ID: 919463305

View in Genome Browser
Species Human (GRCh38)
Location 1:197903237-197903259
Sequence GAATTGATGGAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919463294_919463305 27 Left 919463294 1:197903187-197903209 CCACTCTTTTGTGGTGTATGTGT 0: 1
1: 0
2: 2
3: 30
4: 249
Right 919463305 1:197903237-197903259 GAATTGATGGAGAAGGTGGAGGG 0: 1
1: 0
2: 7
3: 59
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919463305 Original CRISPR GAATTGATGGAGAAGGTGGA GGG Intronic
900650093 1:3726298-3726320 GGATGGATGGAGTGGGTGGATGG + Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901174155 1:7286260-7286282 GAGTTGATGGCACAGGTGGAGGG + Intronic
901325014 1:8360625-8360647 GCATTCATGGAGAAGGGTGAGGG + Exonic
901411647 1:9088348-9088370 TAATAGGTGGAGAAGGAGGAGGG - Intronic
901536141 1:9883981-9884003 GAATCCATGGGGAAGGAGGAAGG + Intronic
901715202 1:11147987-11148009 TAATTGCTGGAAAAGGTGAAGGG + Intronic
902149055 1:14427702-14427724 GAATTTAAGGAGAATGTGGTTGG + Intergenic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902905968 1:19557753-19557775 GAATTGAAGGGGAAGGGGAAGGG - Intergenic
903011717 1:20335831-20335853 GAATAAGTGGAGGAGGTGGAAGG + Intronic
903084346 1:20841930-20841952 GAACTGATGCAGAAGGGAGAAGG + Intronic
903139913 1:21333209-21333231 GATCTGATGCAGAAGGTGGGGGG + Intronic
903168882 1:21540047-21540069 GAAGTGCTGGAGGAGGTGGTTGG + Intronic
903544057 1:24112538-24112560 GACTTCATGAAGACGGTGGAAGG + Intergenic
905313914 1:37069063-37069085 GGAGTGATGGAGCAGGAGGAAGG - Intergenic
905518741 1:38581294-38581316 GCATGGCTGGAAAAGGTGGATGG - Intergenic
905566260 1:38967511-38967533 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
906018886 1:42609114-42609136 GAAGAGGTGGAGAAGGTGGAAGG - Intronic
906796125 1:48697700-48697722 GAATTAATGGAGTAGGTGAATGG - Intronic
906810898 1:48826007-48826029 GAATTGTGGGTGAAGGTAGAAGG - Intronic
907143877 1:52214525-52214547 GAATGTATGTAGTAGGTGGATGG + Intronic
907756561 1:57316398-57316420 CATTTGAGGGGGAAGGTGGATGG - Intronic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
909979815 1:82085363-82085385 GAAGAGGTGGAGAAGGTGGAGGG + Intergenic
910140160 1:84018419-84018441 GAAAGGAAGGAGAAAGTGGAAGG - Intergenic
910207919 1:84766031-84766053 GAAATGAAGGTGAAGGTGAAGGG - Intergenic
910261801 1:85300119-85300141 GAATTAAAGGAGTTGGTGGATGG + Intergenic
910285177 1:85545750-85545772 GAAATGGTGGAGAAGGTGGGAGG + Intronic
910597233 1:88992922-88992944 GAATGGATGGAAATGGAGGAGGG + Exonic
911119140 1:94277715-94277737 ACCTTGATGGAGAAGGAGGAGGG - Intergenic
911452474 1:98081281-98081303 GAAAAGGTGGAGAAGGTGGAAGG + Intergenic
912664727 1:111568758-111568780 GAAGAGATGGAGGAAGTGGAAGG - Intronic
913447508 1:118965315-118965337 GAAAAAATGGAGAAGTTGGAGGG + Intronic
914407025 1:147385691-147385713 GCAGTGATGGGGAAGGTGGAGGG - Intergenic
915110396 1:153561083-153561105 GAAATGATAGTGATGGTGGATGG + Intergenic
915908300 1:159895813-159895835 GAATAACTGGAAAAGGTGGATGG + Intronic
915970208 1:160349550-160349572 GATTTAATGGAGAAGCTGAAAGG + Exonic
916611543 1:166396719-166396741 GACTTGATGGTGAAGCAGGATGG + Intergenic
917379635 1:174391197-174391219 GAATTGAGGTAGGAGTTGGAGGG + Intronic
917904961 1:179579549-179579571 CACTTTATGGACAAGGTGGAAGG + Intergenic
918003474 1:180520242-180520264 GAATTGATTGGGAAGCTGGGAGG + Intergenic
918732086 1:188011853-188011875 GAATTTATGGCAAAGGAGGAGGG + Intergenic
919210176 1:194472402-194472424 GAATTGAGGTAGAAAGTTGATGG + Intergenic
919463305 1:197903237-197903259 GAATTGATGGAGAAGGTGGAGGG + Intronic
921193864 1:212733483-212733505 GGAAAGATGGAGAGGGTGGAAGG - Intronic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922061254 1:222094564-222094586 GAAGCCATGGAGAAGGAGGATGG - Intergenic
922073526 1:222219977-222219999 GTGTTGAGAGAGAAGGTGGAAGG - Intergenic
922904061 1:229160378-229160400 CCATTCATGGAGAAGGTGAAGGG - Intergenic
923191671 1:231626437-231626459 ACAGTGATGGAGAAGATGGAGGG - Intronic
923290760 1:232543403-232543425 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
923378444 1:233390353-233390375 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
923611938 1:235504040-235504062 GAATTGTTGGAGGCGGGGGAAGG - Intronic
923664779 1:235990418-235990440 GAATTGCTGGAGCAGTGGGAGGG - Intronic
923934147 1:238742873-238742895 GAAAAGGTGGAGAGGGTGGAAGG + Intergenic
924096041 1:240551821-240551843 GAATTAATGGAGAAGGGAGGAGG + Intronic
1064526300 10:16260353-16260375 GAAGGGAGGGAGAAGGTAGAAGG + Intergenic
1064895392 10:20229539-20229561 GAATTGATGTTGATGGTTGATGG + Intronic
1065480724 10:26191374-26191396 GAATAGATGGAGGAGGTGGAGGG - Intronic
1065978264 10:30863521-30863543 ATATTGATGGAGAAGAAGGATGG - Intronic
1066453041 10:35548728-35548750 AAAGAGGTGGAGAAGGTGGAAGG + Intronic
1066577639 10:36843915-36843937 GAATTAATAGAGAAAGTAGATGG + Intergenic
1066594443 10:37034562-37034584 GATTTGATGTAGAGGGAGGATGG + Intergenic
1067052902 10:43034489-43034511 TAATTCTTGGAGAAGGTGGGGGG - Intergenic
1069357787 10:67607521-67607543 GAAGAGATGGAGGAGGTGGAAGG + Intronic
