ID: 919435379

View in Genome Browser
Species Human (GRCh38)
Location 1:197553021-197553043
Sequence ACTTCAGGTGGCTTTTGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919435379 Original CRISPR ACTTCAGGTGGCTTTTGTGG AGG (reversed) Exonic
900415287 1:2531890-2531912 ACATCAGGTGACTTTGGAGGTGG + Intergenic
909866518 1:80679662-80679684 ACATCAGGTGGCTCTTTTTGAGG - Intergenic
910064691 1:83139464-83139486 ACTTAAGTTTGTTTTTGTGGTGG + Intergenic
911337024 1:96593723-96593745 GCTTCAGGTGGCTGTGTTGGGGG + Intergenic
911781186 1:101881166-101881188 ACTTCAGTTGACCTTTGTGAAGG + Intronic
912367874 1:109149903-109149925 ACTTCAGGAGGCTTTTGTGAGGG + Intronic
912809251 1:112781449-112781471 ACTTCACATGGCTGTTGTGAGGG + Intergenic
916594570 1:166231749-166231771 ACTTCAGTGTGCTTTTGTAGTGG + Intergenic
918128882 1:181607865-181607887 ACTTCAGCTGGGTTTTGAAGAGG + Intronic
918912872 1:190596004-190596026 ACTTCAGGTGAGTTTTCTAGAGG - Intergenic
919435379 1:197553021-197553043 ACTTCAGGTGGCTTTTGTGGAGG - Exonic
922785153 1:228278976-228278998 TCTGCAGGTTGCTTTTGTTGGGG + Intronic
923110348 1:230885125-230885147 ACTTCCTGTGGCTTATCTGGGGG + Intergenic
923855502 1:237840913-237840935 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
924224972 1:241914129-241914151 ACCTTAGGTGGCTTTAGTGTAGG + Intergenic
924788774 1:247223778-247223800 ACTTCAGTGTGCTTTTGTGGTGG - Intergenic
1063673891 10:8122318-8122340 TCTTCATGGGGCTTTTGGGGTGG - Intergenic
1064274326 10:13892199-13892221 GCTTTGGGTGGGTTTTGTGGGGG - Intronic
1064378158 10:14815738-14815760 AGTTGTGATGGCTTTTGTGGAGG - Intergenic
1064736891 10:18391171-18391193 AATTAAGTTGGCATTTGTGGAGG + Intronic
1064777659 10:18796847-18796869 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1065419233 10:25523214-25523236 ACTTCAGGAGCCTTTTGTTCAGG - Intronic
1067033437 10:42896302-42896324 ACTTCAGAAGGCTTTTATGAGGG + Intergenic
1069126035 10:64635216-64635238 ACTTCAGATGGTTTTTGAGGGGG - Intergenic
1069662964 10:70135893-70135915 ACAACAGGTGGCTTTTCTGCTGG + Intergenic
1071611584 10:87036842-87036864 ACTTCAGGATGTTTTTGTAGTGG + Intergenic
1071856849 10:89634621-89634643 AATTCATGTGGCTTTTATGAAGG + Intronic
1072360642 10:94655567-94655589 ACTTCAGCATGCTTTTGTAGTGG + Intergenic
1074993649 10:118735767-118735789 AATGAAGGTGGCTTTTTTGGTGG - Intronic
1076406576 10:130216010-130216032 ACTTGGCGTGGCTTTTCTGGAGG + Intergenic
1076559169 10:131349935-131349957 TCTTGAGGTGGCCTTTGAGGTGG + Intergenic
1076756631 10:132576010-132576032 AGGTCAGGTGGCATCTGTGGTGG - Intronic
1079989618 11:27233011-27233033 ACTTGAGGTGTCTTTTATGAAGG + Intergenic
1081000566 11:37665337-37665359 ACCTCAGGAGCCTTATGTGGTGG + Intergenic
