:9863888-9863910 ATCAAACACATCCAGATGGACGG - Intergenic
1037074554 8:14697905-14697927 TTCTAACATATAGAGAGGGAGGG - Intronic
1037777700 8:21846658-21846680 TTCAACCAGATGAAGAAGGAAGG + Intergenic
1038281812 8:26172524-26172546 TTTAAACACATACAGAAGTAGGG - Intergenic
1038977407 8:32715583-32715605 TTCAAAAATTTTCAGAAGTAAGG + Intronic
1039363040 8:36900866-36900888 TTCTAGCATATATAGAAGGAGGG - Intronic
1039579219 8:38650563-38650585 TTCAAACACATGCAGGAACATGG - Intergenic
1040371188 8:46777409-46777431 TTCAAACATATAAAGCAGGCTGG - Intergenic
1040620614 8:49088422-49088444 TTTAAAAATATGCAGAAAAATGG - Intergenic
1040945492 8:52880845-52880867 TTTAAAAATGTGCAGAAGAATGG + Intergenic
1042356327 8:67832240-67832262 TTCAAAAATATGCAAAAGGAAGG - Intergenic
1042682779 8:71404944-71404966 TTCAGAAATATACAAAAGGAAGG + Intronic
1043618959 8:82164264-82164286 TTAAAACCTATGCAGTATGAGGG - Intergenic
1046056522 8:109084870-109084892 ATCAAAAACATGCACAAGGATGG - Intergenic
1047071714 8:121352419-121352441 TTCCAAAAAATGCAGAAGTAAGG + Intergenic
1047828065 8:128599960-128599982 ATTAAACATTTGCAGGAGGAAGG - Intergenic
1050180654 9:2918719-2918741 TTCAAACCTGTGCAGTAGGAAGG + Intergenic
1050266682 9:3898167-3898189 TTCAAACCTAGGCAGATGGAAGG + Intronic
1050470516 9:5984286-5984308 TTAAAACACATGTAGAAGGAAGG + Intronic
1050723149 9:8614181-8614203 TTCACAAATATGAAGAATGAGGG - Intronic
1052000201 9:23269479-23269501 TTCCAACATATGGATAAGGGGGG + Intergenic
1052176411 9:25468538-25468560 TTCCAAAATATTGAGAAGGAGGG - Intergenic
1055428382 9:76218732-76218754 TTCACACAGCTGGAGAAGGAAGG + Intronic
1055674549 9:78642868-78642890 GTCAAACATATGCAGTGGGATGG - Intergenic
1055921191 9:81462695-81462717 TTCAAACAACTGCAGAAATAGGG + Intergenic
1056253012 9:84770045-84770067 AGCAAACATATGCAGAAGCCAGG - Intronic
1057733290 9:97630772-97630794 TTCAAATATTTACAGAAGTAGGG - Intronic
1058031637 9:100205267-100205289 TACCAACAGATGCAGCAGGATGG - Intronic
1059255318 9:112925015-112925037 ATCAAACAAATCCAGAAGGTGGG - Intergenic
1060546754 9:124466385-124466407 TTCATAGATTTGCAGCAGGATGG - Exonic
1060604588 9:124902425-124902447 ATTAAACATAAGCACAAGGAAGG + Intronic
1060647423 9:125292857-125292879 TTAAAACATCTGCAGAAGTCAGG - Intronic
1060753849 9:126194588-126194610 TATAGACATATGAAGAAGGAGGG - Intergenic
1061220333 9:129246869-129246891 TCCAAACATCAGCCGAAGGATGG + Intergenic
1061575794 9:131505114-131505136 GTCAAACATATACAAAAGCAGGG + Intronic
1061740351 9:132699269-132699291 TTTAAACATGTGCACAAGAATGG - Intergenic
1061796588 9:133088935-133088957 TTCAAACCGAAGCAGAGGGATGG - Intergenic
1062217018 9:135394717-135394739 GGGAAACATGTGCAGAAGGAGGG + Intergenic
1203748293 Un_GL000218v1:56961-56983 TTGCAACATATTCAGATGGATGG - Intergenic
1185745473 X:2569303-2569325 TTCTACCATATGCAGAATAAAGG - Intergenic
1185767548 X:2737790-2737812 ATCAAACAAATGCAGACGGCTGG - Intronic
1185932003 X:4213672-4213694 ACCAAACAAATGCAGAATGAAGG + Intergenic
1186333793 X:8564662-8564684 GTCCACCACATGCAGAAGGAAGG + Intronic
1186859214 X:13654766-13654788 TCAAAACATTTGCATAAGGAAGG - Intronic
1187078103 X:15956631-15956653 TACAAACACATGCAGCAGGCTGG + Intergenic
1187209231 X:17212472-17212494 TTCAAAGATAGGGAGAGGGATGG - Intergenic
1188558192 X:31435836-31435858 TGCAAACAAATGCAGAAGAAAGG + Intronic
1189769200 X:44406113-44406135 TTCAAAAACATGGAGAAGGAGGG - Intergenic
1191717037 X:64200849-64200871 TTCCAACATATCCAGAAAGGAGG + Intronic
1192829002 X:74730390-74730412 TTCCAAAATAGGGAGAAGGATGG + Intergenic
1192970962 X:76229439-76229461 TTCATATATAGGCAGAATGATGG - Intergenic
1194146626 X:90273812-90273834 TTCAAACATATATAAAAGTAAGG + Intergenic
1194553447 X:95330046-95330068 AGCAAACATATGCAGTAGCAAGG - Intergenic
1194686627 X:96925779-96925801 TAAAAACATATGTAGAAGGGTGG - Intronic
1195544135 X:106096321-106096343 TTCCAACAAATTGAGAAGGAGGG - Intergenic
1195592382 X:106644802-106644824 TTCAAAAAAATGGAGGAGGAAGG - Intronic
1195716559 X:107824696-107824718 TTCAAACATCTGCACAGGAAAGG - Intergenic
1196244257 X:113380809-113380831 TTCCAAAATATTGAGAAGGAGGG - Intergenic
1196715108 X:118803270-118803292 TTCAAACATATATAGAAGTAAGG + Intergenic
1197902747 X:131391763-131391785 TTGGAAAATATGGAGAAGGAAGG - Intronic
1198548838 X:137723325-137723347 TTCAAACATATTCAAATGTAAGG + Intergenic
1200790067 Y:7291734-7291756 GTGAAACATATGGAGATGGAGGG - Intergenic
1200858053 Y:7960386-7960408 TTCCAAGATAGGCAGAGGGAGGG + Intergenic
1200872364 Y:8116262-8116284 ATAAAACATATGCAGATGAATGG - Intergenic
1201446643 Y:14064123-14064145 TTCAAACCCATGCAGGAGGAGGG - Intergenic