ID: 919455761

View in Genome Browser
Species Human (GRCh38)
Location 1:197818221-197818243
Sequence TGCCATGCAGCCACTGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 3, 1: 7, 2: 36, 3: 80, 4: 394}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919455761_919455764 1 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455764 1:197818245-197818267 AAAGAGAGAATCTGTGCTTTGGG No data
919455761_919455770 27 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG No data
919455761_919455765 2 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455765 1:197818246-197818268 AAGAGAGAATCTGTGCTTTGGGG No data
919455761_919455768 8 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455768 1:197818252-197818274 GAATCTGTGCTTTGGGGGGATGG No data
919455761_919455766 3 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455766 1:197818247-197818269 AGAGAGAATCTGTGCTTTGGGGG No data
919455761_919455767 4 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455767 1:197818248-197818270 GAGAGAATCTGTGCTTTGGGGGG No data
919455761_919455763 0 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455763 1:197818244-197818266 CAAAGAGAGAATCTGTGCTTTGG No data
919455761_919455769 26 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455769 1:197818270-197818292 GATGGAGAGCATAGTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919455761 Original CRISPR TGCCATGCAGCCACTGCTGG AGG (reversed) Intergenic
900501109 1:3005049-3005071 TGCCACGCAACCCCAGCTGGAGG - Intergenic
900959209 1:5908717-5908739 GGCCAAGCAGCCGATGCTGGTGG - Intronic
901022565 1:6262481-6262503 TGCCAGCCTCCCACTGCTGGTGG - Intergenic
901054724 1:6443828-6443850 TGCCATGCTGCCCCTGCTGCCGG - Intronic
902000075 1:13185077-13185099 TGCCAGTCTGCCCCTGCTGGTGG - Intergenic
902295110 1:15461859-15461881 TGCCAGGCAGGCACTGAGGGAGG + Intronic
902297975 1:15481398-15481420 TGCCAGGCAGGCACTGAGGGAGG + Intronic
902381667 1:16055668-16055690 TGTCCTGGAGACACTGCTGGGGG - Exonic
902882431 1:19381432-19381454 TGCCAAGCAGATGCTGCTGGTGG + Intronic
903383654 1:22913307-22913329 GGGCAGGCAGCCACAGCTGGAGG - Intronic
903995809 1:27304928-27304950 GGCCATGCAGCCTCTACTTGAGG + Intronic
904330556 1:29755549-29755571 TGCCCTGCAGCCCCTGCTGGGGG - Intergenic
904416116 1:30362046-30362068 TGCCCTGCCGCCCCTGCTGGGGG + Intergenic
905107848 1:35574602-35574624 TGCCACCCACGCACTGCTGGCGG - Intronic
906059344 1:42938244-42938266 TGCCATGCATCCCCTCCTGGAGG - Intronic
906125899 1:43426716-43426738 TGCCGAGGGGCCACTGCTGGGGG + Exonic
906127788 1:43438145-43438167 TCCCATGCAGCTCCTGCTTGAGG - Intronic
907359676 1:53904415-53904437 TGCTATGCGGCAACTGCAGGTGG + Intronic
908175716 1:61553229-61553251 TTCCATGAGGCCACTGCTAGAGG + Intergenic
908397701 1:63741262-63741284 TGCCCTGCAGCCACTGCTGGAGG + Intergenic
908959030 1:69671856-69671878 TGCCATGTGGCCGCTGCTGGGGG + Intronic
909615582 1:77605185-77605207 TGCCTTGTGGTCACTGCTGGGGG - Intronic
909902965 1:81160872-81160894 TGCCATGTGGCCACTGCTGGGGG - Intergenic
910547210 1:88432248-88432270 CACCAAGCTGCCACTGCTGGGGG - Intergenic
911147129 1:94563117-94563139 AGGCATGCAGCCACTGTTGATGG - Intergenic
911664777 1:100539851-100539873 GGCCACGCAGCCACTGGTGTGGG + Exonic
912135763 1:106658788-106658810 TACCATGCCGCTGCTGCTGGGGG - Intergenic
914652932 1:149712624-149712646 TGCCGTGCAGGTACTGCTTGTGG - Intergenic
915049264 1:153050090-153050112 TGCCATGCTGCCTCTGCTCCTGG + Intergenic
915287512 1:154862385-154862407 AGCCACACAGCCAGTGCTGGAGG + Intronic
915356304 1:155256878-155256900 TGACAGGGAGCCACTGCTGATGG - Intronic
917387390 1:174491931-174491953 TGCCATGCAGCCACTGCTGGGGG + Intronic
917397045 1:174604396-174604418 TGCCATGCAGCTAATGCTAGGGG + Intronic
919377171 1:196808982-196809004 TGGCCTGCTGGCACTGCTGGGGG - Intergenic
919386880 1:196933883-196933905 TGGCCTGCCGGCACTGCTGGGGG - Intronic
919455761 1:197818221-197818243 TGCCATGCAGCCACTGCTGGAGG - Intergenic
921677352 1:217990987-217991009 TGCCAGGCATCCTCTGATGGTGG + Intergenic
921767537 1:218990154-218990176 TGCCATGCTGCTGCTGTTGGTGG - Intergenic
921769642 1:219021433-219021455 TGCCATGCAGCCACTGCTAAGGG - Intergenic
921818834 1:219593809-219593831 TGGCATGCAGTGACTGATGGAGG - Intergenic
922088952 1:222377512-222377534 TGCTCTGCATCCACTGCTGGGGG + Intergenic
922484673 1:225964219-225964241 GGCCAAGGAGCCAGTGCTGGTGG + Intergenic
922565488 1:226598751-226598773 TGCCATGCAGCCTTCACTGGGGG + Intronic
923557067 1:235009704-235009726 TGCCAAGGAGGCACTGCTGGTGG + Intergenic
924872944 1:248068350-248068372 TGTTCTGCAGCCACTGCTGCTGG + Intronic
1063357236 10:5412689-5412711 TGCCATGGAGCCCGAGCTGGCGG + Exonic
1065928512 10:30457934-30457956 AACCATGCAGCAATTGCTGGAGG - Intronic
1066471417 10:35701632-35701654 TGTCATGCCACCACTGCTGGTGG + Intergenic
1066552908 10:36579016-36579038 TGGCATGCACCCACTACTTGAGG + Intergenic
