ID: 919446148

View in Genome Browser
Species Human (GRCh38)
Location 1:197708074-197708096
Sequence CAGCGCGATTCCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919446148_919446156 30 Left 919446148 1:197708074-197708096 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 919446156 1:197708127-197708149 GCAAGGCGGCAACGAGGCTGGGG 0: 316
1: 1145
2: 1873
3: 1683
4: 815
919446148_919446153 24 Left 919446148 1:197708074-197708096 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 919446153 1:197708121-197708143 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
919446148_919446152 16 Left 919446148 1:197708074-197708096 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 919446152 1:197708113-197708135 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360
919446148_919446151 13 Left 919446148 1:197708074-197708096 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 919446151 1:197708110-197708132 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
919446148_919446154 28 Left 919446148 1:197708074-197708096 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 919446154 1:197708125-197708147 CTGCAAGGCGGCAACGAGGCTGG 0: 315
1: 1152
2: 1845
3: 1595
4: 741
919446148_919446155 29 Left 919446148 1:197708074-197708096 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 919446155 1:197708126-197708148 TGCAAGGCGGCAACGAGGCTGGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919446148 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG (reversed) Intronic
Too many off-targets to display for this crispr