ID: 919455762

View in Genome Browser
Species Human (GRCh38)
Location 1:197818224-197818246
Sequence TTGTGCCATGCAGCCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919455762_919455764 -2 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455764 1:197818245-197818267 AAAGAGAGAATCTGTGCTTTGGG No data
919455762_919455768 5 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455768 1:197818252-197818274 GAATCTGTGCTTTGGGGGGATGG No data
919455762_919455765 -1 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455765 1:197818246-197818268 AAGAGAGAATCTGTGCTTTGGGG No data
919455762_919455767 1 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455767 1:197818248-197818270 GAGAGAATCTGTGCTTTGGGGGG No data
919455762_919455763 -3 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455763 1:197818244-197818266 CAAAGAGAGAATCTGTGCTTTGG No data
919455762_919455770 24 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG No data
919455762_919455769 23 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455769 1:197818270-197818292 GATGGAGAGCATAGTGATTGTGG No data
919455762_919455766 0 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455766 1:197818247-197818269 AGAGAGAATCTGTGCTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919455762 Original CRISPR TTGTGCCATGCAGCCACTGC TGG (reversed) Intergenic
No off target data available for this crispr