1069733272 10:70633330-70633352 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1070170534 10:73929477-73929499 AGATTGATTGGGAAGGTGGAAGG + Intergenic
1071150046 10:82623299-82623321 GACTTGATGGAGAAGCAGGCTGG - Intronic
1073348516 10:102802102-102802124 GGAAGGAAGGAGAAGGTGGAAGG - Intronic
1073980433 10:109147677-109147699 GAATTGCTGGAGCAGGGGAATGG + Intergenic
1074476915 10:113781771-113781793 GAGTTGTTGGGGAAGGGGGAAGG - Intronic
1075118850 10:119649882-119649904 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1075300699 10:121321307-121321329 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
1075472260 10:122700003-122700025 GAATGGATAGAGAATGTGGCTGG + Intergenic
1075751148 10:124772345-124772367 GTACTGATGTAGAAGGTAGAAGG - Intronic
1077165874 11:1138047-1138069 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
1077374954 11:2201326-2201348 GGATGGATGGATGAGGTGGATGG + Intergenic
1077374969 11:2201391-2201413 GGATGGATGGATGAGGTGGATGG + Intergenic
1077407961 11:2391080-2391102 GGAGTGATGGAGGAGGAGGAGGG + Intronic
1077802581 11:5555755-5555777 GAACTGATGGAGTTGGTGTATGG - Intronic
1078011879 11:7578701-7578723 GTTTTGATGGAGAAGGGGGTTGG + Intronic
1078160775 11:8837905-8837927 GAGTTTATGAAGGAGGTGGAAGG + Intronic
1078588918 11:12620813-12620835 GATTTGGTGTGGAAGGTGGATGG + Intergenic
1078836130 11:15031814-15031836 GAAGAGGTGGAGTAGGTGGAAGG - Intronic
1079186281 11:18240300-18240322 GATTTCATGGAGCAGGTGGAAGG + Intronic
1079557489 11:21778067-21778089 GAAATGAGGGTAAAGGTGGATGG + Intergenic
1079604882 11:22352777-22352799 GTATTGAAGGATAAAGTGGAAGG + Intronic
1079788514 11:24706615-24706637 GAATTGATGGATAATGATGAGGG + Intronic
1080232393 11:30032560-30032582 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1081245884 11:40765344-40765366 CAATTATGGGAGAAGGTGGAAGG - Intronic
1081279716 11:41193976-41193998 GAAGAGATGGAGGAGATGGAAGG - Intronic
1081438775 11:43057642-43057664 GAAGGGATGGATAAGGTAGAGGG + Intergenic
1082244476 11:49905292-49905314 GAATGGAGGGGGAAGGGGGAAGG + Intergenic
1082721363 11:56680997-56681019 GAATTGAGAGAGAAGGGGGAAGG - Intergenic
1082795559 11:57376172-57376194 GAAGTGGTGGAGATGGTGGTGGG - Intergenic
1083660615 11:64250375-64250397 GAGTTGATGGAGAACTTGGCGGG + Intergenic
1084004581 11:66316273-66316295 GAATGTGTGGAGGAGGTGGATGG - Exonic
1084716039 11:70874088-70874110 GGATTGATAGATAAGATGGATGG - Intronic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1088168126 11:106962604-106962626 GAATTGTGGGAGTAGGTGGGGGG + Intronic
1089297319 11:117477987-117478009 GGATGGGTGGGGAAGGTGGAGGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089493067 11:118895575-118895597 GCATTGATGGGGAAGGAGGCTGG + Exonic
1089547005 11:119235604-119235626 GAATAGGTGGAGGGGGTGGAAGG + Intronic
1089620629 11:119720263-119720285 GGACTGAGGGAGAAGGTGCATGG + Intronic
1090249569 11:125241983-125242005 GGATGGATGGTGAAGGTGGAGGG + Intronic
1090717686 11:129444674-129444696 GAGGTAATGGAGAAGGTGGCCGG + Intronic
1090780480 11:130002533-130002555 GAATTGATGGTGGTGGTGGGGGG - Intronic
1091386777 12:101001-101023 GAATTGATGGAGCTGGAGGCAGG - Intronic
1091961387 12:4697999-4698021 GAACTCATGGAGAAGGTCGTGGG - Intronic
1092136926 12:6155864-6155886 AAATTGATGGATAAGTGGGAAGG - Intergenic
1092913969 12:13172840-13172862 GGATAGATGGAGAAAGGGGAAGG - Intergenic
1092946399 12:13458024-13458046 GGCTTCATGGAGAAGGTGGCAGG - Intergenic
1093744227 12:22721555-22721577 GAAGAGATGGAGAAGCAGGAGGG + Intergenic
1093981547 12:25480448-25480470 GAAATAATGTAGTAGGTGGAAGG + Intronic
1094272597 12:28633526-28633548 GAAGAGATGGAGGAGGTAGAAGG + Intergenic
1094468526 12:30780091-30780113 TTATTGATGCAGAAGGTGGCAGG - Intergenic
1094528650 12:31251071-31251093 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1095486595 12:42691310-42691332 TAATTTATGGATAAGGTGAAAGG + Intergenic
1095937085 12:47696551-47696573 GAAGAGGTGGAAAAGGTGGAAGG - Intronic
1096006648 12:48178754-48178776 TAATTTATGGAAAAGATGGAAGG + Intronic
1096670542 12:53195909-53195931 GAACTGCTGGAGAAGATGGCAGG + Intronic
1096721476 12:53526259-53526281 GAAGAGGTGGAGAAGTTGGAAGG - Intronic
1096755472 12:53796037-53796059 TAAGTGAGGGAGAATGTGGAAGG + Intergenic
1097452943 12:59757674-59757696 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1098075993 12:66732148-66732170 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098815336 12:75153929-75153951 GAAAAGGTGGAGGAGGTGGAAGG + Intronic
1098986063 12:77013673-77013695 GAAGAAGTGGAGAAGGTGGAAGG - Intergenic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100440068 12:94608820-94608842 GAGTAGATGGTGGAGGTGGAAGG - Intronic
1100828715 12:98498451-98498473 AAAGTGATGGAGAAGGTGAGAGG - Intronic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1100888104 12:99094890-99094912 GAATGGATGGAGAAATTGGGAGG + Intronic
1101571991 12:105962162-105962184 GAAGCAATGGAGAAGGGGGACGG + Intergenic
1102258627 12:111430176-111430198 GGAGTGATGGGGAAGGCGGAGGG + Intronic
