ID: 919441703

View in Genome Browser
Species Human (GRCh38)
Location 1:197642353-197642375
Sequence TTTCTTTCAAGTGGCTCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919441697_919441703 14 Left 919441697 1:197642316-197642338 CCAGGTTAGGATAGCAGCTATTA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 919441703 1:197642353-197642375 TTTCTTTCAAGTGGCTCCAATGG 0: 1
1: 0
2: 1
3: 22
4: 243
919441696_919441703 21 Left 919441696 1:197642309-197642331 CCTATTACCAGGTTAGGATAGCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 919441703 1:197642353-197642375 TTTCTTTCAAGTGGCTCCAATGG 0: 1
1: 0
2: 1
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919441703 Original CRISPR TTTCTTTCAAGTGGCTCCAA TGG Intronic
901333392 1:8427622-8427644 TTTTTTTAAAGTGGGGCCAAGGG - Intronic
903428200 1:23270555-23270577 TTTCCTTCCAGAGGCTCCAGGGG - Intergenic
905531194 1:38680169-38680191 TTTCTTTCTGGAGGCTCCAGGGG - Intergenic
906572709 1:46857881-46857903 TTTCCTCCAAGTGCCTTCAAGGG - Intergenic
906599065 1:47108012-47108034 TTTCCTCCAAGTGCCTTCAAGGG + Intronic
906700597 1:47854872-47854894 TTTTTTACATGTGACTCCAAAGG - Intronic
906866285 1:49424028-49424050 TTTCCTACAAGTGCCTCCCAGGG - Intronic
908649074 1:66312344-66312366 TTTCTTTCTAGAGACTCTAAGGG + Intronic
909211114 1:72825321-72825343 TCTCTTTCTAGTGGCTCCAGGGG - Intergenic
910053087 1:82999250-82999272 TTTCTTTCTGGAGGCTCTAAGGG + Intergenic
911518140 1:98894424-98894446 TTTATTTCCAGTGGCCCCACGGG + Intronic
911745267 1:101434942-101434964 TTTTTTTAAAGTAACTCCAAAGG - Intergenic
912559662 1:110541207-110541229 TTTCTATAATGTGGCTCCCATGG + Intergenic
913156531 1:116105020-116105042 CTTCTTTCAAAATGCTCCAAAGG + Intergenic
916276598 1:163000996-163001018 TCTCTTGCAAGTGCCTCCGATGG - Intergenic
916823256 1:168420472-168420494 TTCCTTTCTAGTGGCTGAAAAGG + Intergenic
917179169 1:172275597-172275619 TTTCTTTCACATGGCTCAACTGG + Intronic
919038469 1:192348352-192348374 TTTCTTTCAACTTGTACCAAAGG - Intronic
919441703 1:197642353-197642375 TTTCTTTCAAGTGGCTCCAATGG + Intronic
920264304 1:204710446-204710468 TTCCTTTCAAGGGGCTCCCTGGG + Intergenic
921558019 1:216622571-216622593 TTTTTATTAAGTAGCTCCAATGG + Intronic
1062993676 10:1845319-1845341 TTTTTTCCATGTGGCTCGAAAGG + Intergenic
1063561704 10:7134224-7134246 TTTTGTTCTAGTAGCTCCAATGG + Intergenic
1063879391 10:10515611-10515633 TTTGTTTCAAGTGGCGTTAACGG - Intergenic
1063954315 10:11252077-11252099 TTTCTTTCCAGAGGCCCAAATGG + Intronic
1064954964 10:20897832-20897854 ATTCTTTGAAGTGGTTCAAAGGG - Intronic
1065098154 10:22303130-22303152 TTTCTTTAAAGTGACTTCCAAGG + Intergenic
1067825727 10:49571373-49571395 TTTCCTTCAAATGACACCAAGGG - Intergenic
1069624860 10:69861298-69861320 TTGCTGTCAGGTGGCTCCAGGGG + Intronic
