ID: 919444010

View in Genome Browser
Species Human (GRCh38)
Location 1:197678190-197678212
Sequence CTCTGTAATTACATGTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919444010 Original CRISPR CTCTGTAATTACATGTGTCA TGG (reversed) Intronic
905618795 1:39422167-39422189 CTCTGTAATTACATGTCCATAGG + Intronic
908400433 1:63767875-63767897 CACAGTAGTTACATGTGTAATGG - Intergenic
909807304 1:79887460-79887482 ATCAGTGATTTCATGTGTCATGG + Intergenic
918484612 1:185016156-185016178 CTCTGTAACTTTATCTGTCAGGG + Intergenic
919444010 1:197678190-197678212 CTCTGTAATTACATGTGTCATGG - Intronic
919797261 1:201328625-201328647 ATCACTAAGTACATGTGTCAGGG - Intronic
922888366 1:229038447-229038469 TTCAGTGATTACATGTGACAAGG + Intergenic
923002790 1:230021480-230021502 CTTTGTAATCACATGTATGATGG + Intergenic
923849384 1:237776746-237776768 CTCTGGGATTACATGTGCCCCGG - Intronic
1063136156 10:3218150-3218172 CTCTGTAGTTACTACTGTCACGG - Intergenic
1064821985 10:19347126-19347148 CTGTGTAATTACTACTGTCATGG + Intronic
1066299446 10:34083954-34083976 CTCTGTAATAACATTTATTAGGG + Intergenic
1066501406 10:35998523-35998545 CTGTTTAATGAAATGTGTCAGGG - Intergenic
1066629274 10:37442838-37442860 CTGTTTAATGAAATGTGTCAGGG - Intergenic
1067473611 10:46552502-46552524 CTGTGTAATTACAAATGTCCTGG + Intronic
1068133468 10:52925152-52925174 CCCTGTAATCCCATGTATCAAGG + Intergenic
1068281388 10:54875176-54875198 CATTGTGATTACATGTGTTATGG + Intronic
1072578165 10:96719049-96719071 CTCTGGTATGACATGTGTTATGG - Intronic
1074971024 10:118538870-118538892 CTCTGTGCTTGCATGTTTCAGGG + Intergenic
1075958044 10:126542002-126542024 CCATGTAATAGCATGTGTCACGG - Intronic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1078437885 11:11340481-11340503 CTCTGACATTAGATGTTTCATGG - Intronic
1078754387 11:14195081-14195103 CTTAGTAATTACATGTGGTAAGG - Intronic
1079396093 11:20064944-20064966 CTCTGACATTCCATGAGTCATGG + Intronic
1080142677 11:28941662-28941684 CTCTGAAATCACATGAGTCTTGG + Intergenic
1082644707 11:55708020-55708042 CTCTGTAATTTGATGTTTCTAGG + Intergenic
1083182890 11:60999365-60999387 CTATGTAATTAAATGTGGCTGGG + Intronic
1083668520 11:64288044-64288066 CTCTGTTGTTACCTGTGCCAGGG + Exonic
1084849975 11:71930765-71930787 AGCTGTAGTTACATATGTCAGGG + Intronic
1086950977 11:92890166-92890188 CTCTGCAATAGCATGTGTCTAGG + Intronic
1088312401 11:108473934-108473956 CTCTGTTATTAAAGGTGGCATGG - Exonic
1091077571 11:132634510-132634532 CTCAGTAGTTACATGCTTCAAGG + Intronic
1093166516 12:15810158-15810180 ATTTGGATTTACATGTGTCAGGG - Intronic
1093513813 12:19960994-19961016 CTCTATAATCCCCTGTGTCAAGG - Intergenic
1096047321 12:48574136-48574158 CTTGGTAATTACATGTGTATCGG - Intergenic
1097387739 12:58969689-58969711 TTTTGTACTTACATGTATCAAGG + Intergenic
1098352011 12:69572841-69572863 TACTGTAATTACATGAGTCTTGG + Intronic