1067833991 10:49626707-49626729 GGCCATACAGACACTGCTAGGGG + Intronic
1068583794 10:58773614-58773636 AGCCATGCAGCCACTGCCAGGGG + Intronic
1068940993 10:62681216-62681238 TCCCATGCTGGCCCTGCTGGTGG + Intergenic
1069909866 10:71752453-71752475 TGCCATGCAGCCTGGCCTGGAGG - Intronic
1070556286 10:77530080-77530102 AACCATGTAGACACTGCTGGAGG - Intronic
1070942555 10:80359679-80359701 TGGCAGGCCGGCACTGCTGGGGG + Intronic
1071370267 10:84944154-84944176 TGCCATGCTGCTGCTGATGGTGG + Intergenic
1073684434 10:105736559-105736581 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1075194857 10:120347709-120347731 CACCATGCAGCCACTGCCAGGGG - Intergenic
1075496251 10:122922113-122922135 TACCATGTAGCCACTGCAAGGGG - Intergenic
1075719283 10:124575545-124575567 TGTCCTGCAGCCTCTCCTGGGGG + Intronic
1076024100 10:127098429-127098451 TGTCCTGCCGCCACTGCTGCTGG + Intronic
1077514784 11:2994958-2994980 TGACATGCAGCCAGAGCTGAGGG + Intergenic
1077858756 11:6156758-6156780 TGTCACGTGGCCACTGCTGGGGG - Intergenic
1078267026 11:9762670-9762692 TGTCAAGCTGCCTCTGCTGGAGG - Intergenic
1079003869 11:16779137-16779159 GGCAATGCGGCCGCTGCTGGGGG + Intronic
1079571713 11:21952088-21952110 CACCATGCCACCACTGCTGGGGG - Intergenic
1079760152 11:24319198-24319220 TGCCATGCAGCCACTCCTAGGGG + Intergenic
1080350992 11:31385894-31385916 CGCCATGTGGCCACTGCAGGGGG - Intronic
1080713375 11:34772229-34772251 TGCCATGCTGCCACAGCTGCTGG - Intergenic
1081039474 11:38192587-38192609 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1082894555 11:58176294-58176316 TGCCATGCACCCACTGAGTGGGG - Intronic
1082909440 11:58353857-58353879 TGCCCTGTAGCTATTGCTGGAGG + Intergenic
1083888013 11:65582113-65582135 TGCCCTGCAGGCTCCGCTGGGGG - Exonic
1084088134 11:66864154-66864176 TGCCACGCAGTCACTGCTACTGG + Intronic
1085261244 11:75205899-75205921 GGCCAGGAAGCCACTGCTGGTGG - Exonic
1085562651 11:77486582-77486604 TGCCATGTGGCCACTGCCAGGGG - Intergenic
1085981741 11:81733865-81733887 CACCATGTAGCCACTGCTGGGGG + Intergenic
1086611112 11:88757341-88757363 TGCCATGCCTCTGCTGCTGGTGG + Intronic
1086934285 11:92727861-92727883 TGCCATGCCGCCACTGAGGCTGG + Intronic
1088274057 11:108065648-108065670 TGCCATACAGCTGCTGCTGGGGG + Intronic
1088985073 11:114898757-114898779 CACCATGCAGCCACTGCTAGGGG - Intergenic
1089572162 11:119418129-119418151 GGGCAGGCAGGCACTGCTGGAGG + Exonic
1090217581 11:124983761-124983783 TGCCACGCTGCCACTGCTGCTGG - Intronic
1090398602 11:126434727-126434749 TGCCCTGCAGCCTCAGCTTGGGG + Intronic
1090482868 11:127083497-127083519 TGTTCTGCAGCCCCTGCTGGTGG + Intergenic
1090948387 11:131451510-131451532 TCCCATGCAGGAACTGCTGTGGG + Intronic
1091014144 11:132034575-132034597 TACCATCCAGCCATTGCTGAGGG - Intronic
1091227236 11:133964935-133964957 GGCCCTGGAGCCACAGCTGGAGG + Intergenic
1091270798 11:134310523-134310545 AGCCATGCAGTCTCTGCAGGAGG - Intronic
1091331542 11:134735162-134735184 TGCTTTGGAGCCACCGCTGGGGG - Intergenic
1093124162 12:15307847-15307869 TGCCATGCTGCCACTTCCAGGGG + Intronic
1093537811 12:20243698-20243720 CACCATGCTGCCGCTGCTGGGGG - Intergenic
1093619879 12:21276688-21276710 TGCCATGTGGCCACTGCTGGGGG - Intronic
1094108793 12:26839344-26839366 TGGCAGGCTGGCACTGCTGGGGG - Intergenic
1095108221 12:38260965-38260987 TGTCTTGCAGCCAATCCTGGAGG - Intergenic
1095603110 12:44037243-44037265 AGCCATCCAGCCACAGCTGCAGG + Intronic
1095624989 12:44304147-44304169 TGCCACGTGGCCACTGCTGGGGG - Intronic
1095834115 12:46618334-46618356 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1096197110 12:49655820-49655842 CGACATCCAGCCACAGCTGGTGG - Intronic
1096513840 12:52145808-52145830 TGCCATAAAGCCACTGGTGCTGG + Intergenic
1096585176 12:52615227-52615249 AGCCCAGCACCCACTGCTGGGGG + Intronic
1097409009 12:59227610-59227632 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1097426146 12:59446758-59446780 TGCCATGCAACCTCTGCTCAGGG + Intergenic
1098038486 12:66331198-66331220 AGACATGCTGCCAGTGCTGGCGG - Exonic
1099024389 12:77447558-77447580 CTCCATGCAGCCACTGCTGGAGG - Intergenic
1099394598 12:82121743-82121765 TGCCATGCTGCCACCACTGCTGG + Intergenic
1099428214 12:82550507-82550529 TGTTCTGCAGCCTCTGCTGGTGG - Intergenic
1099697869 12:86044358-86044380 CACCATGCTGCCACTGCTGCTGG - Intronic
1101252108 12:102946606-102946628 TGCCATGCGTCCACTGCTGCTGG + Intronic
1102111903 12:110371352-110371374 CTCCCTGCAGCCACAGCTGGGGG - Intergenic
1102671666 12:114624563-114624585 TGACATGCAGCCACTGCTCTTGG - Intergenic
1105603192 13:21905586-21905608 TGCCATGCAGCCCCCGCCTGGGG + Intergenic
1105884009 13:24627158-24627180 TCCATTGCAGCCACAGCTGGGGG - Intergenic
1106350105 13:28921882-28921904 CACCATGCAGCCACTGCCAGGGG + Intronic
1107973672 13:45669354-45669376 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1108447643 13:50525728-50525750 TGCTCTCCAGCCACTTCTGGTGG - Intronic