1082085710 11:48047914-48047936 TCTTGTGGGGGCTTTTGTGGGGG + Intronic
1082861766 11:57863776-57863798 GCTTCAGGTGTTTTTTGGGGGGG - Intergenic
1082907783 11:58330220-58330242 ACTTAAGGGTGTTTTTGTGGTGG + Intergenic
1083368083 11:62154716-62154738 AATACAGTTGGCTTTTGTGTCGG + Intergenic
1086637800 11:89111354-89111376 ACTTCAGTGAGCTTTTGTAGTGG + Intergenic
1086852448 11:91825838-91825860 ACTTCATATGAATTTTGTGGGGG + Intergenic
1087374446 11:97324494-97324516 ACTTCAGTGTGCTTTTGTAGTGG + Intergenic
1087559849 11:99774325-99774347 ACTTCAGGTTTTTTTTTTGGGGG + Intronic
1089720042 11:120408814-120408836 AATTTAGGAGGCTTTGGTGGTGG + Intronic
1091111254 11:132970797-132970819 ACTACAGGAGGCTTTTCTAGAGG - Intronic
1092845281 12:12579215-12579237 ACTTCAGGAGGCTGAGGTGGAGG - Intergenic
1093348973 12:18072720-18072742 ACTTCATGTGGTTTCTCTGGTGG + Intergenic
1094531674 12:31281459-31281481 ACTTCAGTTGACCTTTGTGAAGG - Exonic
1097365641 12:58709519-58709541 CCTACAGGTGGCGTTTGTTGTGG + Intronic
1097734838 12:63170648-63170670 ATTTCAAGTGGCTTTTATGAAGG + Intergenic
1097996812 12:65896897-65896919 ACTTCATGTGGCTGCTGTGGTGG + Intronic
1099018216 12:77371105-77371127 ACTGCAGGTGGCTTCTGAGCAGG + Intergenic
1100809081 12:98319647-98319669 ACTTCAGCTGGCTTTTGTGAAGG + Intergenic
1103044488 12:117724507-117724529 ACTTTAGGTGGCTTTGCTGCTGG + Intronic
1104138607 12:125964324-125964346 ATTTCAGGTTTTTTTTGTGGGGG - Intergenic
1104262128 12:127194049-127194071 ACTTCAGGAGCCTTTTGTGGGGG + Intergenic
1104969187 12:132523490-132523512 ACCGGAGGTGGCTTTTGTGTGGG + Intronic
1106378254 13:29211139-29211161 GCTTCCTGTGGCTGTTGTGGAGG + Intronic
1106392252 13:29346371-29346393 GCTTCCTGTGGCTGTTGTGGAGG + Intronic
1106766889 13:32922266-32922288 AGTTCAGTTGCCTTTTGGGGCGG + Intergenic
1107389335 13:39946854-39946876 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1108117842 13:47149671-47149693 ACTTCAGGGTGTTTTTGTAGTGG + Intergenic
1109647395 13:65276066-65276088 ACTTCAGGTTACTTTTTTGTAGG - Intergenic
1110504740 13:76272247-76272269 ACTTGCTGTGGCTTCTGTGGAGG - Intergenic
1112376209 13:98843818-98843840 ACTGCAAATGGGTTTTGTGGTGG - Intronic
1113472104 13:110554500-110554522 AGCCCAGGTGGCTTTTGTGAAGG - Intronic
1115778880 14:36747541-36747563 AGTTAAGGTTCCTTTTGTGGAGG - Intronic
1116282440 14:42926677-42926699 ACTTAAGGGTGTTTTTGTGGTGG + Intergenic
1116496154 14:45563179-45563201 TTTTCAGGTGGGTCTTGTGGTGG + Intergenic
1118516313 14:66532230-66532252 GCTTCCGGTGGCATTTGTTGGGG + Intronic
1120161279 14:81147635-81147657 ACTTCAGGTGGGGGTGGTGGGGG - Intergenic
1123509895 15:20987345-20987367 TCTTTAGGTGACTGTTGTGGTGG + Intergenic
1123567114 15:21561091-21561113 TCTTTAGGTGACTGTTGTGGTGG + Intergenic