1070517328 10:77220401-77220423 TTCCTCTGCAGTGGCTCCAACGG + Intronic
1071236938 10:83660150-83660172 TTTCTTTAATGTGACTTCAATGG + Intergenic
1072674676 10:97456938-97456960 GTTATTTCAAGGGCCTCCAAGGG + Exonic
1074122760 10:110505459-110505481 TTTCTTTCAAGTGACTGAACTGG + Intronic
1079715608 11:23739873-23739895 TTTCATCCAAGTTGCTGCAAAGG + Intergenic
1081340504 11:41921664-41921686 TTCCATTCATGTGGCTGCAAAGG + Intergenic
1083606465 11:63981821-63981843 TTTCTTTCCAGAGGCTCTAAAGG - Intronic
1085561566 11:77476585-77476607 TTCCTTTCCAGAGGCTCCAAGGG - Intergenic
1088311969 11:108469738-108469760 TTTCTTTAAAGTAGCCACAAGGG + Intergenic
1089625267 11:119747132-119747154 TTCCTTTCAGGAGGCTCCAGGGG + Intergenic
1091271870 11:134320052-134320074 TTTTTTTCAAATGGCTCCACTGG - Intergenic
1091471082 12:727811-727833 TTTCTTCCAAGGGCTTCCAAGGG - Intergenic
1092403666 12:8199268-8199290 TTTCTTTCAAGAAGCTACACAGG - Intergenic
1093996881 12:25652583-25652605 ATTCTTTCAAGTCCCTCCAGAGG - Intergenic
1096795555 12:54075359-54075381 TTTTTTACAAGTGTCTCCTAAGG - Intergenic
1097144122 12:56928236-56928258 TTTCTTTAAAGTTCCTCAAATGG + Intronic
1097903607 12:64897837-64897859 TTTATTTTATGTGGCTCCAAGGG + Intergenic
1098659767 12:73076882-73076904 TTTCTTTCAAATGTCTGGAATGG - Intergenic
1099284866 12:80704970-80704992 TTTCATTCAAGTGTCACCACTGG - Intergenic
1100680541 12:96915282-96915304 TTTCTTCCACATGGATCCAACGG - Intronic
1102654845 12:114473388-114473410 TTTCTTTCATGTGTCTTGAATGG - Intergenic
1103232837 12:119346219-119346241 TTTTTTTCAAGTGCCATCAAGGG - Intronic
1104372183 12:128233770-128233792 GTTCCTTCCAGAGGCTCCAAAGG + Intergenic
1105629497 13:22148299-22148321 TTTCTTTTAAGGGTCTCAAAAGG - Intergenic
1106735386 13:32583760-32583782 TGTCTTTCTGGAGGCTCCAAAGG - Intergenic
1107120159 13:36787404-36787426 TTTCCTTCCTGTGGCTCCTATGG - Intergenic
1107734211 13:43379105-43379127 TTTCTTTCTGGAGGCTCCAGAGG - Intronic
1107985216 13:45770022-45770044 GTTCTTTTAAAAGGCTCCAAAGG + Intergenic
1108182373 13:47853829-47853851 TTCTTTTCCAGAGGCTCCAAAGG - Intergenic
1108698917 13:52927101-52927123 GTTCTTTCTGGAGGCTCCAAGGG - Intergenic
1109982871 13:69933540-69933562 ATTTTTTCCAGTGGCTCTAAAGG + Intronic
1109988864 13:70027360-70027382 TCACTTTCAACTGGCTCTAAAGG - Intronic
1114375290 14:22139580-22139602 TTTCCTTCAACTGGCTTCCAAGG - Intergenic
1114938227 14:27572343-27572365 TTTCTTCCAGGTGGCTCTAGTGG - Intergenic
1116205169 14:41856390-41856412 TTTCATTCAAGGAGCTTCAAGGG + Intronic
1118097568 14:62555716-62555738 TCTCATTCAACTGTCTCCAAAGG + Intergenic
1119149252 14:72343232-72343254 TTTCTTTCTGGAGGCTCTAAGGG + Intronic
1120431858 14:84429130-84429152 TTTATTTCAATTGGCACAAAAGG + Intergenic
1121056804 14:90862244-90862266 TCTCATTCAAGTGGCTTCAATGG + Exonic