1108997140 13:56748274-56748296 TGCCACACAGCCACTGCCAGGGG + Intergenic
1109057089 13:57564539-57564561 GGCTATGCAGCCAGTGGTGGTGG + Intergenic
1109100836 13:58181706-58181728 TGCCATGGAGCCACTGCTAGGGG + Intergenic
1109569237 13:64164508-64164530 TGCTATGCTGCCACTGTTGCTGG - Intergenic
1111322667 13:86650897-86650919 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1111572194 13:90103623-90103645 TGCCATATGGCCACTGCTGGGGG + Intergenic
1112131027 13:96524175-96524197 TGTTCTGCAGCCTCTGCTGGTGG - Intronic
1112693497 13:101920684-101920706 TGTCATGCATCCACTGTGGGGGG - Intronic
1115723250 14:36185394-36185416 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1115884412 14:37955698-37955720 TGTCATTCTGCCACTACTGGGGG + Intronic
1116021753 14:39469672-39469694 TGCCATGCAGCTGCTGCTGGAGG + Intergenic
1116336764 14:43666387-43666409 TGCCATGCTGCCACTGCCACTGG + Intergenic
1117280404 14:54234723-54234745 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1117504556 14:56389158-56389180 TGCCACATGGCCACTGCTGGAGG + Intergenic
1117607117 14:57441005-57441027 TGCCATGTGGCTACTGCTGGGGG + Intergenic
1117727332 14:58687451-58687473 TCGAGTGCAGCCACTGCTGGGGG + Intergenic
1117902676 14:60551252-60551274 TGGCATTCAGCCACTGGTGTGGG + Intergenic
1118071336 14:62249625-62249647 TGCCATACTGCTGCTGCTGGGGG - Intergenic
1118096794 14:62546328-62546350 TGCCATGTGGCCACTGCCAGGGG - Intergenic
1118241292 14:64060979-64061001 TGCCATGCTGCTGCTGCTGGGGG + Intronic
1118348947 14:64960013-64960035 TGCCATGCAGCCATGGCCTGAGG + Intronic
1119769095 14:77209283-77209305 CTCCCTGCAGCGACTGCTGGAGG + Intronic
1120971474 14:90212047-90212069 TGTCATTCTGCCCCTGCTGGGGG + Intergenic
1121526360 14:94621979-94622001 TGCCATGCAGCCACTGCAGCTGG + Intronic
1122112835 14:99514042-99514064 TGCCTTGCAGTCGCTGCGGGTGG - Exonic
1122822684 14:104355128-104355150 TGCCGGGGAGCCACCGCTGGTGG - Intergenic
1123106772 14:105845438-105845460 CGCCTTGGCGCCACTGCTGGAGG + Intergenic
1125537786 15:40452576-40452598 TCCCAGGCAGCCTCTGCTTGTGG + Intronic
1126660841 15:51031520-51031542 TGCCACGTGGCCAGTGCTGGGGG + Intergenic
1127132517 15:55882318-55882340 TGCCATACAGCCACTGCCAGGGG - Intronic
1128943212 15:71805378-71805400 TCCCATGCAGCCATTGCAGCTGG - Intronic
1130026789 15:80277148-80277170 TGCAATGTGGCCACTGCTGTTGG + Intergenic
1131218762 15:90562931-90562953 TGCCCAGCAGCCACTGCAAGGGG - Intronic
1131315247 15:91329812-91329834 CGCCATGTGGTCACTGCTGGGGG + Intergenic
1131346865 15:91657574-91657596 TGGGATGCAACCACTGCTAGTGG + Intergenic
1132797818 16:1733952-1733974 TACCACACAGCCACTGCTGCTGG - Intronic
1134300020 16:12982556-12982578 TACCATGCATGCCCTGCTGGGGG - Intronic
1134407172 16:13970630-13970652 TGCCACACAGCCACTGCTGGGGG + Intergenic
1135304620 16:21357366-21357388 AGCCAAACAGCCACTGCTGTTGG + Intergenic
1136283203 16:29226299-29226321 AACCATGCAGCCTCAGCTGGTGG + Intergenic
1136389308 16:29952351-29952373 TGCCATGCAGCTACTGCTAGGGG + Intronic
1137543022 16:49377688-49377710 AGCCCTGCAGCCACTGCTGTGGG - Intronic
1138012690 16:53397627-53397649 TGCCAGTCTGCCTCTGCTGGGGG - Intergenic
1138228868 16:55323752-55323774 TGCCCCGCGGCCACTGCGGGAGG + Exonic
1139257027 16:65551963-65551985 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1139751025 16:69108906-69108928 TACCCTGCACCCACTCCTGGAGG - Intronic
1140408944 16:74729885-74729907 AGTCAGGCAGCCACTGCAGGTGG + Intronic
1142063060 16:88043190-88043212 AGCCAAACAGCCACTGCTGTTGG + Intronic
1142555075 17:769630-769652 TGCCCTGGAACCACTGCTGGTGG - Intronic
1142919130 17:3169297-3169319 CACCATGTAGCCACTGCTGGGGG - Intergenic
1143884493 17:10055630-10055652 GCCCATTCAGCCACCGCTGGAGG + Intronic
1144835889 17:18156583-18156605 GGCCATGCAGCCAAGGCAGGAGG - Intronic
1146827943 17:36040323-36040345 TGACATGCACACACTGCTGCAGG - Intergenic
1147245150 17:39115438-39115460 TGCCATGCAGAATCTGCTGCAGG + Intronic
1149180738 17:53932890-53932912 TGCCATGCAGAAACTGCCAGGGG + Intergenic
1149565456 17:57637797-57637819 TGCCATCCTGCCATAGCTGGCGG - Intronic
1150541382 17:66103774-66103796 TGCCATGTAGCCACTGCTGGGGG - Intronic
1151394499 17:73813282-73813304 GGCCAGGGTGCCACTGCTGGTGG + Intergenic
1152118492 17:78403635-78403657 GGGCATGCAGCATCTGCTGGCGG - Exonic
1152431098 17:80248628-80248650 TGCCATGGAGGCTCTGCGGGAGG + Exonic
1153048313 18:877069-877091 GGCCATGCAGCATCTGCTGACGG - Intergenic
1153075510 18:1157484-1157506 TACCAAGCTGCCACTGCTGGGGG - Intergenic
1156094146 18:33509563-33509585 TGCCATGGGGCCACTGCCTGGGG - Intergenic
1156216443 18:35003152-35003174 TCCCATGCAGCCTTTGCTTGTGG - Intronic
1156915472 18:42461426-42461448 TGCCAGGCAGGCCATGCTGGGGG - Intergenic
1157879188 18:51304059-51304081 TGCCACACAGCCACTGCCAGGGG - Intergenic
1159092150 18:63861334-63861356 TGCCATGTGGCCCCTGCTGGGGG + Intergenic
