ID: 919457991

View in Genome Browser
Species Human (GRCh38)
Location 1:197842757-197842779
Sequence CCTGATTAGGAGTCATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919457991_919457995 28 Left 919457991 1:197842757-197842779 CCTCACAATGACTCCTAATCAGG No data
Right 919457995 1:197842808-197842830 TCTAGCATTATGAAATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919457991 Original CRISPR CCTGATTAGGAGTCATTGTG AGG (reversed) Intergenic
No off target data available for this crispr