1121334939 14:93071596-93071618 TCTCTTTTAAATGGATCCAATGG + Intronic
1124621023 15:31273970-31273992 TTTCTGTCAAGAGGCTCCCCTGG - Intergenic
1126519499 15:49575969-49575991 TTTCTTTTAAGTGCATCCAGAGG + Intronic
1127859921 15:62985342-62985364 TTTGTTACAAATGGGTCCAACGG - Intergenic
1129490178 15:75917219-75917241 TTTTTCTCTAGTGACTCCAATGG + Exonic
1130893852 15:88155388-88155410 TTTCTTTCTGGAGGCTCTAAGGG - Intronic
1133689336 16:8198064-8198086 TTTGTTTCCAGTGGCCCCATGGG - Intergenic
1134238427 16:12486072-12486094 TTTCTTTCTAGAGACTCCAGGGG + Intronic
1138933970 16:61696278-61696300 TATCAATCAAGTGGCTCCAGTGG + Intronic
1139244995 16:65433029-65433051 TTTCTCTCCAGTGGCTTCAAAGG + Intergenic
1139660520 16:68417495-68417517 TGTCTCTCAAGTGGCTCCTTAGG - Intronic
1141560168 16:84862688-84862710 TTTTTTTAACGTGGCTCCACTGG + Intronic
1144252098 17:13427914-13427936 TTTCTTTCAGGAGGTTCCAGGGG - Intergenic
1149211477 17:54307196-54307218 GTTCTTTCCAGAGGCTCCAAGGG - Intergenic
1149313603 17:55420097-55420119 TTTCTTTTTAGAGGATCCAAAGG + Intronic
1149625983 17:58081596-58081618 CTTCTTTCAAGTGTTCCCAAGGG - Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1151106497 17:71621948-71621970 TTTATTTCAAGTGTTGCCAATGG + Intergenic
1152736708 17:82000825-82000847 TGTCTTTGAAGTGCCTCCACTGG + Intronic
1152774399 17:82191489-82191511 TTTCTGTCAAGTTACACCAAGGG + Intronic
1153650211 18:7232633-7232655 TTTCTTTCATGCGGCTACAGAGG + Intergenic
1153731060 18:8012297-8012319 TTTGTTTCCAGAGGCTCTAAAGG + Intronic
1155424411 18:25691215-25691237 TTGCTTTCCAGGGGCTCCAGTGG - Intergenic
1156588451 18:38459206-38459228 TTTCTTTGGAGCGGCTTCAAAGG + Intergenic
1158888682 18:61853254-61853276 TTTCTTTCTGGGGGCTCTAACGG + Intronic
1161462227 19:4404525-4404547 TTTCTTTGAAGTGGCTAGAAAGG + Intronic
1162048743 19:8019099-8019121 GTTCCTTCTAGAGGCTCCAAGGG - Intronic
1163920880 19:20287386-20287408 TTTCTTTCAACTGCATCCACAGG + Intergenic
1164042590 19:21506549-21506571 TTTCCTTCAAGCTCCTCCAAAGG - Intronic
1167027661 19:46932945-46932967 CTTCTTTTACATGGCTCCAAAGG - Intronic
1167724742 19:51202520-51202542 TTTCTTTCCAGTAACTCAAATGG + Intergenic
1168132337 19:54329600-54329622 TTTCCTTGGAGTGGCTCCCATGG - Intergenic
1168312196 19:55465938-55465960 TTTCTCTCGGGTGTCTCCAAGGG + Intergenic
925819473 2:7785760-7785782 TTTCTTTCAAGAGAAGCCAAAGG - Intergenic
926124314 2:10262600-10262622 TTTCCTTCTAGTGGCTGCAAGGG - Intergenic
926406154 2:12555048-12555070 CTTCTTTCAACTGGGTCCACAGG + Intergenic
926740610 2:16107538-16107560 TTTCTCTAAAGTGGGTCCAGAGG + Intergenic
926993699 2:18709897-18709919 TTTCTGTCTAGTGGCTCCATCGG + Intergenic
927009693 2:18890200-18890222 TTTCTCTCCAGCTGCTCCAATGG + Intergenic
929488963 2:42379642-42379664 GTTCTTTCTGGAGGCTCCAAGGG + Intronic
930923902 2:56792366-56792388 TTTCTTTCATGTCCCTACAAAGG - Intergenic