1123603378 15:21998384-21998406 TCTTTAGGTGACTGTTGTGGTGG + Intergenic
1124444417 15:29716797-29716819 TCTTCAGGTGGCTTCAGTTGAGG + Exonic
1125274381 15:37975831-37975853 ACTTCAGTGTGTTTTTGTGGCGG + Intergenic
1126301490 15:47201925-47201947 ACCTCTGCTGGCTTTTTTGGGGG + Intronic
1126319499 15:47407029-47407051 ACTTTATGTAGTTTTTGTGGTGG + Intronic
1128262420 15:66241593-66241615 ACTGCAGGAGGCTTTTTTGCGGG + Intronic
1128769158 15:70268889-70268911 CCTTCAGCTGGCTAATGTGGAGG + Intergenic
1128966059 15:72059474-72059496 ACTTCAGTTGACCTTTGTGAAGG + Intronic
1129624263 15:77180284-77180306 ACTTTAGGTATCTTTTGTCGTGG + Exonic
1129936588 15:79456089-79456111 ACTTCAGGTCAGTTCTGTGGTGG - Exonic
1129954449 15:79622388-79622410 ACTTCAGTGGGTTTTTGTAGTGG + Intergenic
1130080019 15:80724719-80724741 ACTGCAGGTTACTTTTGTGCAGG - Intronic
1130422557 15:83763133-83763155 ACTTCAGGGGGCTGAGGTGGGGG - Intronic
1130783352 15:87069035-87069057 GCTGCAGGAGGCTTTTGGGGAGG + Intergenic
1131456266 15:92584844-92584866 ACTTGAGATGGCATTTGAGGAGG + Intergenic
1202975476 15_KI270727v1_random:288185-288207 TCTTTAGGTGACTGTTGTGGTGG + Intergenic
1132933266 16:2469233-2469255 ACGTCTGGTGGCTTCTGGGGTGG - Intergenic
1135736739 16:24937983-24938005 ACTTCAGGTGGCATCTCTTGTGG - Intronic
1136534148 16:30889306-30889328 ACCTCATGTGGCTGTTGTGAGGG + Intronic
1137581864 16:49638509-49638531 TCTTCAGGTGGATCTTGAGGTGG + Exonic
1138925030 16:61580868-61580890 ACTGCACGTGGCTTTTGCTGCGG + Intergenic
1140614916 16:76650553-76650575 AATCCAGGTGGCTTTTGAGAGGG + Intergenic
1141150943 16:81564290-81564312 ACTTAAGGTGCCTTTCTTGGAGG + Intronic
1142316498 16:89350073-89350095 TTTTCATGTGGCTTTTTTGGTGG - Intronic
1142657971 17:1406882-1406904 ACTTTAGGAGGCTTAGGTGGGGG + Intergenic
1147571078 17:41571616-41571638 TCTGGAGGTGGCTTTGGTGGTGG - Exonic
1147697249 17:42365023-42365045 AATTCAGAAGGCATTTGTGGTGG + Intronic
1148133427 17:45276149-45276171 ACTTAAGGAGGCTTCTGAGGAGG + Intronic
1151096088 17:71500020-71500042 ACTTCAGATTTCTTTTGTGGTGG - Intergenic
1151108299 17:71644819-71644841 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1153094520 18:1385154-1385176 ACTTCAGTGTGCTTTTGTAGTGG - Intergenic
1153870358 18:9313407-9313429 AGTTCTGGTAGCTTTTTTGGTGG - Intergenic
1155141308 18:23047054-23047076 TCTTCAGTTGGATTTTGGGGTGG + Intergenic
1155477998 18:26254449-26254471 ACTTCAGTTGACCTTTGTGAAGG - Intronic
1155936913 18:31763821-31763843 ACTTTAGGTGGCTGGGGTGGGGG + Intergenic
1156596037 18:38548993-38549015 CCTTCAGGTGCCTTTTGTCATGG - Intergenic
1158730300 18:60015520-60015542 ACTTCAGTTGACCTTTGTGAAGG - Intergenic
1159905947 18:74092622-74092644 ATTTCTGGTAGATTTTGTGGGGG + Intronic
1161210568 19:3063167-3063189 TCTTCAGGTCGCTTTAGGGGTGG - Intergenic