1099083196 12:78212167-78212189 GTCTGAAAGTACATCTGTCATGG + Exonic
1099687656 12:85909932-85909954 GTATATATTTACATGTGTCATGG - Intergenic
1102459601 12:113092287-113092309 CCGTGAAATTATATGTGTCAAGG - Intronic
1104224483 12:126818399-126818421 CTCTCACATTACCTGTGTCACGG + Intergenic
1105553963 13:21427973-21427995 ACCAGTAATTACAAGTGTCAGGG - Intronic
1108252707 13:48582885-48582907 TTCTTTAACTACATGTCTCAAGG + Intergenic
1110961759 13:81635252-81635274 CTCTGTAATTCTTTGTATCATGG + Intergenic
1115156880 14:30351249-30351271 CCCTGTAAGCACATGTGACAGGG - Intergenic
1116863944 14:50016343-50016365 CACTGGAATTACAGATGTCAAGG + Intergenic
1119593607 14:75913387-75913409 CTCTGTAATTACCTCTATCATGG + Intronic
1120476610 14:84996993-84997015 TTCTGAATTTACATGTTTCATGG - Intergenic
1123147625 14:106149222-106149244 TTATGTAATTTCATGTCTCAAGG - Intergenic
1123969042 15:25487666-25487688 CTCTGTATTTCCATGATTCAGGG - Intergenic
1127026338 15:54811476-54811498 GAATGTAATTACATGTGTAAAGG - Intergenic
1127730586 15:61798516-61798538 CTCTGTTCTTTCATCTGTCATGG - Intergenic
1130740204 15:86591262-86591284 TTCTGTGATTACATGAGTAAGGG + Intronic
1131251152 15:90830926-90830948 CTCTGTTTTTAGATGTGTCATGG - Intergenic
1135224167 16:20641142-20641164 CTCTGAAATTCCTTCTGTCAGGG - Intronic
1136691118 16:32030215-32030237 TTATGTAATTTCATGTCTCAAGG + Intergenic
1136791706 16:32973776-32973798 TTATGTAATTTCATGTCTCAAGG + Intergenic
1136878110 16:33880154-33880176 TTATGTAATTTCATGTCTCAAGG - Intergenic
1138860288 16:60747718-60747740 CTCTTTAATTTCCTGTGTCGAGG + Intergenic
1141239777 16:82254796-82254818 CACTGTACTTACATTGGTCAAGG + Intergenic
1203093916 16_KI270728v1_random:1235237-1235259 TTATGTAATTTCATGTCTCAAGG + Intergenic
1144303950 17:13950352-13950374 CTCTGTAATTATCCCTGTCACGG - Intergenic
1144318504 17:14088718-14088740 GTTTATAATTTCATGTGTCAAGG + Intronic
1146582820 17:34054370-34054392 CTCTGCATTAACATGTTTCATGG - Intronic
1146611889 17:34313395-34313417 CTCTGTAAGTTCATGTTGCAAGG - Intergenic
1148914374 17:50962069-50962091 CTCAGGAATGACATGTGTGATGG + Intergenic
1149986341 17:61350155-61350177 CTCTGTAATGCCATGAGCCATGG - Intronic
1150721385 17:67617064-67617086 CTCTGTTATTAAATGTGTGCAGG - Intronic
1155577761 18:27266526-27266548 CACTGTAAGTATATGGGTCATGG + Intergenic
1156899655 18:42286241-42286263 CTCTGTTATTGCATTTTTCACGG - Intergenic
1158229491 18:55237966-55237988 CTCTGTATATACAAGGGTCAGGG + Intronic
1159074627 18:63666386-63666408 TACTGTAATTACATATATCAGGG - Intronic
1159249098 18:65850465-65850487 CTCTGTAAATACATGTAGCGAGG + Intronic
1160654354 19:254976-254998 CTTTGTAATTAGGTGTGTAAAGG + Intergenic
1161734188 19:5980524-5980546 CCATGTAAATACATGTGTCCTGG - Intergenic
1166883574 19:45943841-45943863 CTTGGTACTTACATGTGTCATGG - Intronic
925891199 2:8436369-8436391 CTCTGTGATTTCCTGTGTAAAGG + Intergenic