1102381499 12:112470543-112470565 GACTTGATCTTGAAGGTGGAGGG + Intronic
1102432111 12:112891625-112891647 GACTAGATAGAGAAGTTGGAGGG + Intronic
1102455891 12:113070552-113070574 GACTCCATGGAGAAGGGGGAGGG - Intronic
1102719374 12:115002946-115002968 GCATTGCTGGAGAGGGTGGCTGG + Intergenic
1103445939 12:120995233-120995255 GAGTGGATGGAGTAAGTGGATGG - Intronic
1103507417 12:121451114-121451136 GAAGAGATGGAGGAGGTAGAAGG - Intronic
1104205810 12:126637409-126637431 GAGTTGATGGTGGAGATGGAAGG - Intergenic
1104343554 12:127975152-127975174 GACTTGAGGGAAAGGGTGGAAGG - Intergenic
1104925997 12:132314109-132314131 GGATGGATGGATTAGGTGGATGG - Intronic
1105337943 13:19492160-19492182 GAAAGGAAGGAGATGGTGGAGGG - Intronic
1107084535 13:36412373-36412395 GAATTGTTGCAGAAGGTGAAGGG + Intergenic
1107104958 13:36633215-36633237 TTATTGAAGGACAAGGTGGAGGG + Intergenic
1107135934 13:36944127-36944149 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1107497874 13:40946599-40946621 GAAGAGATGGAGGAAGTGGAAGG - Intronic
1108253993 13:48593400-48593422 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1109024062 13:57138662-57138684 GACATGATGGATAAGGTGGATGG - Intergenic
1110910858 13:80961044-80961066 GAATTCATGGAGATAGTAGAAGG - Intergenic
1111743022 13:92228140-92228162 TAAGAGATGGAGAAGATGGAAGG + Intronic
1111781738 13:92736409-92736431 GACTTAATGAAGAAGGTGGGTGG - Intronic
1112141123 13:96643842-96643864 GAAATGAGGGAGGAGGTGGATGG + Intronic
1112508924 13:99991444-99991466 GAGCTGCTGGAGAAGGTGGGGGG + Intergenic
1112709446 13:102110771-102110793 GAATAAATGAAGAAGATGGAGGG - Intronic
1112839121 13:103553677-103553699 GAAGAGATGGAGGAGGTAGAAGG - Intergenic
1113240779 13:108334799-108334821 GACTTGAGGGAAAAGGTGGGAGG + Intergenic
1113246270 13:108399202-108399224 GAAAGAATGGAGAAAGTGGATGG + Intergenic
1113635227 13:111914790-111914812 GACTTGAAGGGGAAGGTGGCTGG + Intergenic
1113965868 13:114153519-114153541 GTAGTGATGGAGATGATGGAGGG - Intergenic
1114557401 14:23569928-23569950 GACTAGAGGGAGGAGGTGGAAGG - Intronic
1115253475 14:31373786-31373808 GAAGAGGTGGAGCAGGTGGAAGG - Intronic
1116100475 14:40427368-40427390 GAGCTGTTGGAAAAGGTGGAGGG - Intergenic
1117455549 14:55893538-55893560 GGATAGATAGAGAAGGTGGGAGG - Intergenic
1118626641 14:67665357-67665379 GAATTGCTTGAGCAGGTGGGAGG - Intronic
1118906752 14:70028971-70028993 GAATTCATGGAGGAGGAGAAAGG - Intronic
1118970239 14:70630370-70630392 GAAGTGGTGGAGGAGATGGAAGG - Intergenic
1119190155 14:72676005-72676027 CAATTGAGGGAGAAGGGAGAAGG - Intronic
1119198299 14:72733565-72733587 GGATGGATGGAGAGGGTGGTTGG - Intronic
1119215924 14:72868997-72869019 GCCTTGATGGAGAAGTTTGAGGG - Intronic
1119310236 14:73640194-73640216 TTTTTGGTGGAGAAGGTGGAAGG - Intergenic
1119961395 14:78860848-78860870 GAAGATATGGAGGAGGTGGAAGG + Intronic
1120073896 14:80134265-80134287 GAATTCATGGAGATGCTGGGAGG + Intergenic
1121468358 14:94130278-94130300 GGATTGATGGAGGAGGGGGCGGG - Intergenic
1122011311 14:98751299-98751321 GGATGGATGGAGTGGGTGGATGG + Intergenic
1122114562 14:99521303-99521325 GCATTCCTGGAGAAGGTGGAAGG + Intronic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1124959199 15:34382333-34382355 GAAGTCATGGAGAAGCTGGAGGG - Intronic
1124975825 15:34528554-34528576 GAAGTCATGGAGAAGCTGGAGGG - Intronic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125904701 15:43380184-43380206 GAATTGGTGGTGGAGGTGGGTGG + Intronic
1126567659 15:50116392-50116414 GAAAAGGAGGAGAAGGTGGAGGG + Intronic
1127509329 15:59624674-59624696 GAAGTGATGGAGAACTTGGGAGG + Intronic
1127956497 15:63858389-63858411 GCAATGATGGAGATGGTGGTAGG + Intergenic
1128560218 15:68660004-68660026 GAAGTGGTGGTGGAGGTGGAAGG + Intronic
1129703048 15:77778968-77778990 GAATGGGTGGAGAAGGCGGTGGG - Intronic
1131152225 15:90054298-90054320 GATGGGATGGAGAAGGCGGAGGG + Intronic
1131340141 15:91591239-91591261 GGATTGATGGAGAAAGTGGTGGG + Intergenic
1131481617 15:92787193-92787215 GAATTGATGATGAAGATGGTGGG - Intronic
1131508371 15:93035415-93035437 GAATTGATGGCCAAGGAGCAGGG + Intronic
1131570553 15:93531025-93531047 GAATTCAAAGAGAAGGTGCAAGG + Intergenic
1131727176 15:95239399-95239421 GAATGGAAGGAGAAGCAGGAGGG + Intergenic
1131731753 15:95288873-95288895 GAATTCAAGGAGGGGGTGGATGG + Intergenic
1131852141 15:96554731-96554753 GAGGTGATGGAGGAGGAGGAGGG - Intergenic
1131864426 15:96692167-96692189 GAATGGATGGAGAAGTGGGGAGG + Intergenic
1132534023 16:468069-468091 GAAGTGAGGGAGGAGGTGCAGGG + Intronic
1133232723 16:4374059-4374081 GAGTTCTTGGAGAAGGGGGAGGG + Intronic
1136053338 16:27669299-27669321 GGATCCAGGGAGAAGGTGGAGGG - Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136512939 16:30750145-30750167 GAAGTGTTGTGGAAGGTGGAGGG + Intronic
1136709573 16:32225378-32225400 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136758336 16:32704035-32704057 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1136809772 16:33166340-33166362 TATTTGATGGAGGAGGAGGAGGG + Intergenic
1136816248 16:33276420-33276442 TATTTGATGGAGGAGGAGGAGGG + Intronic