1162315432 19:9935971-9935993 ACTTCAGGGGGCATTGGAGGGGG - Intronic
1163242484 19:16072670-16072692 ACTTCAGGAGGCTGAGGTGGGGG + Intronic
1164232268 19:23300724-23300746 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1164732177 19:30514600-30514622 TCTTCTGGTGGCTTTTCTTGGGG + Intronic
1166066266 19:40360980-40361002 GCTTCAGTTGGATTTTGTAGTGG - Intronic
926173974 2:10572536-10572558 TCTTAAGGTGGCTCTTGTGTAGG - Intronic
926633005 2:15154678-15154700 GGTTCTGGTGGCTTTTGGGGTGG - Intergenic
926967384 2:18429887-18429909 ACTTCCGGGGTCTTTTGTTGGGG - Intergenic
928094876 2:28398398-28398420 CCTTCCGGTGGCTTTAATGGAGG + Intronic
928976019 2:37087262-37087284 CCTTCATGTGGTTTTAGTGGAGG - Intronic
931376610 2:61713728-61713750 AGTTCAGGTGGCTTTTGCTCTGG - Intergenic
931939163 2:67233042-67233064 ACATCAGATGGTCTTTGTGGTGG - Intergenic
932106777 2:68950740-68950762 TTTTCAGGTGGCATTTCTGGTGG - Exonic
933071450 2:77863549-77863571 TTTTCAGGTGGTCTTTGTGGAGG + Intergenic
933145103 2:78842338-78842360 ACTTCAAGAGGCTTATATGGGGG + Intergenic
933653736 2:84870509-84870531 ACTCCAGGTGGCGCTTGAGGCGG + Exonic
934019588 2:87932560-87932582 ACTTCAGTGTGCTTTTGTAGTGG + Intergenic
934791900 2:97068906-97068928 ACTCCTGCTGGCTTCTGTGGAGG + Intergenic
937100918 2:119267695-119267717 AGTACAGGTGGCTTTAGAGGAGG + Intergenic
937293269 2:120794670-120794692 AGCTCAGGTGGCTGGTGTGGTGG + Intronic
938364110 2:130720382-130720404 CCTTCAGGAGGCTTCAGTGGGGG + Intergenic
938462405 2:131506345-131506367 GCTTCAGGAGGCTAGTGTGGTGG - Intergenic
941725617 2:168857198-168857220 ACCTCATGGGGCTTTTGTGAGGG + Intronic
943350156 2:186787332-186787354 ACTTCAGTGTGCTTTTGTAGTGG - Intergenic
945052789 2:205841241-205841263 ATTTCAGCTGGCTTTTTTGGGGG + Intergenic
946803043 2:223441778-223441800 ATTTAAGGAGCCTTTTGTGGAGG + Intergenic
946993346 2:225361183-225361205 ACTTGAGGTGGGTATAGTGGAGG - Intergenic
1169135597 20:3195269-3195291 ACTGAAGGAGGCCTTTGTGGTGG - Exonic
1169900514 20:10547884-10547906 CCACCAGGTGGCCTTTGTGGAGG - Intronic
1172115090 20:32568857-32568879 ACTGCAGGCTGCTTGTGTGGGGG + Intronic
1172287256 20:33749539-33749561 ACTTCAGGAGGCTGAGGTGGGGG - Intronic
1172477869 20:35252532-35252554 CCATCAGGTGGATTTTGGGGTGG - Intronic
1172700425 20:36850227-36850249 GCTGGAGGTGGCTTTTGAGGTGG - Intronic
1173843703 20:46175024-46175046 AGCTCAGGTGGCTCTTGTGGTGG + Exonic
1179601753 21:42482775-42482797 ATTTGAGGTGGGTATTGTGGTGG - Intronic
1183047923 22:35235527-35235549 ACTTAAGTGTGCTTTTGTGGTGG - Intergenic
1183510973 22:38234759-38234781 ACTTAATGTTGCTTTTGTGCCGG - Intronic
1183880822 22:40827214-40827236 ATTACAGGTGGCTTTCCTGGGGG - Exonic
1184616169 22:45640062-45640084 CCTGGAGGTGGCTTTTGAGGTGG + Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