1159224912 18:65521896-65521918 TGCCACCCAGCCACTGCTGAGGG - Intergenic
1159394642 18:67839639-67839661 TCCCATGCTGCCACTGCCAGGGG + Intergenic
1160225615 18:77008807-77008829 TGACATGCAGCCACACCTGGCGG + Intronic
1160541345 18:79625303-79625325 AGACATGCAAGCACTGCTGGCGG - Intergenic
1161875327 19:6904105-6904127 TGCAATGCAGCCACAGCTGTAGG - Exonic
1163126776 19:15248469-15248491 TGCCAGGCAGGCACTGGTGAAGG - Intronic
1166259052 19:41625391-41625413 GGCCCTGCAGACACTGATGGCGG - Intronic
1166553056 19:43679585-43679607 TGCCAGAAAGCCACTGCTGCTGG + Intergenic
1167196757 19:48034293-48034315 GGCCATGCAGAGACTCCTGGGGG - Exonic
1167410092 19:49339344-49339366 TGTTGTGCAGCCACTTCTGGAGG - Exonic
1167508233 19:49882310-49882332 TGCCCTGCAGCCACAGCCTGAGG + Exonic
925054426 2:846250-846272 TGGCATAGAGCCACTGCTGGAGG - Intergenic
926197714 2:10773816-10773838 TGCCCTGGGGCCCCTGCTGGGGG + Intronic
926568695 2:14506744-14506766 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
927208988 2:20627252-20627274 TGGCATGGAGCTGCTGCTGGGGG - Intronic
927779337 2:25926948-25926970 TGAGATCCAGCCACTCCTGGTGG + Exonic
928269250 2:29841599-29841621 TAGCAGGCAGCCTCTGCTGGGGG + Intronic
928483944 2:31710942-31710964 TGCCATGTGGCCAGTGATGGGGG - Intergenic
928680881 2:33700917-33700939 TGCCATGCTGCCATGGCTGTGGG + Intergenic
928715660 2:34056746-34056768 CACCATGCAGCCACTGCTGGGGG + Intergenic
929281848 2:40088253-40088275 TGCCACGGTTCCACTGCTGGGGG + Intergenic
930025951 2:47029232-47029254 TGCCATGGAGCAGCTGCAGGAGG + Exonic
930727223 2:54694181-54694203 TGCCATGCTGCTACTGCCAGGGG - Intergenic
930801069 2:55442943-55442965 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
931012298 2:57930416-57930438 GGCCACGCAGCCACTGCCAGGGG + Intronic
931074049 2:58689314-58689336 TGTTCTGCAGCCTCTGCTGGTGG + Intergenic
931086063 2:58831761-58831783 TGATATGCAGCCACTGCCAGAGG + Intergenic
931582893 2:63796508-63796530 TGCCACACAGCCACTGCCAGGGG - Intronic
931958537 2:67455682-67455704 TGCCATTCCTCCACTGCTTGGGG - Intergenic
932045570 2:68345679-68345701 AGCCATGCAGCCACCGCAGCAGG + Intergenic
932561405 2:72874191-72874213 TGCCATTCAGACCCTGCTGATGG + Intergenic
932575023 2:72958089-72958111 TGCTTTGCAGCCAGAGCTGGAGG + Intronic
934105895 2:88694135-88694157 TGCCAAGCAGGCCCTGCTAGAGG - Intronic
934928855 2:98403995-98404017 TGCCATGCAGCTGCTGCTGAGGG - Intergenic
935863294 2:107357944-107357966 TGCAATGCAGTCACTGCAAGTGG + Intergenic
937628234 2:124068236-124068258 TGCCACACAGCCACTGCCAGGGG - Intronic
938236532 2:129710618-129710640 AGCTTTGCAGCCACTGCTGTTGG + Intergenic
938445505 2:131374129-131374151 TGTTCTGCAGCCACTGCTGCGGG + Intergenic
938680962 2:133689555-133689577 GGTGATGCTGCCACTGCTGGTGG + Intergenic
938990442 2:136622926-136622948 TGCCATGCTGCCACAGCTGCTGG - Intergenic
939036125 2:137133408-137133430 TGCCATGCAGACAATGTAGGAGG + Intronic
939089109 2:137757899-137757921 CACCATGCTGCCACTGCTGCTGG + Intergenic
940429891 2:153576603-153576625 CACCATGCAGCCCCTGCTGGGGG + Intergenic
942838346 2:180328978-180329000 CACCATGCTGCTACTGCTGGGGG - Intergenic
942862672 2:180635330-180635352 TGCCATGCGGCCACTGCTAGGGG - Intergenic
943099666 2:183472273-183472295 TGCCACGCCACCATTGCTGGTGG + Intergenic
943302609 2:186222950-186222972 TGTCATGTAGCCACTGCTGGGGG - Intergenic
943520615 2:188944613-188944635 TGGCAGGCTGGCACTGCTGGGGG + Intergenic
943843115 2:192604603-192604625 AGCCCTGCTGCCACTGCTGGTGG - Intergenic
944279088 2:197873645-197873667 TGTCATACAGCCAAAGCTGGGGG + Intronic
944550140 2:200838268-200838290 TGGCATGTGGCCACTACTGGGGG - Intergenic
944867138 2:203873661-203873683 TGCAAGGAAGCCACAGCTGGTGG + Exonic
944954928 2:204798193-204798215 TGCCAAGCAGCGGCTGCTGGGGG - Intronic
945063486 2:205928486-205928508 TTCCATGCAGACACTGTGGGTGG - Intergenic
945869155 2:215208045-215208067 TGGCAGGCTGGCACTGCTGGAGG - Intergenic
947009283 2:225547662-225547684 TGCCATGTGGCCACTGCTGGGGG + Intronic
947491899 2:230602668-230602690 TGTCATGCAGGCACTGCAGCTGG - Intergenic
948225766 2:236308280-236308302 TGACAGGCATCCTCTGCTGGGGG + Intergenic
1168747800 20:259067-259089 TCCCATACAGCCAGTGCAGGTGG + Exonic
1169353114 20:4886066-4886088 TGCCATGCAGCCACAGCCAGTGG + Intronic
1169778538 20:9283231-9283253 TTGCATGCAGCCTCAGCTGGGGG - Intronic
1170514985 20:17120073-17120095 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1170698920 20:18685549-18685571 TGCCATGGAGCCACTGAAGCTGG - Intronic
1170949282 20:20921440-20921462 TCCCAGGCACCAACTGCTGGTGG + Intergenic
1171065475 20:22010272-22010294 TGGTCTGCAGCCACTGCTGCTGG + Intergenic
1171068724 20:22045748-22045770 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1172359504 20:34302675-34302697 TGCAAGGCTGCCCCTGCTGGAGG + Intronic
1173709705 20:45143835-45143857 TGCCATGCAGCCTCTGCCGGGGG + Intergenic