1138254693 16:55545293-55545315 GAATGGATAGAGAAGATGAAAGG + Intronic
1138758082 16:59513050-59513072 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1141274856 16:82578156-82578178 CAATTGATGGGGAAGGAGAAAGG + Intergenic
1141757066 16:85998385-85998407 GCATTGAGCCAGAAGGTGGAGGG - Intergenic
1203060487 16_KI270728v1_random:964382-964404 TATTTGATGGAGGAGGAGGAGGG - Intergenic
1203141815 16_KI270728v1_random:1771813-1771835 GAGATGATGGAGGAGGAGGAGGG - Intergenic
1144124977 17:12194864-12194886 GACAGCATGGAGAAGGTGGATGG - Intergenic
1144288469 17:13802711-13802733 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1145221642 17:21094265-21094287 GAAGTGGTGGAGGAGATGGAAGG + Intergenic
1145857616 17:28177163-28177185 AAAGTGGTGGAGGAGGTGGAAGG + Intronic
1145865714 17:28240392-28240414 GAATTGCAGGAGGAGGAGGAAGG - Intergenic
1146133094 17:30295154-30295176 GAATCACTGGGGAAGGTGGAGGG + Intergenic
1147126739 17:38375279-38375301 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
1147662271 17:42123049-42123071 GAACTGGTGGTGCAGGTGGATGG + Exonic
1148448731 17:47759163-47759185 GAAGAGTTGGAGGAGGTGGAAGG + Intergenic
1148516008 17:48218014-48218036 GATTTCATAGAGAAGGAGGAAGG + Intronic
1148535678 17:48436720-48436742 GATTTGATGGAGGAAGTTGATGG - Intergenic
1148674877 17:49439343-49439365 GAATGGAGGGTGAAGGTGCAGGG - Intronic
1149802428 17:59582492-59582514 GAATTGATGACTAAGGTGGAAGG + Intronic
1149844063 17:59993001-59993023 GAATTGATGACTAAGGTGGAAGG - Intergenic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1150824203 17:68460279-68460301 CAACTGATGGGGAAGGGGGAGGG + Intergenic
1152458515 17:80429539-80429561 GAACTGAGGGAGCAGGTGGCGGG + Intronic
1152496778 17:80678730-80678752 TAATGCATGAAGAAGGTGGAAGG + Intronic
1152879926 17:82808830-82808852 GAAGGGATGAAGCAGGTGGAGGG + Intronic
1152918399 17:83053073-83053095 GAAATGAGGGCAAAGGTGGAGGG - Intergenic
1153731357 18:8016090-8016112 TAATTGGTGGAAAGGGTGGATGG + Intronic
1153991098 18:10401480-10401502 GAGTAGATGGAGAATGTGGTAGG + Intergenic
1154277185 18:12972253-12972275 GAACTGAGGAAGAAGGGGGAAGG + Intronic
1154382320 18:13863607-13863629 AGATTGATGCAGAAGGTGGGTGG - Intergenic
1154395892 18:13988355-13988377 GTTTTGATGGAGAAGGTGATGGG + Intergenic
1154406553 18:14097047-14097069 GGTTTGATGGAGAAGGTGGTTGG - Intronic
1155660056 18:28238738-28238760 AAAATGATGGAGAAGGTCAAAGG + Intergenic
1156842092 18:41620891-41620913 GAATTCAAGCAGAAAGTGGATGG + Intergenic
1157580736 18:48772533-48772555 GAATTCATGGAGATGGAAGATGG - Intronic
1158166353 18:54545574-54545596 GATTTGATGGGGTAGGGGGAGGG + Intergenic
1158763591 18:60420924-60420946 AAATTTATGGTGAAGGTTGAGGG + Intergenic
1160676933 19:395977-395999 GGATGAATGGAGAAGGTTGATGG + Intergenic
1161403766 19:4080856-4080878 GAAAGGAGGGAGGAGGTGGAGGG + Intergenic
1161687163 19:5708487-5708509 GAGTTGATGGAGCTGGTGGGTGG - Intronic
1163160063 19:15458878-15458900 AAAGTGATGGATTAGGTGGAGGG - Intronic
1163164014 19:15483042-15483064 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
1164592132 19:29512900-29512922 GAAGTCTTGGAGAAGGAGGAAGG + Intergenic
1164753296 19:30671533-30671555 GAACTGAGGGAGAAGGAGAAGGG + Intronic
1165274906 19:34740745-34740767 GAATATATAGAGAAGTTGGAAGG + Exonic
1165415970 19:35693733-35693755 GAATCGCTGGTGAAGGTTGATGG - Intergenic
1165611853 19:37161591-37161613 GAAGAGGAGGAGAAGGTGGAAGG - Intronic
1167082422 19:47286018-47286040 GAATGGATGGAGACAGTGGTTGG + Intergenic
1167194126 19:48015295-48015317 GAAGCAATGGAGGAGGTGGAAGG + Intronic
1167691448 19:50986460-50986482 GTCTTGAAGGAGATGGTGGAGGG + Intergenic
1167972337 19:53196497-53196519 GAATGGGTGTAGAATGTGGAGGG - Intergenic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168520684 19:57048084-57048106 GAGATGGTAGAGAAGGTGGAGGG - Intergenic
925651437 2:6093738-6093760 GAAGAGATGGAGGAGGTGAAAGG + Intergenic
925688890 2:6499883-6499905 GAATTCATGGAGATGGAGCAAGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926989851 2:18666745-18666767 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
927461840 2:23306073-23306095 GGAGAGATGGAGAAGATGGAAGG + Intergenic
927535990 2:23859394-23859416 GAATTGATTGAGCTGGTGGGTGG - Intronic
927803561 2:26123904-26123926 GAAGAGGTAGAGAAGGTGGAAGG - Intronic
928850635 2:35741087-35741109 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
928868739 2:35949949-35949971 GAAGTGTGGGGGAAGGTGGAGGG - Intergenic
929009671 2:37428536-37428558 GATTTAAGGGAGAGGGTGGAAGG - Intergenic
929849838 2:45576065-45576087 GAAGTGGTGGAGGAGGTGGAAGG - Intronic
930231272 2:48846316-48846338 TATTTCATGGAGCAGGTGGAAGG + Intergenic
930308658 2:49709622-49709644 GATGTGATGGAGAAGATAGATGG - Intergenic
930566950 2:53033072-53033094 CATATGATGGAGAAGGTGAAAGG - Intergenic
931014811 2:57964447-57964469 GAAGGGATGGAGGAGGTAGAAGG + Intronic
932825086 2:74931852-74931874 GAAGTGAGGCAGAAGTTGGAGGG + Intergenic
935354265 2:102183938-102183960 GAAGTGATGGAGAGGGTGTTGGG - Intergenic
935782645 2:106521581-106521603 GAAGTGACTGAGAACGTGGAGGG + Intergenic