931765232 2:65449675-65449697 TTTCTTTTAAGGGGCTACAAAGG - Intergenic
935503255 2:103868229-103868251 ATTCTTTCTAGAGGCTCCAGGGG - Intergenic
936269083 2:111034855-111034877 CTTCCTTCAAAAGGCTCCAAAGG - Intronic
937309785 2:120895006-120895028 TTTCTTTCTAGTGCCTCAATGGG + Intronic
938144208 2:128820599-128820621 TTTCTTTCCAGTGGCTCTGTCGG + Intergenic
939543751 2:143526431-143526453 TTCCTTCCAACTGACTCCAAGGG - Intronic
939762168 2:146196406-146196428 TTTGTTTAAAGTGGTTCCTATGG - Intergenic
939871455 2:147530853-147530875 TTTATTTCAAGGGGCTCATAGGG - Intergenic
941304032 2:163838943-163838965 TTTCTTTCTTGAGGCTCCAGAGG - Intergenic
942873196 2:180761346-180761368 TTCCTTTCTAGAGGCTCCAGGGG - Intergenic
943227816 2:185203757-185203779 TTTCTTTCAAGTGGAGTAAAAGG - Intergenic
943937545 2:193940410-193940432 ATTCTTTCAAGTTTCTCCAGAGG + Intergenic
944907048 2:204272360-204272382 TTGCTTAGAGGTGGCTCCAATGG - Intergenic
944944604 2:204669017-204669039 TTCCTTTCTGGAGGCTCCAAGGG - Intronic
946597120 2:221318188-221318210 TTTTATTGAAGTGGCTTCAAGGG - Intergenic
947339606 2:229123700-229123722 TTTCATTCAAGTGGGTATAAAGG + Intronic
947408244 2:229804450-229804472 TTACTTTCAGCTGGCCCCAATGG - Intronic
1168861275 20:1047739-1047761 TGTATTTCAAGTGGCCCCAGTGG + Intergenic
1169527965 20:6451023-6451045 CTTGTTTCAACTGGCTACAAAGG - Intergenic
1169756771 20:9051313-9051335 TTTCTTTCTTCAGGCTCCAAGGG - Intergenic
1171103289 20:22407117-22407139 TTCCTTTCAAGTGGCTAAAGTGG + Intergenic
1171993858 20:31717379-31717401 ATTTTTTCAGGGGGCTCCAATGG - Intronic
1173041610 20:39469336-39469358 TTGCTTTCAAGTGACACAAATGG + Intergenic
1173129515 20:40376652-40376674 TTTCTTTCTAGAGGCTCTAGGGG - Intergenic
1178202478 21:30423110-30423132 TTTCTTTCCAGAGGCTCTAAGGG - Intronic
1178379181 21:32093768-32093790 CTGCTTGCAAGTGGCTCCATGGG + Intergenic
1179462028 21:41542630-41542652 TTTCTTTCCAGAGATTCCAAAGG - Intergenic
1181627215 22:24130161-24130183 TATCTGGCAAGTGGCTCCATGGG + Intronic
1182323538 22:29494189-29494211 TTCCTCTAAAATGGCTCCAATGG + Intergenic
951429733 3:22592556-22592578 TTTTTTTCCAGTTGCTCCAGAGG - Intergenic
952314157 3:32218190-32218212 TTTATATCAAGTGGCTTCATTGG - Intergenic
954136315 3:48583727-48583749 TTTCTTTCCAGGGGGGCCAACGG + Exonic
954508760 3:51103145-51103167 TTTCTTTCAAGGGGCTCTAATGG + Intronic
955070553 3:55569123-55569145 TTTCCTTGAAGTGGGTTCAAAGG - Intronic
957252941 3:77797531-77797553 CTCCTTTCAAGTGCCTGCAAAGG - Intergenic
957553434 3:81735778-81735800 CTTCAATCAAGGGGCTCCAAAGG + Intronic
957651304 3:83008837-83008859 TTTCTTAGAAATGGCTTCAAAGG - Intergenic
959312001 3:104750334-104750356 TTTGTTTCAAATGGCTTCAAGGG - Intergenic
959862419 3:111230751-111230773 TTTCTTTCAAGTAACACAAATGG + Intronic