950106927 3:10394354-10394376 ACCTCAGGGGGCTGTTGTGAGGG - Intronic
952723528 3:36557888-36557910 TCTTTAAGTTGCTTTTGTGGAGG - Intergenic
954913337 3:54127543-54127565 TCTTCAGATTGCTCTTGTGGGGG + Intronic
959135807 3:102418216-102418238 ACTTCAGGTGGCTTCAGTGCTGG - Intronic
960277023 3:115740561-115740583 ACTTCAGTTTGTTTTTGTAGTGG + Intergenic
960679895 3:120237116-120237138 ACTTCAGTGTGTTTTTGTGGTGG + Intronic
960711384 3:120533048-120533070 ACTTCAGATGAGTTTTGTTGTGG + Intergenic
962274912 3:134004795-134004817 CCTTCTGGAGGCTTTAGTGGAGG - Intronic
962294536 3:134170385-134170407 TGTTGAGGTGCCTTTTGTGGAGG + Intronic
962529744 3:136267784-136267806 GCCTCTGGTGGCTTTTGAGGTGG + Intronic
962994055 3:140607280-140607302 ACTTAAGTTTGTTTTTGTGGTGG - Intergenic
964024340 3:152054088-152054110 ACTTTGGGAGGCTTTGGTGGAGG + Intergenic
965473007 3:169118767-169118789 AGTTCAGCTGACTTTTCTGGTGG + Intronic
965917432 3:173867751-173867773 TCTTCAGGTGATTTTTGTAGGGG - Intronic
967621983 3:191644276-191644298 ACTTCAGTATGTTTTTGTGGTGG - Intergenic
967791471 3:193553579-193553601 ATTTCTGGTGACATTTGTGGAGG + Intronic
968789003 4:2646693-2646715 ACTGCAGGTGTCGTGTGTGGTGG - Exonic
968984038 4:3865775-3865797 ACTCCAGGTGGCTATGCTGGTGG - Intergenic
970135981 4:12924574-12924596 ATTTCAGGTGGCTGTGGAGGAGG + Intergenic
972003776 4:34072590-34072612 ACTTCAGGCTGTTTTTTTGGAGG - Intergenic
977870815 4:102088691-102088713 ACTTCAGTTGTCTTTTATAGAGG - Intergenic
981401998 4:144323755-144323777 ACTTCAGTGGGTTTTTGTGGTGG - Intergenic
982786730 4:159545023-159545045 ACTTCTGGTAGCTTTTTTGCAGG - Intergenic
982933540 4:161440158-161440180 ACTTTTAGTGCCTTTTGTGGAGG - Intronic
983798789 4:171901336-171901358 TCTTCAGAAGGCCTTTGTGGGGG - Intronic
984606509 4:181791221-181791243 AGTTCTGGTCTCTTTTGTGGGGG + Intergenic
985186282 4:187319398-187319420 ACTTAAGTGTGCTTTTGTGGTGG - Intergenic
985627969 5:999924-999946 ACTTCACGAGGCTTTTGCCGAGG + Intergenic
986154219 5:5157846-5157868 ACTTGAAGTGCCTTATGTGGAGG - Intronic
986401688 5:7388240-7388262 ATTTCAGGTGGCTTATGTGCAGG + Intergenic
986488913 5:8269468-8269490 ATGTCAGGTGGCTCCTGTGGAGG + Intergenic
987846700 5:23296119-23296141 GCTTCCTGTGGCTATTGTGGGGG + Intergenic
988077379 5:26369636-26369658 ACTTTAGTTTACTTTTGTGGAGG + Intergenic
990069539 5:51763693-51763715 TCAACAGGTGGCTTTTGAGGAGG - Intergenic
990857430 5:60285261-60285283 ACTTCAGGTCCCCTTTGTGGCGG - Intronic
991655981 5:68904159-68904181 GTTTCAGGTGGCTTTTATGTTGG + Intergenic
992736857 5:79730407-79730429 ACTTCAGGGGACATATGTGGTGG - Exonic
994006258 5:94840902-94840924 ATTTGAGGTGGATTTTGGGGTGG + Intronic
995258105 5:110071004-110071026 ACTTCAGTGAGTTTTTGTGGTGG + Intergenic