935803394 2:106722675-106722697 GAAGAGATGGAGGAGATGGAAGG + Intergenic
935867573 2:107407573-107407595 GAAAGGATGAAGGAGGTGGAAGG - Intergenic
936903420 2:117510221-117510243 GACTTGAGGGAAAAGGTGGAGGG + Intergenic
937747239 2:125429304-125429326 GAAATGAGGAGGAAGGTGGAAGG - Intergenic
938169579 2:129063022-129063044 GAATGGATGGGGTGGGTGGAAGG - Intergenic
938388473 2:130884912-130884934 TTATTGATGAAGAAGCTGGAGGG - Intronic
938903110 2:135815261-135815283 GAATTGAAGGAGAAGAGTGAAGG + Intronic
939437497 2:142197537-142197559 CAATTGATTGAGAGGGTGCATGG + Intergenic
939827373 2:147031028-147031050 GAAATGTTGTAGAAGGTGGCAGG + Intergenic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940043060 2:149380418-149380440 GAATTGATGGAGGTGGTAAAGGG + Intronic
940059036 2:149544769-149544791 GACCTGATGGATAAGGTGGCAGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
941192788 2:162407347-162407369 GAATTGCAGGAGAAGTAGGAAGG - Intronic
941530073 2:166657963-166657985 GAATAGATGGTGCATGTGGAAGG + Intergenic
941597790 2:167499680-167499702 GATTTGGTGGGGACGGTGGAAGG - Intergenic
942938826 2:181592125-181592147 GAAATAAAGGAGAAGGTGTAGGG - Intronic
943176143 2:184477137-184477159 GTATTGACGCAGAAGATGGATGG + Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
943839060 2:192554200-192554222 GAATGGAAGGAGAAGAGGGAGGG + Intergenic
944654635 2:201865353-201865375 TGGTGGATGGAGAAGGTGGAGGG - Intronic
944663957 2:201943905-201943927 GCAGAGATGGAGGAGGTGGAAGG + Intergenic
944768934 2:202893804-202893826 AAATTGAGGGAGGAGGAGGAAGG - Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
946035040 2:216735063-216735085 GAAATGTTGGAGATGGTAGATGG + Intergenic
946131422 2:217609914-217609936 GAGGTGATGGAGCAGGTGCAGGG + Intronic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
946574386 2:221058168-221058190 GAATTGTAGCAGAAGGTGAAAGG + Intergenic
947550546 2:231042190-231042212 GAAATGAGGGAGAAGGGGAAGGG + Intronic
947859673 2:233349563-233349585 GAAGGGCTGGAGAAGGGGGATGG + Intergenic
947885827 2:233570254-233570276 GAATTGGTGGAGGAGGTGGAAGG - Intergenic
948094686 2:235324381-235324403 GAAAAGATGGAAAAGATGGATGG + Intergenic
948458522 2:238118318-238118340 GGGTGGGTGGAGAAGGTGGATGG + Intronic
948458534 2:238118361-238118383 GAATGGATGGAGGAGGTGGATGG + Intronic
948458554 2:238118431-238118453 GAATGGATGGAAGAGGTGGATGG + Intronic
948458560 2:238118458-238118480 GAGTGAATGGAGGAGGTGGATGG + Intronic
948458581 2:238118538-238118560 GAATGGATGGAAGAGGTGGATGG + Intronic
948458587 2:238118565-238118587 GAGTGAATGGAGGAGGTGGATGG + Intronic
948458825 2:238119468-238119490 GAATGGATGGAGGAGGTGGATGG + Intronic
948458854 2:238119562-238119584 GAATGGATGGAGGAGGTGGATGG + Intronic
948619299 2:239224090-239224112 GAATTCATGGGGAATGTGGGTGG - Intronic
948695314 2:239730174-239730196 AAGCTGATGGAGAAGGTGGGTGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1168984468 20:2036322-2036344 ATATTGATGGAGAGGATGGAAGG + Intergenic
1169479603 20:5966911-5966933 GAATTTTTGGAGAAGGTGAGTGG - Intronic
1169522786 20:6391096-6391118 GAATTGATGAGTAATGTGGAGGG - Intergenic
1169839153 20:9915530-9915552 GAAATGATGGATAAGGAGGTGGG + Intergenic
1170973851 20:21141918-21141940 GGATGGCAGGAGAAGGTGGAGGG - Intronic
1171097444 20:22345115-22345137 GAATTGATGAGGAAGGACGAAGG - Intergenic
1171257810 20:23704085-23704107 TGAATGATGGAGAAGATGGAAGG - Intergenic
1171265294 20:23766750-23766772 TGAATGATGGAGAAGATGGAAGG - Intergenic
1171267220 20:23781694-23781716 GGAATGATGGAGAAGATGGAAGG - Intergenic
1171274889 20:23848096-23848118 TGAATGATGGAGAAGATGGAAGG - Intergenic
1171418120 20:24997412-24997434 GAAGAGGTGGAGCAGGTGGAAGG - Intergenic
1171967565 20:31542131-31542153 GAAGTGGTGGTGGAGGTGGAGGG - Intronic
1172015673 20:31871008-31871030 GAATGGATGGGAAAGGAGGAAGG - Intronic
1173534007 20:43794985-43795007 GAACTGGTGGAGAAGGAGAATGG - Intergenic
1173918082 20:46724730-46724752 GAACAGATGGAGTAGATGGATGG + Intronic
1173918090 20:46724774-46724796 GAATTGATGGAGTGGATGGATGG + Intronic
1173918106 20:46724851-46724873 GAATTGATGGAGTGGATGGATGG + Intronic
1173918119 20:46724921-46724943 GAATAGATGGAGTAGATGGATGG + Intronic
1174000174 20:47368954-47368976 GACTTGAGGGACCAGGTGGATGG - Intergenic
1174980036 20:55383683-55383705 GAATAGATGGAGAAGCTCTATGG + Intergenic
1175657190 20:60781151-60781173 GAATTGATGGCTAAGGTCTATGG + Intergenic
1176518091 21:7801534-7801556 GAATTGCCAGAGAAGGTGGTTGG + Intergenic
1176914736 21:14611166-14611188 GAAATGATGGAGAATCTAGAGGG - Intronic
1177213564 21:18100279-18100301 TAATAGATGTTGAAGGTGGAAGG + Intronic
1177283755 21:19021106-19021128 AATTTGATGGAGAAGGTCAAAGG - Intergenic
1177482921 21:21715462-21715484 GAATATATGGAGAAAGTGAATGG - Intergenic
1177928341 21:27248142-27248164 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1178652119 21:34431547-34431569 GAATTGCCAGAGAAGGTGGTTGG + Intergenic
1178794149 21:35728106-35728128 GCAGAGATGGAGGAGGTGGAAGG - Intronic
1179345895 21:40556983-40557005 GGAGAGGTGGAGAAGGTGGAAGG + Intronic