1173718918 20:45236201-45236223 TGGCATTCAGCCACTGGTGTGGG + Intergenic
1174206844 20:48846589-48846611 AGCCAGGCAGCCGCTCCTGGCGG + Intergenic
1174695419 20:52551877-52551899 TGCCATGTGGCCACTGTGGGGGG + Intergenic
1174938413 20:54897651-54897673 TGCCATGCAGCTGCTGCTGAGGG - Intergenic
1175069898 20:56324482-56324504 TGCCAAGCAGGCCCTGCTCGTGG + Intergenic
1175632280 20:60551257-60551279 CGCCACACAGCCACTGCTGGGGG + Intergenic
1175784113 20:61701418-61701440 TTCCATGCATCCAGGGCTGGTGG + Intronic
1176199829 20:63855256-63855278 TGCCCTGTGGCCACAGCTGGGGG - Intergenic
1176199860 20:63855353-63855375 TGCCCTGCGGCCACAGCTCGGGG - Intergenic
1179481097 21:41679176-41679198 AGCCTTGCAGCTTCTGCTGGTGG + Intergenic
1180147816 21:45930997-45931019 TGCCATGCTGCCACTGTGGCTGG + Intronic
1181342785 22:22196048-22196070 GGCAATGCTGCCACTGCTGCCGG - Intergenic
1181868819 22:25881594-25881616 TGCCATGCATCGGCTGTTGGGGG + Intronic
1183015959 22:34986939-34986961 TCCTATGCAGCCACTGGTGAGGG - Intergenic
1183317073 22:37142662-37142684 TGCCATGGAGCCAGTGGGGGAGG - Intronic
1184262633 22:43328175-43328197 TGCCCTGAAGCCCTTGCTGGGGG + Intronic
949840586 3:8315710-8315732 TGCTGTGCAGCTACTGCTGTTGG - Intergenic
950335162 3:12187531-12187553 TGCCAGGGAGCTGCTGCTGGAGG - Exonic
950459683 3:13113715-13113737 TGCCATGCGGCCCACGCTGGGGG - Intergenic
951495175 3:23317438-23317460 CACCATGCAGTCTCTGCTGGTGG + Intronic
951551876 3:23882724-23882746 TGGCAGGCTGGCACTGCTGGGGG + Intronic
951843282 3:27058227-27058249 TGGCAGGCAGCAACTGCTGAAGG - Intergenic
952512516 3:34071453-34071475 TTCCATGAAGCCACTGCAGAAGG + Intergenic
952932806 3:38373229-38373251 AGCCCTGAAGCCACTCCTGGAGG + Intronic
953565404 3:44027880-44027902 TGCCTTCCAGCCACTGTTGTAGG + Intergenic
956139028 3:66127132-66127154 TGGAATACAGACACTGCTGGAGG - Intergenic
957087170 3:75691926-75691948 CACCATGTAGCCACTACTGGTGG - Intergenic
958085412 3:88799111-88799133 CACCATGCTGCCACTGCCGGAGG + Intergenic
958705464 3:97648860-97648882 TGTCATCAAGTCACTGCTGGTGG + Intronic
959344364 3:105174182-105174204 TGCCAGGCAGCCACAGCCAGTGG - Intergenic
961652494 3:128423885-128423907 TGCCCTGCAGCCAATGCCTGGGG + Intergenic
961952183 3:130761761-130761783 TACCATGCAGCCACTGCCAGGGG - Intergenic
962291847 3:134144178-134144200 TGCCATGGGGACACAGCTGGGGG + Intronic
963520982 3:146359700-146359722 TGCCATGAAGCCACTTATGAGGG - Intergenic
964021667 3:152021028-152021050 TGCCATGCAACCACTGCTGGGGG - Intergenic
964325656 3:155542740-155542762 TGTTCTGCAGCCACTGCTGCTGG + Intronic
964398563 3:156273569-156273591 TGCCATGCAGCTGCTGCTGTGGG + Intronic
964686659 3:159403437-159403459 TGCCATACAGCCACTGCCAAAGG - Intronic
964803984 3:160587093-160587115 CACCATGCAGCCACTGCTGGGGG - Intergenic
964993502 3:162844802-162844824 TGGCAGGCTGGCACTGCTGGGGG + Intergenic
965035251 3:163429948-163429970 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
965099324 3:164276752-164276774 TGCCATGTGGCCACTGCCTGCGG - Intergenic
966328900 3:178789551-178789573 TGCCATGCAGCTTCTGCCAGGGG - Intronic
967294196 3:187949413-187949435 TGTCTTGCAGCCACTCCAGGAGG - Intergenic
967619554 3:191616438-191616460 AGCCAAGCAGCCACTGGAGGTGG + Intergenic
967677348 3:192316408-192316430 TGCCATGCAGCCACTAATGGGGG - Intronic
969053438 4:4387665-4387687 CACCAAGCAGCCGCTGCTGGAGG + Exonic
969088541 4:4674961-4674983 ACTCATGCAGCCACTGCTAGTGG - Intergenic
969315933 4:6381289-6381311 TGCCCTGCAGCCAGTGCAGAGGG - Intronic
969381560 4:6802363-6802385 GGCCATGCAGCCCCAGCTGCTGG - Intronic
969657406 4:8506264-8506286 TGCCCTGCTGACACTGCTGAGGG + Intergenic
969683777 4:8657540-8657562 TGCTGTTCAGGCACTGCTGGGGG + Intergenic
970207213 4:13666973-13666995 TGCCAGGCAGCCAGTGCTGAGGG + Intergenic
971914678 4:32852056-32852078 TGCCATGTGGCCATTGCTGGGGG + Intergenic
972271206 4:37512081-37512103 TACCATGTGGCCACTGCTGAAGG + Intronic
972909438 4:43796851-43796873 TCCCATGCTGCCACTGCAGAAGG - Intergenic
973227397 4:47801956-47801978 TGCCACACACCCACTGCTGGAGG - Intronic
973592565 4:52457867-52457889 TGCCCTGCAGCCTTGGCTGGTGG - Intergenic
973735771 4:53870309-53870331 TGCCATACAGCCATTGTCGGAGG - Intronic
973784609 4:54323354-54323376 TGCAATGCAGTCACTGGTCGTGG + Intergenic
974240287 4:59237884-59237906 TACCATACTGCCACTGCTGCTGG - Intergenic
974609207 4:64193262-64193284 TACCACATAGCCACTGCTGGGGG + Intergenic
974774521 4:66462639-66462661 TGTTCTGCAGCCTCTGCTGGTGG - Intergenic
975250127 4:72169059-72169081 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
975796875 4:78015397-78015419 TGCCAGCCAGCAGCTGCTGGAGG - Intergenic
975829732 4:78356695-78356717 TGCCATGAAACCCTTGCTGGAGG - Intronic
976082951 4:81376079-81376101 TGACATGCAGCCACTGCCAGGGG + Intergenic
977527951 4:98166923-98166945 TGCCATGAAGCTACTGCCAGGGG + Intergenic