995664603 5:114527492-114527514 ACTCCACGTGACCTTTGTGGTGG + Intergenic
995775653 5:115722480-115722502 ACTTCAGGAGGCTAAGGTGGTGG + Intergenic
996046125 5:118875236-118875258 ACTTCAGTTTGTTTTTGTAGTGG - Intronic
996335005 5:122373905-122373927 ACTTTGGGTGGCTGGTGTGGTGG + Intronic
996525774 5:124477920-124477942 ACTTGCTGTGGCTTTTGTGATGG - Intergenic
996888471 5:128388446-128388468 ACTTAAGTTTGTTTTTGTGGTGG + Intronic
998523956 5:142825578-142825600 ACTTCAGGTGGCTTGTGGGCAGG - Intronic
999717652 5:154374592-154374614 ACTTCAGGAGGCTGAGGTGGGGG - Intronic
1000134625 5:158335461-158335483 ACTTAAGTTTGTTTTTGTGGTGG + Intergenic
1003403504 6:5809901-5809923 ACTGCAGGTGGCTCCTGGGGTGG + Intergenic
1004527462 6:16422718-16422740 ACTTGAGGAGGCTGTTGTGAAGG - Intronic
1005120410 6:22383291-22383313 TCTTCAGGAGCTTTTTGTGGTGG - Intergenic
1006040365 6:31247844-31247866 ACTTCAGCTTGTTTTTGTAGTGG - Intergenic
1007416437 6:41694026-41694048 ACTTCAGTTGGCCCTGGTGGGGG + Intronic
1007685759 6:43666448-43666470 ACTTCACGTGGCTTCTGAGCAGG + Exonic
1009060270 6:58389642-58389664 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1009230641 6:61057757-61057779 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1009596982 6:65747911-65747933 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1009599026 6:65773687-65773709 ACTTAAGTGTGCTTTTGTGGTGG - Intergenic
1012169373 6:95999717-95999739 ACTTAAGTGTGCTTTTGTGGTGG - Intergenic
1013414402 6:109912143-109912165 GCTTTAGGTGCCTTTTTTGGCGG + Intergenic
1014400228 6:120979643-120979665 ACTTCAGGTGTGTTATATGGAGG - Intergenic
1016847753 6:148586008-148586030 ACTTCAGTGTGCTTTTGTAGTGG + Intergenic
1021200177 7:17720124-17720146 ACTTCAGCTGGCTTTTGATGTGG + Intergenic
1021512562 7:21450365-21450387 ATTTTAGGGGGCTTTTTTGGTGG + Intronic
1022387747 7:29917451-29917473 CCTACAGGAGGCTTTTTTGGGGG - Intergenic
1023000826 7:35805897-35805919 ACTTCTGGTAGCTTTATTGGAGG + Intronic
1024782765 7:52870921-52870943 ACTTCAGGGGGATTTTGGGAGGG + Intergenic
1027279421 7:76595284-76595306 ACTTAAGTTTGTTTTTGTGGTGG - Intergenic
1027554466 7:79646567-79646589 ACTTAAGTGTGCTTTTGTGGTGG + Intergenic
1027595545 7:80169191-80169213 TCTACACGTGGCTTTTGCGGTGG + Intronic
1027752521 7:82168126-82168148 AATTTAAGTGGCTTTTTTGGTGG + Intronic
1030024764 7:105312759-105312781 ACTTCAGGTTGAGTTTGTGAGGG - Intronic
1031500397 7:122507420-122507442 ATTTGAGGTGCCTTTGGTGGGGG + Intronic
1032366872 7:131307847-131307869 ACTTTCGGTGGCTGTTGAGGAGG + Intronic
1035304082 7:157918929-157918951 ACCTCAGGTGGCTGTTGTGGGGG - Intronic
1037338256 8:17813151-17813173 ACTTCAGGAGGCTGAGGTGGGGG - Intergenic
1037366079 8:18123533-18123555 ACTTCATATGAATTTTGTGGGGG + Intergenic