1179474662 21:41635498-41635520 GAATTGTTGGAGGAGGCAGAGGG - Intergenic
1180143614 21:45907823-45907845 GAGTCGATGGAGGAGCTGGAAGG + Intronic
1180324264 22:11354571-11354593 GTATTGATGTAGAGAGTGGAAGG + Intergenic
1181671321 22:24426846-24426868 GACTTGGAGGAGAAGGTGAAGGG - Intronic
1181820888 22:25474784-25474806 GAATTTATGGAGACAGTAGAAGG + Intergenic
1181890616 22:26059863-26059885 GAAAGGCTGGAGAAGGTGTATGG + Intergenic
1181923131 22:26336156-26336178 GAAATGCTGGAGAAGTGGGAAGG - Intronic
1182099684 22:27649143-27649165 GAATAGATGGATAAGTAGGAGGG + Intergenic
1183764917 22:39864223-39864245 GGAATGAGGGGGAAGGTGGAAGG - Intronic
1184920417 22:47601618-47601640 GGAGGGATGGAGAAGGAGGAGGG - Intergenic
1185076659 22:48686865-48686887 GGATAGATGGAGATGATGGATGG + Intronic
1185076704 22:48687089-48687111 GGATAGATGGTGATGGTGGATGG + Intronic
949949112 3:9214654-9214676 CCATGGATGGAGAAGCTGGAAGG + Intronic
950342334 3:12258386-12258408 GTATTCAAGGAGCAGGTGGATGG + Intergenic
950744137 3:15073687-15073709 GGATGGATGGGGAAGGTGGCAGG - Exonic
950917151 3:16657528-16657550 GAAAAGATGGAGGTGGTGGAAGG - Intronic
951829915 3:26915024-26915046 AATGTGATGGAGAAGGTGGCAGG + Intergenic
953573461 3:44092925-44092947 GAATTGGTCTAGAATGTGGAGGG - Intergenic
954091691 3:48289405-48289427 GGATTGAGGGAGGGGGTGGATGG + Intronic
954424108 3:50434356-50434378 AAGTTGGTGGAGAAGGTGGCAGG - Exonic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955382559 3:58451519-58451541 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
955410832 3:58654373-58654395 GAATTGATGGAAACTGTGGGGGG - Intronic
955689253 3:61574785-61574807 AACATGGTGGAGAAGGTGGAAGG + Intronic
957665149 3:83217695-83217717 GGATTTACGGAGAAGGTGGGCGG + Intergenic
958008025 3:87838207-87838229 GAATTGATGCAGGAAGTGGCTGG + Intergenic
958059984 3:88467188-88467210 GAAGTGGAGGAGGAGGTGGATGG - Intergenic
958429720 3:94024210-94024232 GAATTCATAGTCAAGGTGGAAGG - Intronic
958542040 3:95490304-95490326 TACTTGATGGTGGAGGTGGAAGG - Intergenic
959153637 3:102639379-102639401 GAAGTGATTGTGAAGGTGGAAGG + Intergenic
959183682 3:103014601-103014623 TAATAGATAGGGAAGGTGGAAGG + Intergenic
959467976 3:106713599-106713621 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
959943583 3:112104788-112104810 GACTTGATGGAAAAGGTGGTGGG - Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961792251 3:129384679-129384701 AGATTCTTGGAGAAGGTGGAGGG - Intergenic
964033987 3:152173171-152173193 GAAGAGGTGGAGAAGGTGGAAGG - Intergenic
965524732 3:169703760-169703782 AACTTGATGGAAAATGTGGAGGG - Intergenic
965703322 3:171480812-171480834 GAAGGGACTGAGAAGGTGGAAGG - Intergenic
966623447 3:181991208-181991230 GAGTTGTGGGAGCAGGTGGAGGG + Intergenic
966653455 3:182326976-182326998 GAAATGATGGTGATAGTGGATGG + Intergenic
966912867 3:184569122-184569144 GAAGTGAGGGAGAGGGAGGAGGG + Intronic
967648605 3:191957467-191957489 GGAGGGATGGAGAAGGAGGAAGG + Intergenic
967848608 3:194064681-194064703 GAAGAGATGGAGAAAGAGGAAGG + Intergenic
969649702 4:8458287-8458309 GAAGACATGGAGGAGGTGGAAGG - Intronic
970320183 4:14867800-14867822 TACTAGAGGGAGAAGGTGGAAGG + Intergenic
970539220 4:17060500-17060522 GAAATGAAGGGGAAGGTAGAAGG - Intergenic
970807134 4:20050183-20050205 GAAGAGGTGGAGAAAGTGGAAGG - Intergenic
973690754 4:53428113-53428135 GAAGAAATGGAGGAGGTGGAAGG - Exonic
974281256 4:59797235-59797257 GACTTGAAGGGAAAGGTGGAAGG - Intergenic
975426131 4:74230291-74230313 GAAATGATGGGAAAGGTGGCCGG + Intronic
976231338 4:82846509-82846531 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
976426834 4:84913849-84913871 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
977099685 4:92795130-92795152 GAACAGGTGGAGGAGGTGGAAGG + Intronic
977891304 4:102314528-102314550 GAGTTGGTGGGGAAGGTAGAAGG - Intronic
978420412 4:108526764-108526786 GAATATGTGGAGAAGGTGGAAGG - Intergenic
979038143 4:115751866-115751888 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
981351240 4:143732105-143732127 GGATTGTTGGTGGAGGTGGAGGG - Intergenic
982114279 4:152084382-152084404 GAAGAAGTGGAGAAGGTGGAAGG + Intergenic
982644698 4:158009042-158009064 GAATAGATGGGGTTGGTGGATGG - Intergenic
983248808 4:165321231-165321253 GAAGAGGTGGAGGAGGTGGAAGG - Intronic
983279127 4:165658480-165658502 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
983978175 4:173962643-173962665 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
984019713 4:174470298-174470320 GAAGAGATGGAGGAGGTGGAAGG + Intergenic
984375754 4:178926693-178926715 GAATAGGTGGAGAAGGTGGAAGG + Intergenic
984944076 4:184957607-184957629 CAATTGAGGGAGAAGGGGAAGGG + Intergenic
985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG + Intergenic
985993440 5:3582766-3582788 GAATTGATGAGGAAGATGGTTGG - Intergenic
986725423 5:10592960-10592982 GAATTGATGGAGAAGGAACTGGG - Intronic
987009099 5:13741995-13742017 GAATCAAGGGAGAAGATGGAAGG - Intronic
987094287 5:14534424-14534446 GAATTAATGGAGAAAGTAAATGG - Intergenic
987170076 5:15246098-15246120 GAGTTGATGAAAAAGATGGAAGG + Intergenic