978478769 4:109163566-109163588 TGCCATGCAGCCTGTGCAGCAGG - Intronic
978859258 4:113429841-113429863 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
980875248 4:138655828-138655850 TGTCATGTTCCCACTGCTGGTGG - Intergenic
980956514 4:139434073-139434095 TGCCACGTGGCCACTGCTGGGGG + Intergenic
981150968 4:141378620-141378642 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
981530921 4:145752991-145753013 TGCCACGTGGCCGCTGCTGGGGG + Intronic
981728728 4:147875160-147875182 AGCCACGCAGCCACTGCTGGAGG - Intronic
983166076 4:164478412-164478434 CACCATGCAGCCTCTACTGGGGG + Intergenic
983492997 4:168411366-168411388 TGCCATGTGGCCACTGCTGGAGG - Intronic
983657844 4:170100980-170101002 TGCCACACAGCCACTGCTGAGGG - Intergenic
984220071 4:176964397-176964419 TGCCATGTTGCCACTGCCAGTGG - Intergenic
984918111 4:184741379-184741401 TGGCAGGCCGGCACTGCTGGGGG - Intergenic
985229336 4:187798526-187798548 TGCCCTGCAGCTGCTGCTGGAGG - Intergenic
985947188 5:3194970-3194992 TCCCATGCAGCCCCTGCAGAAGG + Intergenic
986963598 5:13244361-13244383 TGGCAGGCCGGCACTGCTGGGGG - Intergenic
987631506 5:20478458-20478480 GGCCATGCAGTAACTGCTGTGGG + Intronic
988384069 5:30539112-30539134 TGCCATACAGCTGCTGCTGGGGG - Intergenic
988855910 5:35228381-35228403 TGCCTTGCTGGCACTGCTAGTGG + Intronic
988880346 5:35495084-35495106 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
989732569 5:44665338-44665360 TTTCATGCAGCCTCTGCTGCAGG - Intergenic
990622217 5:57571818-57571840 TATCATGCAGCCACTGCTGGAGG - Intergenic
991621460 5:68549706-68549728 TCCCATCCAGCCTCTGCTGTGGG - Intergenic
992531919 5:77660166-77660188 TGTCATGCAGCCACTGCTGTGGG + Intergenic
993582186 5:89676902-89676924 CACCATGCTGTCACTGCTGGAGG - Intergenic
994028465 5:95113425-95113447 CACCATGCAGCCACTGCTTGGGG - Intronic
994614685 5:102089538-102089560 CACCATGCTGCCACTGCTGGGGG + Intergenic
994970564 5:106731284-106731306 TGCCATGCTGCCACTGCTGCTGG + Intergenic
995290385 5:110444418-110444440 TACCATGTAGCCACAGCTGGGGG + Intronic
995488060 5:112659002-112659024 TGCCATGCTGCCATGGCTGCTGG + Intergenic
996000479 5:118356035-118356057 TGCCATGCAGCCCCATCTGGGGG + Intergenic
996259192 5:121445363-121445385 TACCATACAGCCACTTCTAGAGG - Intergenic
996931748 5:128897007-128897029 TGCCATGCTGCCGCTGCTGGAGG + Intronic
996956283 5:129187053-129187075 AACCATGCAGCCACTGCCGGGGG - Intergenic
997002922 5:129784034-129784056 TGCCATGTGGCCACTGCTGGAGG - Intergenic
997087501 5:130818473-130818495 TGCCAGTCTGCCCCTGCTGGGGG - Intergenic
997751255 5:136347968-136347990 TGCAATGAAGCACCTGCTGGTGG + Intronic
998058024 5:139096084-139096106 TACCATACTGCCACTGTTGGGGG - Intronic
999025895 5:148231338-148231360 TGTCAGGCTGCCCCTGCTGGGGG - Intergenic
999542348 5:152587191-152587213 TGTTCTGCAGCCTCTGCTGGTGG + Intergenic
999849611 5:155523950-155523972 TGCCACTTGGCCACTGCTGGGGG + Intergenic
1000154227 5:158534851-158534873 AGACATGAAGGCACTGCTGGAGG - Intergenic
1001298388 5:170515390-170515412 TATCATGTAGCCTCTGCTGGAGG + Intronic
1002538968 5:179893687-179893709 TCCCCTTCAGCCACTGGTGGGGG - Intronic
1002560271 5:180076921-180076943 TTACCTGCAGCCACAGCTGGGGG - Intergenic
1002706407 5:181163512-181163534 ATCCAAGCAGCCACTGCTGTTGG - Intergenic
1002707108 5:181169413-181169435 ATCCAAGCAGCCACTGCTGTTGG - Intergenic
1002707586 5:181173070-181173092 TTCCTAGCAGCCACTGCTGTCGG - Intergenic
1004095532 6:12550030-12550052 TGCTCTGCAGCCACCGCTGCTGG + Intergenic
1005037537 6:21570402-21570424 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1005117723 6:22356594-22356616 TGGCAGGCTGGCACTGCTGGGGG + Intergenic
1006732311 6:36245574-36245596 TGCCTTCCAGGCACTGCTGCAGG + Intronic
1006794252 6:36721898-36721920 TGGCATGCAGGTCCTGCTGGAGG - Exonic
1007777924 6:44234160-44234182 GGGCATGAAGCCACGGCTGGAGG - Intergenic
1008062654 6:47014765-47014787 TCCCCTGTAGCCACTGCTGCAGG + Exonic
1008214918 6:48777453-48777475 CACCATGCCACCACTGCTGGGGG - Intergenic
1008848693 6:55997764-55997786 TGCCATGCAGCTGCTGCCAGGGG + Intergenic
1009566848 6:65320849-65320871 TGGCATGCAGTGACTGATGGAGG + Intronic
1010530279 6:76959711-76959733 TGTCATTCTGCCCCTGCTGGGGG - Intergenic
1010838688 6:80622555-80622577 CGCAGTGCAGCCACTGCTGGGGG - Intergenic
1011270955 6:85579555-85579577 TGACATGTGGCCACTTCTGGGGG - Intronic
1011397211 6:86922010-86922032 TGTCCTGCAGCCACTGCTGCTGG + Intergenic
1011564818 6:88663574-88663596 TGCCATGCATCCTCTGATGTGGG - Intronic
1012265060 6:97131727-97131749 TCCCTTGCAGCTGCTGCTGGGGG + Intronic
1013908442 6:115245886-115245908 TGCCCTGTAGCCACTGCCAGGGG - Intergenic
1014430529 6:121365331-121365353 TGGCATGCAGTCACTGCTTGCGG - Intergenic
1016054851 6:139567570-139567592 TGCCATGCAGCCACTGCCAGGGG + Intergenic
1016061701 6:139637279-139637301 TGCCATGCAGTCACTGCTGTGGG + Intergenic
1016237681 6:141887737-141887759 TGCCATGCTGCCACAGCTGCTGG + Intergenic