1037743968 8:21628813-21628835 ATTTCCTGTGGCTTCTGTGGGGG - Intergenic
1037930994 8:22880299-22880321 ACTTCACAGGGCTTTTGTGAGGG + Intronic
1038030305 8:23633019-23633041 ACTTCAGTTGACCTTTGTGAAGG - Intergenic
1038133290 8:24758419-24758441 ACTGCAGGTGTCTGTGGTGGTGG - Intergenic
1040088251 8:43367532-43367554 ACTTCAGTGGGCTTTTGTAGTGG - Intergenic
1041938727 8:63363429-63363451 AAAACAGGAGGCTTTTGTGGTGG - Intergenic
1042645534 8:70982353-70982375 GCTTGATGTGGCTGTTGTGGGGG + Intergenic
1044955767 8:97478002-97478024 ACTTCAGTGTGTTTTTGTGGTGG - Intergenic
1045672931 8:104576642-104576664 ACTTCAGTGTGCTTTTGTAGTGG - Intronic
1046702823 8:117419626-117419648 ACTTCAGGTGGGGTTTTTGTGGG - Intergenic
1048847815 8:138616705-138616727 CCCTCAGGTGGTTTTTCTGGGGG - Intronic
1049503696 8:142983263-142983285 ACTTCAGATGGCTTTGGGGTTGG - Intergenic
1050109092 9:2196240-2196262 CCTTCAGGTGGCACTGGTGGTGG - Intergenic
1050437199 9:5623707-5623729 AATGCTGGTGGCTTTTTTGGTGG - Intergenic
1055509584 9:76983100-76983122 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1056010629 9:82326268-82326290 ACTTCAGTGTGCTTTTGTAGTGG + Intergenic
1056104399 9:83332752-83332774 ATTCCAGTTGGCTTTTGTTGGGG - Intronic
1058229457 9:102407975-102407997 AGCTCAGGGGTCTTTTGTGGCGG - Intergenic
1059071454 9:111141762-111141784 AATTTAGGTGGCTATTGTGTTGG + Intergenic
1059821707 9:117980958-117980980 ATTTCAGGTGGATTTTGGGAGGG - Intergenic
1061343783 9:130005264-130005286 ATTTCAGGTGGTATTTGTGATGG - Intronic
1062380685 9:136285263-136285285 AGTTCAGGGGGCATTCGTGGGGG + Intronic
1186162490 X:6792444-6792466 ACTTCAGGCAACTTTTGAGGAGG - Intergenic
1189517633 X:41731173-41731195 ACTTCAGGGGGCTGAAGTGGGGG + Intronic
1190435159 X:50417206-50417228 ACATCAGCTGGCTCTTGAGGTGG - Intronic
1190506207 X:51128711-51128733 ACTTCAGTTTGTTTTTGTAGTGG + Intergenic
1191064707 X:56335595-56335617 ACTTCAGTGTGCTTTTGTAGTGG + Intergenic
1191815422 X:65239684-65239706 ACTTCAGTGTGTTTTTGTGGTGG + Intergenic
1192002967 X:67175858-67175880 ACTTCAGTGTGTTTTTGTGGCGG + Intergenic
1193775918 X:85641777-85641799 GCTTCCTGTGGCTGTTGTGGGGG + Intergenic
1193939974 X:87670486-87670508 AACTCAGGTGGCTTTTGTGTAGG - Intergenic
1194031548 X:88822922-88822944 ACTTAAGTGTGCTTTTGTGGTGG + Intergenic
1195301262 X:103532138-103532160 ACTTCAGGTAGCATGTGGGGTGG - Intergenic
1198738281 X:139811829-139811851 ACTTCATATGGCTGTTGTTGAGG + Intronic
1199124938 X:144106574-144106596 ACTTCAGTGTGCTTTTGTAGTGG - Intergenic
1200749069 Y:6928593-6928615 ACCACATGTGGCTTTTGTTGTGG + Intronic
1201494568 Y:14579085-14579107 ACTTCAGCTGTCTTCTGTGAAGG - Intronic
1201556916 Y:15272635-15272657 ACTTCAGGCAACTTTTGAGGAGG - Intergenic