987727711 5:21724041-21724063 GAATGGATTGATAAGGAGGAAGG - Intergenic
990079757 5:51898923-51898945 GAAGAGGTGGAGAAGGTGGAAGG + Intergenic
990087517 5:51996967-51996989 CAATTGATTGAAAAGGTGGAGGG + Intergenic
990170863 5:53048183-53048205 GAAGTGATGGAGAAGGTGGCAGG - Intronic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
990999319 5:61767105-61767127 CAATTGATGGGGTAGGGGGAGGG - Intergenic
991418450 5:66416122-66416144 GAATTGATTGAAAAGGTAAAAGG + Intergenic
991609965 5:68439922-68439944 GAATTGAGGGGGAAGGAAGAAGG + Intergenic
992621924 5:78602588-78602610 GAATTGATGTTGATGGTGAAGGG - Intronic
993160730 5:84287807-84287829 GAATGGCTAGAGAAGGAGGAGGG - Intronic
993209621 5:84931915-84931937 GAGTTGCTGGAGAAAGTGTATGG - Intergenic
993220772 5:85094193-85094215 CTCTTGATGGAGAAGGTGCAAGG - Intergenic
993763012 5:91820189-91820211 GAATGGATTGAGAAGGGGGCCGG + Intergenic
994076799 5:95660803-95660825 TAATTGATAGAGAAGATGGTAGG - Intronic
994718468 5:103352242-103352264 ATATTGATGAATAAGGTGGAGGG + Intergenic
994827375 5:104731777-104731799 GAATTAATGGAAAATGTGAAGGG - Intergenic
994900693 5:105764907-105764929 GAATTCAAGGACAAGCTGGAGGG - Intergenic
994946634 5:106402242-106402264 AAATTGATGGATAATATGGAGGG - Intergenic
995139989 5:108725122-108725144 GAATTTATAGAGAAGGAGCAGGG + Intergenic
995507431 5:112874741-112874763 GAACTGATGGAGGATGGGGATGG - Intronic
995815384 5:116161795-116161817 GAATAGACGGAGGAGGTGGAAGG + Intronic
995998426 5:118328385-118328407 AAATTGATGGAGGAGGATGAAGG - Intergenic
996165729 5:120220686-120220708 GAAGTGGAGGAGAAGGAGGAGGG - Intergenic
996675058 5:126165508-126165530 TATTTGATGGGGAAGGTGGAGGG - Intergenic
997131362 5:131279692-131279714 GAACTGGGGGAGAAGGTAGAGGG - Intronic
997526936 5:134559676-134559698 GAAGTGAAGGAGGGGGTGGAAGG + Intronic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
999897563 5:156051907-156051929 GAAATGCTGGTGGAGGTGGAAGG + Intronic
1000292764 5:159886289-159886311 GAAATGAAGAAGAAGGTGGAAGG - Intergenic
1000688410 5:164283343-164283365 GACTTGGGGGAAAAGGTGGAGGG - Intergenic
1000752465 5:165113889-165113911 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1000978207 5:167787829-167787851 GGATTGTTGGTGAAGGTAGAAGG + Intronic
1002140412 5:177134118-177134140 GTAGTGATGGAGGAGGGGGAGGG - Intronic
1002289331 5:178188881-178188903 GACTTGATGAGGAAGGTGGGAGG + Intergenic
1002682783 5:180981417-180981439 GAACCGGTGGAGAAGGAGGAGGG + Intergenic
1003232516 6:4267501-4267523 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1003532201 6:6947074-6947096 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1003765736 6:9234398-9234420 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1004354795 6:14921562-14921584 CAAATGAGGGAGAAGGGGGAAGG + Intergenic
1004442177 6:15663849-15663871 GAATTGACGGAGAGGGAGGAAGG - Intergenic
1006699624 6:35961499-35961521 GAAGTAATGGAGAAGGTGCTGGG - Intronic
1007017465 6:38483124-38483146 GAAATGATGAAGAGGATGGAGGG - Intronic
1007732837 6:43959812-43959834 GAAGAGGTGGAGGAGGTGGAAGG - Intergenic
1008071494 6:47103242-47103264 GAATAGATGGGGAAGGGGAATGG - Intergenic
1008117604 6:47570281-47570303 GATTTAATGAAGAAGGAGGAGGG + Intronic
1008139979 6:47821140-47821162 GAAGTGATGGAGGAAGTGGAAGG + Intronic
1009201293 6:60749827-60749849 GCAGTGATGGAGGTGGTGGAGGG - Intergenic
1010731364 6:79394928-79394950 AAAGTGAGGGAGAATGTGGATGG + Intergenic
1011527575 6:88281956-88281978 GATTTCCTGGAGAAAGTGGAGGG - Intergenic
1011712837 6:90072002-90072024 GAAGGGGTGGAGGAGGTGGAAGG + Intronic
1011927944 6:92671839-92671861 GAATAGCTGGAAAGGGTGGATGG + Intergenic
1012213327 6:96551215-96551237 ACATTGATGGAGCAGGTGGGAGG + Intronic
1013398890 6:109771922-109771944 GAATAGCTGGAAAGGGTGGATGG - Intronic
1013756205 6:113464641-113464663 GAATTGATGGGGAAGGAGAGGGG + Intergenic
1013843081 6:114421246-114421268 GAAATGAATGTGAAGGTGGAGGG + Intergenic
1013919617 6:115387812-115387834 TATTTGATGAGGAAGGTGGAGGG + Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1016379907 6:143466166-143466188 GAAACCATGGATAAGGTGGATGG - Intronic
1016708111 6:147137632-147137654 GAATTGGGGGAGAATGAGGATGG - Intergenic
1017551725 6:155516930-155516952 CAAATGAGGGAGAAGGTGGGTGG + Intergenic
1017986024 6:159443935-159443957 GAATTAGGGGAGAAGGAGGAAGG - Intergenic
1018099775 6:160427162-160427184 GAGCTGATGGGGAAGGTTGAGGG + Intronic
1018174996 6:161170874-161170896 GAACTGATGGTGAGAGTGGAAGG - Intronic
1018656274 6:166040301-166040323 GCTGTGATGGAAAAGGTGGATGG - Intergenic
1019055259 6:169218837-169218859 GGATGGATGGATAAGATGGATGG + Intronic
1019096540 6:169585818-169585840 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1019782603 7:2952680-2952702 AAATTAACGGGGAAGGTGGAAGG - Intronic
1020555923 7:9670208-9670230 CAATGGGTGGAGGAGGTGGAAGG + Intergenic
1021893054 7:25206084-25206106 GATTTCATGGAGATTGTGGAGGG + Intergenic
1022322889 7:29303594-29303616 GAATGGATGGAGGTGGTGGAAGG - Intronic
1022607618 7:31831746-31831768 GAGATGATGGAGAAGATGGAGGG + Intronic