1016245040 6:141970371-141970393 TGTTATGCAGCCACCGCTGCTGG + Intergenic
1016453566 6:144209170-144209192 CACCATGCTGCCACTGCTGCTGG - Intergenic
1016841698 6:148532266-148532288 TGCCATGTAGCCCAGGCTGGTGG + Intronic
1017635654 6:156440514-156440536 TGTCAAGGAGCCAGTGCTGGAGG - Intergenic
1017882564 6:158572088-158572110 GGCCATGCAGGCCCTGCTGGGGG + Intronic
1017885035 6:158591923-158591945 TGCCATTCTGCCATTGCTGATGG + Intronic
1017950811 6:159133201-159133223 TGTAATGCAGCCCCTGGTGGGGG - Intergenic
1019556463 7:1633916-1633938 TGACATGCAGCCCCTGGTGGGGG + Intergenic
1019780925 7:2939213-2939235 TACCAGGCAGCCACTCCTGGGGG + Intronic
1020153647 7:5703454-5703476 AGCCATGCAGCTACTGTAGGAGG + Intronic
1020367962 7:7400482-7400504 GGCCATGCAGACTCTGCTAGGGG - Intronic
1020574942 7:9914047-9914069 TGCCATGTGGCCACTGCTGAGGG + Intergenic
1020726125 7:11817339-11817361 AGCCATGCAGGCAATGCTGGAGG - Intronic
1020774074 7:12431648-12431670 TGTTCTGCAGCCTCTGCTGGTGG - Intergenic
1021884994 7:25129482-25129504 TGCCATGTGGCCACTGCTGGGGG + Intergenic
1023339739 7:39207382-39207404 TTCCTTGCAGCCACTTCTGACGG + Exonic
1023716128 7:43046253-43046275 TACCATGCAGCCACTGCTGGGGG - Intergenic
1024662540 7:51511863-51511885 TACCATGTAGCCGCTGTTGGGGG + Intergenic
1027131057 7:75591752-75591774 GGCCATGTAGCTACTGCTGAGGG + Intronic
1027141627 7:75661786-75661808 TGCCTTGGAGCCACTGGGGGAGG + Intronic
1027604756 7:80287254-80287276 TGCCATGCAGCCACTGCCAGGGG - Intergenic
1028181374 7:87729376-87729398 TACCACTCAGCCATTGCTGGGGG - Intronic
1028347221 7:89798094-89798116 TGCCACACTGCCACTGCTGCTGG - Intergenic
1029527038 7:101101015-101101037 TGGCAGGCAGGCATTGCTGGAGG - Intergenic
1029653877 7:101911779-101911801 TGCCGTCCAGCGAGTGCTGGGGG + Intronic
1029706913 7:102280931-102280953 TGCCCTGCAGCCCAGGCTGGAGG + Intronic
1030222328 7:107110057-107110079 CACCATGCGGCCACTGCTGGAGG - Intronic
1030391406 7:108932262-108932284 TGTCATGCAGCCACTGCTGAGGG + Intergenic
1030590639 7:111477238-111477260 TGCCATGAAGCCAGCCCTGGTGG - Intronic
1031215317 7:118883044-118883066 CGCCATGCAGCCGCAGCTGGGGG - Intergenic
1031259963 7:119506423-119506445 TACCACTCAGCCATTGCTGGGGG - Intergenic
1031472311 7:122181882-122181904 CACCATGCTGCCAATGCTGGGGG - Intergenic
1031657725 7:124379402-124379424 GGCCACACAGCCTCTGCTGGGGG - Intergenic
1031899832 7:127396405-127396427 TGGCATGCTGCCACTGCATGAGG - Intronic
1032545268 7:132736904-132736926 TGCCTAGCAGCCAAGGCTGGGGG - Intergenic
1033499779 7:141936348-141936370 TGCCATGCTGTCACTGCAGCAGG - Intronic
1033543885 7:142382115-142382137 TGCCTGCCAGGCACTGCTGGTGG - Intergenic
1034398006 7:150842039-150842061 TGCCATGTAGCCACTGCCAGGGG - Intronic
1035084665 7:156247755-156247777 CTCCATGCCACCACTGCTGGAGG + Intergenic
1035749149 8:1983505-1983527 GGTCATGCAGCCAGTGCTGAGGG - Intronic
1036586540 8:10129500-10129522 TGCCCTGCAGCCTCTGATGCAGG + Intronic
1037557572 8:20040615-20040637 TGCTCTGCAGCCTCTGCTGGTGG - Intergenic
1038195077 8:25359914-25359936 TGCCGTGAAGCCACAGCCGGAGG - Intronic
1038443931 8:27589908-27589930 GGCCATGCAGCAAGTGCTTGAGG + Intergenic
1040511636 8:48100987-48101009 CACCATGCAGCCACTGCCAGGGG + Intergenic
1040743244 8:50605593-50605615 CACCATGAAGCCACTGCTAGAGG + Intronic
1042948752 8:74179717-74179739 TGGCAAGCCGGCACTGCTGGGGG + Intergenic
1043554078 8:81409667-81409689 CACCATGCTGCCACTGCTGGAGG - Intergenic
1044156954 8:88859918-88859940 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1044584709 8:93858913-93858935 GGCTTTGCAGCCACTGCTGTGGG + Intronic
1045041436 8:98228080-98228102 TGCCACTTGGCCACTGCTGGAGG + Intronic
1045493170 8:102685964-102685986 TGGCATACAGCCTCTGCTTGTGG + Intergenic
1048149732 8:131883031-131883053 TGTCCTGCAGCATCTGCTGGTGG - Intergenic
1049192938 8:141298786-141298808 TGCCAGGTAGCTGCTGCTGGAGG - Intronic
1049798681 8:144507845-144507867 CTACATGCAGACACTGCTGGGGG + Intergenic
1050381237 9:5032598-5032620 TGTTCTGCAGCCACTGCTGCTGG + Intronic
1051455195 9:17247482-17247504 CACCATGCAGCTACTGTTGGGGG + Intronic
1053038731 9:34850887-34850909 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1053652067 9:40178730-40178752 TGCCATCCAGCCTCAGCTGCTGG - Intergenic
1053902458 9:42808044-42808066 TGCCATCCAGCCTCAGCTGCTGG - Intergenic
1054532519 9:66197476-66197498 TGCCATCCAGCCTCAGCTGCTGG + Intergenic
1054934181 9:70669138-70669160 CGCCATGCAGCCAGTTCTGATGG - Intronic
1057163075 9:92905206-92905228 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1057204042 9:93160117-93160139 TGCGCTGCGGCCCCTGCTGGCGG - Intergenic
1057496488 9:95565197-95565219 AGCCATGCAGGCGCTGCAGGTGG - Intergenic
1058134483 9:101291643-101291665 TGTTCTGCAGCCACTGCTGCTGG + Intronic
1058432660 9:104932256-104932278 GGCCTTGCAGACTCTGCTGGAGG + Intergenic