927986423 2:27414360-27414382 ATCTATAATTACATGCCTCAGGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929207958 2:39319742-39319764 CTTTGTAATTTCATTTGTCTAGG - Intronic
931231012 2:60374975-60374997 ATCTGTAATTTAAGGTGTCAAGG - Intergenic
931797963 2:65729925-65729947 CTCTGTTATAACATTTATCATGG + Intergenic
932994244 2:76829565-76829587 CTCTGTAATAACATGTAAAATGG + Intronic
933397147 2:81747604-81747626 TTGTGTCATTACATGTGTGATGG + Intergenic
935418580 2:102843932-102843954 CTTTGTAATTACCCCTGTCAGGG + Intergenic
939233829 2:139466077-139466099 CTCTGTGAATACATATGTAAGGG - Intergenic
943558081 2:189429388-189429410 CTCTCTAATTACCTGTGTCTTGG + Intergenic
947356404 2:229300453-229300475 CTCTGTTATTAAATGTCACAGGG + Intergenic
948496451 2:238352844-238352866 CTCTGTAATCACATTTGAAACGG - Exonic
1172510507 20:35497710-35497732 CTTAGTAATTCCATCTGTCAAGG - Exonic
1175608654 20:60332091-60332113 CTCTGTGATCAAATGTGGCAGGG + Intergenic
1177283060 21:19010071-19010093 CTCTCTAATGACATATGACATGG - Intergenic
1181368579 22:22398718-22398740 CTCTGTTAGTCCAGGTGTCAAGG + Intergenic
1181488165 22:23244689-23244711 CTCAGTAAGTACATTTGTCTGGG + Intronic
1183548269 22:38467052-38467074 CTGTTTAAATACATTTGTCATGG + Intergenic
949676360 3:6458419-6458441 CTCTGTAATTAATTATTTCAGGG + Intergenic
949690700 3:6634467-6634489 CTCTAAAATGACATGTGGCATGG + Intergenic
955232478 3:57111188-57111210 CTGTGTAATTACTTTTGTCCTGG - Intronic
955511340 3:59683448-59683470 ATCTGTAATTCCATGTGACAAGG + Intergenic
955651916 3:61203861-61203883 CTCTGTGAGTACATGTGTAAGGG - Intronic
956353336 3:68363132-68363154 CTTTGTAATAACATGAGCCAAGG - Intronic
960739406 3:120816679-120816701 CTCTTTATTTACAAGGGTCAAGG + Intergenic
961307177 3:125966566-125966588 CACTGAAATGACTTGTGTCAAGG - Intergenic
963072987 3:141320256-141320278 CTATGTAATTACCTGTGATATGG - Intergenic
964948939 3:162263020-162263042 CTCTGTAATGGCATGTGGGAAGG + Intergenic
967762035 3:193237098-193237120 CTCTGTAATTACATTTAGCAGGG + Intergenic
971336862 4:25731068-25731090 CTCTCTAGTTACAAGTGTCAGGG + Intergenic
976751756 4:88456809-88456831 CTCTGGAAATGCGTGTGTCAGGG + Intergenic
977651012 4:99469439-99469461 TTCTATAATTCCATGTGTCATGG - Intergenic
978652091 4:111018179-111018201 ATCTGAAATTACAGCTGTCAGGG - Intergenic
982950914 4:161694880-161694902 TTCAGTGATTACATGTGACAGGG - Intronic
988341487 5:29978058-29978080 CTGTATAATTAAATGTGTAAAGG - Intergenic
990722259 5:58709873-58709895 CTCTCTAATTAGCTGTGTGATGG + Intronic
992177687 5:74166582-74166604 CTCTTTATGTACATGTCTCATGG - Intergenic
993629720 5:90271418-90271440 CTTTGTGATTACTTGTTTCATGG + Intergenic
994985308 5:106925911-106925933 CTCTGGAATTACATATGTGACGG + Intergenic
996497917 5:124182729-124182751 CTCTGTAATCAGATGACTCAAGG - Intergenic
1001004851 5:168041169-168041191 CTCTGAAGTTGCATGTGTCTGGG + Intronic
1006300851 6:33192889-33192911 CTCTGTAATTACACGGGGCGGGG - Intergenic