962181525 3:133210885-133210907 TTTATGTCAAGTGGTTCCACAGG - Intronic
962566551 3:136666255-136666277 TTTCTTTCAGGAGGCTCTAGGGG - Intronic
962727242 3:138242713-138242735 TTTCATGCCAGTGGTTCCAATGG + Intronic
962902211 3:139771455-139771477 TTGATTTCACTTGGCTCCAAGGG - Intergenic
965050805 3:163645259-163645281 GTACTTGCAAGTGACTCCAAAGG - Intergenic
965193776 3:165567226-165567248 TTTCATTCATGTTGCTACAAAGG - Intergenic
965668454 3:171121106-171121128 TTTCTTTGAAGTGATTCCCAAGG - Intronic
966089186 3:176110034-176110056 TTTCTTTTAAGCAGCTCCTATGG + Intergenic
967233058 3:187359122-187359144 TTTATCCCCAGTGGCTCCAAGGG - Intergenic
969065724 4:4478951-4478973 TTTCTTTCAGGTAGTTCCACTGG + Intronic
971166237 4:24186687-24186709 TGTGCTCCAAGTGGCTCCAATGG - Intergenic
974081936 4:57222903-57222925 TTCCATTCAAGTTGCTACAAAGG + Intergenic
974137449 4:57836352-57836374 TGTCCTTCCAGTGCCTCCAATGG + Intergenic
975661774 4:76695909-76695931 TTTCAGTCCAGTGTCTCCAAAGG - Intronic
976827993 4:89281639-89281661 GTTCCTTCCAGTGGCTCTAAGGG - Intronic
977640316 4:99350540-99350562 CTTCATCCAAGTGGCTGCAAAGG + Intronic
977677614 4:99765209-99765231 TTTCTTTCTAGAGGCTCTAGGGG + Intergenic
978403051 4:108350639-108350661 TTTGTTTCAAGTGGAGCCAGGGG - Intergenic
979805792 4:124969421-124969443 TTTCATTCAACTGTTTCCAAAGG + Intergenic
982306970 4:153943055-153943077 TTTCTTTTAAGTGTTGCCAAAGG + Intergenic
982476943 4:155864659-155864681 TTTCTGTCAAATGGCAGCAATGG + Intronic
983750802 4:171267202-171267224 TTTCCTTCAAGAAGCTACAAGGG + Intergenic
984013284 4:174397923-174397945 TTTCTTTCTACAGGCACCAAGGG + Intergenic
984139690 4:175988576-175988598 TTCCTTTTCAGTGGCTGCAATGG - Intronic
985940013 5:3127778-3127800 TTTCTTAAATGTGGCTCCCAAGG + Intergenic
987444675 5:18003054-18003076 TTTCTTTCAAGAGTCACCCATGG + Intergenic
987731583 5:21780428-21780450 TTTCTTTCCAATGGCTCCTTGGG - Intronic
989841889 5:46085485-46085507 TTTCTCACAATAGGCTCCAATGG - Intergenic
990506461 5:56450089-56450111 TTTCTTTCCAGTGGCAACAATGG - Intergenic
990819385 5:59820281-59820303 TTTTATTCAAGTGGCTGCTAAGG + Intronic
992654732 5:78897418-78897440 TCTCTTTCAAGAGGCTTCACAGG + Intronic
993522250 5:88917085-88917107 TTTCTTTCCTGAGGCTTCAAAGG + Intergenic
994189247 5:96850191-96850213 TTTCTTGCACCTGACTCCAAAGG + Intronic
995495111 5:112733588-112733610 CTTCTTTCTAGAGGCTCTAAGGG - Intronic
997949004 5:138227078-138227100 TTACTTTGAAGTGGTTCCAGTGG + Intergenic
998658303 5:144206627-144206649 TTTCTTACAAGTTGATCCAAAGG + Exonic
999320515 5:150612026-150612048 TTTCTTCCTCATGGCTCCAAAGG - Intronic
999508008 5:152218421-152218443 GTTCTTTCAGGTGGCTCCAGGGG + Intergenic
999861028 5:155646517-155646539 TTCCTTTCCAGTGGCCCCACTGG + Intergenic
1000034937 5:157439013-157439035 TTTCTTGGATGTGGCACCAAAGG + Intronic