1060169207 9:121447156-121447178 TACCATGCAGCCATTTCTGGAGG - Intergenic
1060189266 9:121581944-121581966 AGCCCTGCACCCGCTGCTGGTGG - Intronic
1060526527 9:124324114-124324136 TGCCAGGCCTCCCCTGCTGGCGG - Intronic
1060723908 9:125995166-125995188 GGCCAGGCAGTCCCTGCTGGTGG + Intergenic
1061792227 9:133064794-133064816 TCCCATGCAGCCACTGCCCCGGG + Intronic
1061887358 9:133598576-133598598 AGCCAGGCACCCGCTGCTGGTGG + Intergenic
1203393586 Un_KI270508v1:1855-1877 TGTCATTCTGCCCCTGCTGGGGG + Intergenic
1203620105 Un_KI270749v1:118556-118578 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1187594958 X:20760706-20760728 TGCCATGGGGCTGCTGCTGGAGG + Intergenic
1187644235 X:21328957-21328979 TGCTATGCTGCCACTGCTGCTGG + Intergenic
1187772278 X:22713202-22713224 TGAGATGGTGCCACTGCTGGAGG + Intergenic
1188421238 X:29992568-29992590 TGCCATGAGGCCACTGCCAGGGG + Intergenic
1188917989 X:35935421-35935443 TGCCATGCTGCCACTGCTGGGGG + Intronic
1188996037 X:36887340-36887362 TGCTACACATCCACTGCTGGTGG - Intergenic
1189269034 X:39737382-39737404 TGCCAGGCAGACAAGGCTGGAGG - Intergenic
1189598041 X:42590502-42590524 TGCTCTGCAGCCACCGCTGCTGG + Intergenic
1189658130 X:43268087-43268109 CACCATGCAGCTGCTGCTGGGGG + Intergenic
1189891746 X:45610269-45610291 TGCCATGCTGCCAGTGCTGATGG - Intergenic
1190602765 X:52109182-52109204 TTCCATGTAGCCACTGCTGGGGG + Intergenic
1190808485 X:53861719-53861741 CTCCTTGCAGCCACTGCTGGGGG + Intergenic
1190888274 X:54547978-54548000 TGCCATCCTGCCACTGCCGAGGG + Intronic
1190919682 X:54840132-54840154 CACCATGCCACCACTGCTGGGGG + Intergenic
1190923685 X:54882352-54882374 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1191064160 X:56330281-56330303 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1191075145 X:56445034-56445056 TGCCATGCTCCCTCTGCTGCTGG - Intergenic
1191649399 X:63519965-63519987 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1191650152 X:63528771-63528793 CACCATGCAGCTGCTGCTGGGGG - Intergenic
1191930188 X:66364280-66364302 TGCCACACAACCACTGCTGGGGG - Intergenic
1191943458 X:66504049-66504071 TTCCATGCAGCCACTGCTGAAGG - Intergenic
1192679836 X:73241184-73241206 TGCCATATCACCACTGCTGGAGG - Intergenic
1192841070 X:74856809-74856831 TGCCACACAGCCACTGCTGGGGG - Intronic
1193078543 X:77381948-77381970 CACCCTGCCGCCACTGCTGGGGG - Intergenic
1193216133 X:78866751-78866773 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1193366839 X:80644405-80644427 TGCCATGCAGCCCCTGCTGGGGG + Intergenic
1193399678 X:81027677-81027699 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1193544310 X:82808079-82808101 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1193563476 X:83048390-83048412 TGCCATGTAGCCACTGCTGGGGG + Intergenic
1193785620 X:85757001-85757023 TGTTCTGCAGCCACTGCTGCTGG - Intergenic
1193981537 X:88187165-88187187 CACCATGCTGCTACTGCTGGGGG - Intergenic
1194223504 X:91226705-91226727 CGCCATGCCTCCAATGCTGGTGG - Intergenic
1194253069 X:91602285-91602307 CACCAGGCTGCCACTGCTGGGGG - Intergenic
1194387672 X:93277519-93277541 TGCCATGCAGCTCCTGCTAGAGG - Intergenic
1194417180 X:93628171-93628193 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1194441625 X:93940586-93940608 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1194783953 X:98058670-98058692 CACCATGTTGCCACTGCTGGAGG + Intergenic
1194882677 X:99273409-99273431 TGCCATGTGGCCACCGCTAGGGG - Intergenic
1196096888 X:111809514-111809536 TGCCATGCAGCCACTGCCAGAGG + Intronic
1196619470 X:117806283-117806305 CACCATGCAGCCACAGATGGGGG - Intergenic
1196638554 X:118032465-118032487 TGTCAGGCTGCCCCTGCTGGGGG - Intronic
1197024864 X:121737121-121737143 TGCCATGCAACCACTGCCAAGGG - Intergenic
1197075587 X:122349552-122349574 CACCATGCAGCCACTGCTCGGGG - Intergenic
1197284851 X:124583388-124583410 TGTTCTGCAGCCACTGCTGCTGG + Intronic
1197299093 X:124756779-124756801 TGTTCTGCAGCCACTGCTGCTGG - Intronic
1197508993 X:127347116-127347138 CACCATGCTGCCACTACTGGGGG + Intergenic
1197536019 X:127690190-127690212 CACAATGCTGCCACTGCTGGGGG + Intergenic
1197573021 X:128172999-128173021 TGACATGCATGCACTGTTGGTGG + Intergenic
1197590432 X:128402755-128402777 CACCATGCCGCCACTGCTGGAGG + Intergenic
1197655871 X:129115384-129115406 TGGCATCTAGACACTGCTGGTGG - Intergenic
1197670707 X:129273848-129273870 TGCCACATAGCCACTGCTGGAGG + Intergenic
1199258430 X:145744011-145744033 TACCATGCTGCCACTGCTGCTGG - Intergenic
1199455313 X:148021247-148021269 TGCCATGCAGCCACTGCTGGGGG + Intronic
1199944012 X:152651295-152651317 TGCCATGAAGCCACGGCTAGAGG + Intronic
1200559971 Y:4690087-4690109 TGCCATGCCTCCAATGCTGGTGG - Intergenic
1201258679 Y:12135699-12135721 TGTTCTGCAGCCACTGCTGCTGG + Intergenic
1201434015 Y:13937063-13937085 TACCCTTCAGCCATTGCTGGAGG - Intergenic
1202032923 Y:20596952-20596974 TGCCACACAGCCACTGCTGGTGG - Intergenic