1007346904 6:41237535-41237557 CTCTGAACTGAAATGTGTCAGGG + Exonic
1008000979 6:46359211-46359233 CTCTGTACTTTCCAGTGTCAAGG - Intronic
1009055015 6:58324718-58324740 GTTTGTAATTAAGTGTGTCATGG - Intergenic
1009236144 6:61125856-61125878 GTTTGTAATTAAATGTGTCATGG + Intergenic
1009489434 6:64270274-64270296 ATGTGTCATCACATGTGTCATGG + Intronic
1010492061 6:76488596-76488618 TTCATTAATTAAATGTGTCAAGG + Intergenic
1010811133 6:80299956-80299978 CTATGTCATTACATGTGATATGG - Intronic
1012075817 6:94684114-94684136 CTCTGTAATAACAGATCTCAAGG - Intergenic
1012343879 6:98162962-98162984 GTCTGTAATCAAATGTCTCATGG + Intergenic
1013673175 6:112427898-112427920 CTCTGTATTTACATTCCTCAGGG - Intergenic
1014541994 6:122687630-122687652 CTCTTTAATTTCTTTTGTCAGGG + Intronic
1020982760 7:15092515-15092537 CTTTGTAATTATATATGTAACGG - Intergenic
1021581357 7:22157249-22157271 CTCTGCTATTACATTTTTCATGG + Intronic
1021899673 7:25271707-25271729 AACTGTAATTACATGGGCCATGG + Intergenic
1022198360 7:28092152-28092174 CACTGTAATTACATATATAAAGG + Intronic
1022445268 7:30465183-30465205 CTCTGTAATGGCAGGTGACAGGG + Intronic
1026473873 7:70717493-70717515 GTGTGTATTTATATGTGTCAGGG + Intronic
1027832745 7:83201021-83201043 CTCTGTAATTATATGAGCTAAGG + Intergenic
1031324660 7:120379274-120379296 ATATGTAATAACATATGTCAGGG + Intronic
1031815302 7:126426307-126426329 TACTGTAATTACATCTGTTATGG - Intergenic
1035296377 7:157869031-157869053 ATTTGGAATTACACGTGTCAGGG - Intronic
1037243619 8:16805613-16805635 CTCTTTAATTAGATGTGTAGAGG + Intergenic
1039572340 8:38597679-38597701 CTCTTAAATTACATGAGGCAGGG + Intergenic
1045603183 8:103742469-103742491 CTCTATAATTATATCTGTAAGGG + Intronic
1045781522 8:105869559-105869581 CTCTCTATTTATATGTGTGATGG - Intergenic
1046505360 8:115130278-115130300 TTTTCTAATGACATGTGTCAAGG + Intergenic
1047431807 8:124799330-124799352 CTCTATAATTACATGTTTTGAGG + Intergenic
1049525440 8:143123569-143123591 ATGTGTGTTTACATGTGTCATGG - Intergenic
1050009892 9:1174592-1174614 CTCTGGAAATACATGGGTCATGG - Intergenic
1052744748 9:32429493-32429515 CTCTGCAATTACCTGTGTGATGG - Exonic
1055425722 9:76194258-76194280 ATCTGAAATTCCATTTGTCATGG + Intronic
1055744726 9:79430535-79430557 ATGTATAATTAAATGTGTCATGG - Intergenic
1056462630 9:86823055-86823077 CTCTTTAATTCCATGTCTCCTGG - Intergenic
1056507004 9:87267137-87267159 CTCTGTAATGATAAGGGTCATGG - Intergenic
1059896189 9:118868680-118868702 CACTGGTATTACATGTGTAATGG + Intergenic
1189808625 X:44760825-44760847 CTCTTTATTTACATATGTGAAGG - Intergenic
1190628803 X:52365229-52365251 CTCTGTAATTACATATTTCGTGG - Intergenic
1192892136 X:75401496-75401518 AAGTGTAATTACATGTGTGATGG - Intronic
1195346625 X:103956399-103956421 GTCTGTCATTGCATGTGTGATGG - Intronic
1195360817 X:104082442-104082464 GTCTGTCATTGCATGTGTGATGG + Intergenic
1202116441 Y:21472708-21472730 CTCTGTTATTTCTAGTGTCAGGG + Intergenic