1000257991 5:159559144-159559166 CTTCTTCCCAGTGGCTTCAATGG - Intergenic
1002670513 5:180862215-180862237 TTGCTTTCAAGTGTATCCAATGG + Intergenic
1002837171 6:874757-874779 TGTCTTTCCCGTGGCTCTAATGG + Intergenic
1003247771 6:4398906-4398928 TTTCTTTAAAGGGGCTTTAAAGG - Intergenic
1003620125 6:7692100-7692122 TTACTTCTACGTGGCTCCAACGG + Intergenic
1003967702 6:11268805-11268827 TTTATTTCAACTGGCCCAAATGG + Intronic
1004936068 6:20509608-20509630 TTTCTTGCAAGTCCTTCCAAGGG + Intergenic
1007010771 6:38415435-38415457 TTCCTTTCTAGAGGCTCTAAGGG - Intronic
1009617423 6:66028482-66028504 ATTCTTTAAAATGGCTCCATAGG + Intergenic
1011066509 6:83332597-83332619 TTTCATCCAAGTGGCTGCAAAGG - Intronic
1011900087 6:92283315-92283337 TTTCTCTAATGTGGCTCAAAAGG - Intergenic
1011957263 6:93038262-93038284 ATTGTTTTAAGTGGCTCCATGGG - Intergenic
1012611172 6:101222781-101222803 TTCCATCCATGTGGCTCCAAAGG + Intergenic
1013395689 6:109736848-109736870 TTCCTTTCCAGAGGCTCCAGGGG + Intronic
1013705519 6:112829347-112829369 TTTGATACAAGTGGCTCGAATGG + Intergenic
1014654070 6:124077394-124077416 TTTCTATCAAGTCTCTCAAATGG - Intronic
1015700291 6:136028543-136028565 TTTCTTTCTGGAGGCTCTAAGGG + Intronic
1016510016 6:144831798-144831820 TTTCTTTCCAGTGTCACCCAAGG - Intronic
1017333735 6:153229851-153229873 TATCTTGCACATGGCTCCAAGGG + Intergenic
1017369279 6:153686050-153686072 TTCCTTTGAAGTGGCACCCATGG - Intergenic
1020288345 7:6703622-6703644 TTTCTTTGGAGTGTGTCCAAAGG - Intronic
1020887659 7:13838786-13838808 TTTCTTTCAAGTTGTTCATAAGG - Intergenic
1021370009 7:19833108-19833130 TTTCTTTCTAGGGGCTCTCAGGG + Intergenic
1021993867 7:26161375-26161397 TTTCTTTAGAGTTTCTCCAAGGG + Intronic
1023492717 7:40761747-40761769 CTTGTCTCATGTGGCTCCAAGGG - Intronic
1024310507 7:47964887-47964909 TTTCTGTCACTGGGCTCCAAGGG + Exonic
1024580980 7:50800518-50800540 TTTTTTTTAAGTGGCTGGAAAGG - Intergenic
1025265208 7:57450819-57450841 TTTCCTTCAAGTCTCTCCCATGG - Intronic
1025719813 7:63999490-63999512 TTTCCTTCAAGTCTCTCCCATGG - Intergenic
1026093587 7:67322241-67322263 TTTCTTTCCCGAGGCTTCAAAGG - Intergenic
1026132396 7:67631169-67631191 TTTCTTTCTTGTGGGTTCAAAGG - Intergenic
1027703848 7:81503798-81503820 TTTCTTTCAAGTATGTCTAATGG + Intergenic
1028007054 7:85587142-85587164 TTTATGACAAGTGGTTCCAATGG + Intergenic
1028029587 7:85893463-85893485 TTTCTTTGAAGTGGGTGTAAGGG - Intergenic
1028163306 7:87510012-87510034 GTTCCTTCTAGAGGCTCCAAAGG - Intronic
1028478517 7:91277971-91277993 TTTCTTTCTGGGGGCTCTAAGGG + Intergenic
1029032504 7:97483605-97483627 TTTCTTGCCAGTGCCTCCATTGG + Intergenic
1031280992 7:119798833-119798855 TTTCACTTAAGTGGCTCCATAGG + Intergenic
1031815591 7:126431000-126431022 TTTCTTTCATGTGACTCAAACGG + Intergenic
1032809935 7:135402814-135402836 TTTCTTCTAACTTGCTCCAAAGG + Intronic
