ID: 919437559

View in Genome Browser
Species Human (GRCh38)
Location 1:197580860-197580882
Sequence TCCTTATGTTGAGACAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919437559_919437560 15 Left 919437559 1:197580860-197580882 CCTGTACTGTCTCAACATAAGGA 0: 1
1: 0
2: 3
3: 20
4: 120
Right 919437560 1:197580898-197580920 CGTTTTAAATTGTAGTATGTAGG 0: 1
1: 0
2: 0
3: 14
4: 154
919437559_919437561 25 Left 919437559 1:197580860-197580882 CCTGTACTGTCTCAACATAAGGA 0: 1
1: 0
2: 3
3: 20
4: 120
Right 919437561 1:197580908-197580930 TGTAGTATGTAGGTTATTTATGG 0: 1
1: 0
2: 0
3: 8
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919437559 Original CRISPR TCCTTATGTTGAGACAGTAC AGG (reversed) Intronic
902426619 1:16328821-16328843 TCCTTACTTTGTGGCAGTACTGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
907483693 1:54762031-54762053 ACCTAATGTTGAGGCAGTAAGGG - Intronic
908737859 1:67294877-67294899 TCGTTAAGTTGAAACAGCACTGG + Intergenic
909031022 1:70540361-70540383 TATTTATGTTGAGACAATATTGG - Intergenic
911524803 1:98971878-98971900 TTCTCATGTTGACACAGAACAGG + Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913388724 1:118287314-118287336 TCCTTTTGTTGTGACAGCTCAGG + Intergenic
914270330 1:146074581-146074603 CCTTTATGTTGGGACAGAACAGG + Intronic
914270867 1:146079317-146079339 CCTTTATGTTGGGACAGAACAGG + Intronic
914271404 1:146084047-146084069 CCTTTATGTTGGGACAGAACAGG + Intronic
914271939 1:146088774-146088796 CCTTTATGTTGGGACAGAACAGG + Intronic
914272476 1:146093492-146093514 CCTTTATGTTGGGACAGAACAGG + Intronic
914273014 1:146098214-146098236 CCTTTATGTTGGGACAGAACAGG + Intronic
914273552 1:146102936-146102958 CCTTTATGTTGGGACAGAACAGG + Intronic
914274091 1:146107654-146107676 CCTTTATGTTGGGACAGAACAGG + Intronic
914274628 1:146112364-146112386 CCTTTATGTTGGGACAGAACAGG + Intronic
914275161 1:146117082-146117104 CCTTTATGTTGGGACAGAACAGG + Intronic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916489028 1:165285230-165285252 TCCTTAGGTGGAGAGAGTTCTGG + Intronic
917627814 1:176863615-176863637 TCCTTATTTTAAGCCAGGACTGG - Exonic
919437559 1:197580860-197580882 TCCTTATGTTGAGACAGTACAGG - Intronic
920388358 1:205583392-205583414 TCCTTAGGTAGAGACAGCACTGG + Intronic
1065747108 10:28852453-28852475 TCCTTATCATGAGACAGTTCAGG + Intronic
1067578315 10:47421340-47421362 TCCTTGTGCTGAGACAGGCCTGG - Intergenic
1068265333 10:54641090-54641112 TCATTTTGTTGAGACAGAAATGG - Intronic
1070441400 10:76448308-76448330 TCCATATGTTGGGACATTAAGGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1085276374 11:75302733-75302755 TCCCTGTGTTGAGTCACTACTGG - Intronic
1094067893 12:26380889-26380911 TCCTTATGTGGCTAAAGTACTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099192769 12:79577373-79577395 TTCTTATGTTGAGGCAGTTGAGG - Intronic
1100412672 12:94337357-94337379 TCATTTTGTTGAAGCAGTACTGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104276853 12:127336902-127336924 TCCTAGTGTTTTGACAGTACAGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109691956 13:65906398-65906420 TGCATATGTTGAGCCAGTTCTGG + Intergenic
1110457328 13:75704184-75704206 ACCTTATAATGAGATAGTACAGG - Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1118629748 14:67691803-67691825 TGCTTTTGATGAGACACTACAGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121304691 14:92898748-92898770 TCCTTATGTTGATCCAGCAGGGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1127299045 15:57634631-57634653 GCCTTATGAGGGGACAGTACAGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1131139387 15:89964723-89964745 TCCTTCTGTTGAGCCAACACAGG + Intergenic
1131839684 15:96423602-96423624 TTCTGATGTTGAGAAAATACAGG - Intergenic
1133705662 16:8352446-8352468 TTCATACATTGAGACAGTACAGG + Intergenic
1137608856 16:49805577-49805599 GCCTTATTTTGAGAAGGTACAGG - Intronic
1138830719 16:60371590-60371612 GCCTTGTGTTCAGACAGTCCTGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1149615051 17:57989878-57989900 TCCTTAGGTTTGGACATTACAGG - Intronic
1150476999 17:65483274-65483296 TCCTTAGCTGGAGTCAGTACTGG - Intergenic
1151256464 17:72880541-72880563 TCCTTTTTTTGAGACAGGTCTGG - Intronic
1159682855 18:71376271-71376293 TCCTTCTTTTGAGACTTTACTGG - Intergenic
1160315027 18:77835207-77835229 TCCATATGCTGAGAGAGCACAGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
930413466 2:51057489-51057511 TCCTTGTGTTAAGATTGTACTGG + Intergenic
930607121 2:53504231-53504253 TCTTGTTGTTGAGACAGCACTGG + Intergenic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
