ID: 919455770

View in Genome Browser
Species Human (GRCh38)
Location 1:197818271-197818293
Sequence ATGGAGAGCATAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919455761_919455770 27 Left 919455761 1:197818221-197818243 CCTCCAGCAGTGGCTGCATGGCA 0: 3
1: 7
2: 36
3: 80
4: 394
Right 919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG No data
919455762_919455770 24 Left 919455762 1:197818224-197818246 CCAGCAGTGGCTGCATGGCACAA No data
Right 919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919455770 Original CRISPR ATGGAGAGCATAGTGATTGT GGG Intergenic
No off target data available for this crispr