1032989942 7:137382554-137382576 TTTGTTCAAAGTGGCTTCAAGGG - Intronic
1033719416 7:144042006-144042028 TTTATTTCAAGTGAATTCAAAGG + Intergenic
1034094621 7:148395714-148395736 CTGCTTTCTAGTGGCTCCACAGG + Intronic
1035645195 8:1213774-1213796 CATCTTTCCAGTGGCTCCCATGG + Intergenic
1035738562 8:1907851-1907873 TTTGTTTCAAATAGCTCCCAAGG + Intronic
1036865507 8:12392878-12392900 TTTCTTTCAAGAAGCTACACAGG - Intergenic
1040075968 8:43230902-43230924 TTTCATCCAGGTGGCTACAAAGG - Intergenic
1040830244 8:51668067-51668089 CTTCTTTTAAGTGGCTACATTGG - Intronic
1042872314 8:73410201-73410223 TGTCTTTCAAGTAGCTCAAGAGG - Intergenic
1042893204 8:73635951-73635973 TTTCTTTGAATTGGTTCCAGGGG - Intronic
1043389154 8:79774997-79775019 TTTTTTTCTAGTGGTGCCAAAGG - Intergenic
1043680291 8:83016312-83016334 TTTCTTTCTAGAGGCTCTAGAGG + Intergenic
1044683608 8:94806142-94806164 TTTCTTGCAAGTGTTTCTAATGG - Intergenic
1044683611 8:94806180-94806202 TTTCTTGCACGTGTTTCCAATGG - Intergenic
1046430478 8:114119123-114119145 TTTCTTGAAAGTGAATCCAAAGG - Intergenic
1050629422 9:7542926-7542948 TTTATTTGAGGTGGCTCTAAAGG - Intergenic
1050812341 9:9764419-9764441 TTTCTTTGAAGTGGGGGCAACGG - Intronic
1051106978 9:13591509-13591531 CTTCTTTAAAGTGGCCCCAGGGG - Intergenic
1051229185 9:14936327-14936349 CTACTTTCAAGTGGCTCTAAAGG - Intergenic
1051274008 9:15381736-15381758 TTTCCTTCAAGTGGCTCAGGAGG - Intergenic
1052355322 9:27498477-27498499 TTTCTTTTAAGTTTGTCCAAAGG - Intronic
1052429218 9:28345273-28345295 TTTTTTTCAAGTGGTTACTAAGG + Intronic
1052510346 9:29410256-29410278 TTTTTTTTAGGTGTCTCCAATGG - Intergenic
1053433508 9:38059433-38059455 TTCCTTTCCAGTTTCTCCAAGGG - Intronic
1054704582 9:68449408-68449430 TTACTTTCCAGGGACTCCAAAGG - Intronic
1058531709 9:105912360-105912382 TGTGTTCCAAGTGTCTCCAAAGG - Intergenic
1058753858 9:108065939-108065961 TTTCTTTCTGGAGTCTCCAAGGG - Intergenic
1059698773 9:116755136-116755158 TTTCATTTAAATGGATCCAAAGG - Intronic
1203400278 Un_KI270519v1:83624-83646 TTTTTCTCAATTGGCTGCAAAGG - Intergenic
1186095851 X:6101028-6101050 TTTCTTTCAAGTGACTCCTTTGG - Intronic
1187292368 X:17967366-17967388 TTTCTTTCAAGGGTCTCAGATGG + Intergenic
1191015298 X:55803326-55803348 TTTCTTTCAAATGGCTCAGTTGG + Intergenic
1196613220 X:117737402-117737424 TTGATTTCAAGTGGCTTCACAGG + Intergenic
1197278988 X:124513174-124513196 TTCCTTTCCAGAGGCTCTAAGGG + Intronic
1197987618 X:132283747-132283769 TTCCATTCAAGTTGCTGCAAAGG + Intergenic
1198522496 X:137467208-137467230 CTTCATTCAAGTTTCTCCAAAGG + Intergenic
1199029174 X:142976093-142976115 TTTCATTCATGTCGCTGCAAAGG - Intergenic
1199330607 X:146553795-146553817 TTTCATTCCAGGGACTCCAAGGG + Intergenic
1202138453 Y:21694473-21694495 TCTCTTTCAAGCTGCTCCAGAGG - Intergenic