937639130 2:124191983-124192005 TCCTTAGTTTGAGACATTCCTGG + Intronic
939218532 2:139272176-139272198 TCCATGTGTTGAGAAAGTAAAGG - Intergenic
940537552 2:154965633-154965655 TCTTTTTTTTGAGACAGTCCAGG + Intergenic
944749232 2:202691017-202691039 TCCATTTGTTCAGACAGTAAGGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1170144697 20:13160190-13160212 TCCTTTTGTTGAGACAGCTTGGG + Intronic
1170370113 20:15639421-15639443 TCCTTATCTTGAGACTGCCCGGG + Intronic
1174783847 20:53414330-53414352 CCACTATGTTGAGCCAGTACTGG - Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1177032575 21:16000107-16000129 TCCTGGTGTTGAGAAAGAACAGG + Intergenic
1180836844 22:18934207-18934229 TCCTTCTGCTGAGCCAGCACAGG - Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1184075225 22:42172811-42172833 TCCTTATGTTGGCACACTGCAGG + Intronic
1203286937 22_KI270734v1_random:159506-159528 TCCTTCTGCTGAGCCAGCACAGG - Intergenic
950736501 3:15013130-15013152 GCCTTAGGTTGAGAGAATACAGG - Intronic
952084472 3:29801166-29801188 TTCTTATGTTGACACAGCAATGG + Intronic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
956337492 3:68180488-68180510 TTCTTATGTTGGGACAATATGGG - Intronic
956652315 3:71515750-71515772 TGCTTATGTTGAACCAGTAAAGG - Intronic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
963237511 3:142970335-142970357 TCCCTGTCTGGAGACAGTACTGG + Intronic
963427709 3:145153611-145153633 TGGTTATCTTTAGACAGTACAGG - Intergenic
967108888 3:186275410-186275432 TCCTTCTGTTGGGACAATATGGG + Intronic
969538970 4:7774012-7774034 TCCTTAGATTGAGATTGTACTGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
978165596 4:105603003-105603025 TCCTTATCTGGAGACAGGGCGGG - Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
984451052 4:179902502-179902524 TCTGTATGTTCAGACAGTATAGG - Intergenic
992348889 5:75909293-75909315 TTCTTATTTGGAGACAGTACTGG + Intergenic
994448297 5:99906202-99906224 CCCTAATGTGGAGACAGTGCTGG + Intergenic
995714620 5:115069821-115069843 TCCTTCTGTTAAGAAACTACAGG + Intergenic
996233820 5:121102018-121102040 GCCTTATGTTGTGACATCACTGG - Intergenic
1002540015 5:179900384-179900406 TCCTTGTGTTCATTCAGTACAGG - Intronic
1002938489 6:1695585-1695607 TGCTGATGTTGAGAAAGAACTGG - Intronic
1003152650 6:3565603-3565625 TCCTTTTATGGGGACAGTACAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006809768 6:36812304-36812326 TGCTGATGTGGAGACTGTACAGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007903867 6:45439262-45439284 TCATAATGTTGAGTCAGTGCTGG + Intronic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012358724 6:98349558-98349580 TACTTATTTTGAGACAGGGCTGG - Intergenic
1015277507 6:131399370-131399392 TCCTTCAGTTGAGTCAGTATGGG + Intergenic
1015608015 6:134980811-134980833 TCTTTCTTTTGGGACAGTACTGG + Intronic
1015824305 6:137295447-137295469 TCCTTTTGTTGACACAGCAAAGG + Intergenic
1023535410 7:41203553-41203575 CCCTTATGTAGACACAGCACTGG - Intergenic
1023713586 7:43020449-43020471 TCCTATGGTTGAGACAGAACAGG - Intergenic
1024739739 7:52341050-52341072 TCCATCTGCTGAGACAGTGCTGG - Intergenic
1032136861 7:129287382-129287404 TCCTTGTGTTTAATCAGTACTGG + Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1036225917 8:6957501-6957523 TCCTCTTGTTGAGACAGTGACGG - Intergenic
1039193729 8:35006468-35006490 TCTTTTTGTTGAGACAGTGCTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041385941 8:57302508-57302530 TCCTTAGGTTTTGACAGTCCTGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1049210033 8:141381741-141381763 GCCTTGTGTTGAGACAGCACCGG - Intergenic
1050786599 9:9411456-9411478 TGCTTTTGTTTAGACAGTTCTGG - Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057126223 9:92618192-92618214 TCCTTTTGTTGAGAAAGGCCTGG + Exonic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1062676903 9:137752072-137752094 TCCCGATGTGGAGACAGGACCGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187333026 X:18357957-18357979 TGCTTATGTTGAAACAATATCGG + Intergenic
1189649830 X:43177362-43177384 TTCTTTTTTTGAGACTGTACTGG + Intergenic
1190418081 X:50200442-50200464 TGCTTAGGTTGTGACAGTTCAGG - Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191078964 X:56488186-56488208 TTCTTATGTTGAGACTGACCAGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194177605 X:90670290-90670312 TCTTGATGTTGAAACACTACAGG + Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200524275 Y:4252439-4252461 TCTTGATGTTGAAACACTACAGG + Intergenic