1023654060 7:42402433-42402455 AAAGTGATGGTGAGGGTGGAGGG - Intergenic
1024505988 7:50161983-50162005 GAATTGGTTTATAAGGTGGAGGG + Intergenic
1025962644 7:66237135-66237157 TAAGTGATGGAGCAGGTGGGAGG - Intronic
1027544024 7:79503789-79503811 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1028491496 7:91417330-91417352 GAATTGATGGAAAAAATGCACGG + Intergenic
1028536696 7:91896130-91896152 CAAGTGATGGAGAAGGTGGGAGG + Intergenic
1028738813 7:94248863-94248885 GAATTCATTGAAAAGGTGCAAGG - Intergenic
1028942131 7:96533330-96533352 AGATTGATGGAGACGGTGGGAGG - Intronic
1029008713 7:97236160-97236182 GAATTTATGGGGGAGGTGGGTGG + Intergenic
1029642137 7:101827915-101827937 GAAGGGCTGGAGCAGGTGGAGGG + Intronic
1030273545 7:107695320-107695342 GAATGGGTGGAGAAGGGGGAGGG + Intronic
1030578456 7:111320274-111320296 GATTTGAGTAAGAAGGTGGATGG - Intronic
1030636779 7:111959061-111959083 CAAATGATGGAGAAGAGGGAGGG + Intronic
1031145074 7:117988693-117988715 TAATAGTTGGAGAGGGTGGAGGG + Intergenic
1031209787 7:118808363-118808385 AAAGAGATGGAGGAGGTGGAAGG + Intergenic
1031796192 7:126176936-126176958 GAAGCGGTGGAGGAGGTGGAAGG - Intergenic
1032352208 7:131175119-131175141 GGATAGATGGATAGGGTGGATGG + Intronic
1032445140 7:131975905-131975927 GAATTCATGGCCAAAGTGGATGG - Intergenic
1032461097 7:132112117-132112139 GAAGGGATGAAGAAAGTGGAGGG + Intergenic
1033819517 7:145117112-145117134 GAATTCATGGAGAGAGTAGAAGG - Intergenic
1035984485 8:4411616-4411638 GAATGGAATGAGCAGGTGGAAGG - Intronic
1036001732 8:4612641-4612663 GAGTAGATGGAGAAGGCTGATGG - Intronic
1036008943 8:4698710-4698732 GAAGGAAGGGAGAAGGTGGAAGG - Intronic
1036755775 8:11470274-11470296 GATTTGAGGGAGACGATGGAGGG + Intronic
1037454708 8:19051993-19052015 AAAGTGATGGAGAATGAGGAAGG + Intronic
1039854273 8:41398893-41398915 GAGTAGAGGGAGATGGTGGATGG + Intergenic
1039866669 8:41511256-41511278 TAGTTGGTGGAGAAGGTGGAGGG - Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040584320 8:48725998-48726020 GGATTAATGGATGAGGTGGATGG - Intronic
1040915450 8:52563806-52563828 GAGGGGATGGAGAAGGTGGGAGG - Intronic
1041964700 8:63662552-63662574 GAATTAATTGAAAAGGTGGATGG - Intergenic
1042605884 8:70545978-70546000 GAATTGGTGGTGGAGGTGGGAGG + Intergenic
1043917598 8:85940556-85940578 GAAGGGCTGGAGAAGGAGGAAGG + Intergenic
1044762031 8:95530064-95530086 GAAGAAGTGGAGAAGGTGGAAGG + Intergenic
1044805621 8:96005555-96005577 GAAGGGAAGGAGAAGGTAGATGG + Intergenic
1045563172 8:103285702-103285724 TCATTAATGGAAAAGGTGGAGGG + Intergenic
1045832154 8:106475467-106475489 GAAGAGGTGGAGGAGGTGGAAGG + Intronic
1046033317 8:108809367-108809389 GAATTGATAGAGAAAGTAGGGGG + Intergenic
1046098703 8:109590040-109590062 GGATGGGTGGAGAAGGAGGATGG - Intronic
1047618438 8:126582187-126582209 GAGCTGATAGAGAAGGAGGAAGG - Intergenic
1047733589 8:127746723-127746745 GGAATGATGGAGAAGGCAGAGGG - Intergenic
1048406744 8:134130405-134130427 GAAATGATGGAGAAAATAGAGGG - Intergenic
1048592516 8:135833917-135833939 GAATGAATGGAGAGGATGGATGG - Intergenic
1048651583 8:136484315-136484337 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1048959004 8:139560249-139560271 GGGTTGAGGGAGTAGGTGGAGGG - Intergenic
1050379689 9:5014570-5014592 GGACTGATGGAGAAGGAGCATGG + Intronic
1050777263 9:9280826-9280848 ATATTGAAGGAAAAGGTGGAGGG + Intronic
1050890011 9:10812761-10812783 AGATTGATGGAGATGGAGGATGG - Intergenic
1051281279 9:15443765-15443787 GAATTCCTGGAGAAGCTGGCTGG - Intronic
1052037172 9:23695907-23695929 GAAGTGAGGGAGATGGAGGATGG - Intronic
1053144207 9:35701180-35701202 GAACTGATGGTGCAGGGGGATGG + Intronic
1053259247 9:36647445-36647467 GGCTTCATGGAGAAGGTGGCTGG - Intronic
1053285318 9:36846555-36846577 GCATTGAAGGAGAAAGAGGAAGG - Intronic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1053377587 9:37621060-37621082 AAATTGATGGAGAGGGAAGAAGG + Intronic
1055821318 9:80267870-80267892 GAATTTATGAAGAGGATGGATGG - Intergenic
1055907779 9:81314189-81314211 TAGTTGATTGAGAAAGTGGAAGG + Intergenic
1056024213 9:82475732-82475754 GAAAAGATGGAGGAGGTGGAAGG + Intergenic
1058580200 9:106447540-106447562 AAAGAGGTGGAGAAGGTGGAAGG - Intergenic
1058876987 9:109252900-109252922 TAACTGATGGACAAGGTTGAAGG + Intronic
1059903474 9:118954772-118954794 GAAGTGATGGAGGATGGGGATGG + Intergenic
1060857651 9:126927657-126927679 GAATTGCTTGAGAAGGTTGCTGG - Intronic
1060985455 9:127816738-127816760 GAACTGATGGAGAGGCTAGAGGG + Intronic
1062631844 9:137466629-137466651 GAGGTGATGGAGATGGTGGTAGG - Intronic
1062631856 9:137466678-137466700 GAGGTGATGGAGATGGTGGTGGG - Intronic
1062631869 9:137466727-137466749 GAGTTGGTGGAGATGGTGGTGGG - Intronic
1062631882 9:137466776-137466798 GAGTTGGTGGAGACGGTGGTGGG - Intronic
1062631895 9:137466825-137466847 GAGGTGATGGAGACGGTGGTGGG - Intronic
1062631908 9:137466874-137466896 GAGTTGGTGGAGACGGTGGTGGG - Intronic
1062631944 9:137467021-137467043 GAGGTGATGGAGACGGTGGTGGG - Intronic
1062631956 9:137467070-137467092 GAGTTGGTGGAGACGGTGGTGGG - Intronic
1185613496 X:1406193-1406215 GAATGGATGGATGAGATGGATGG + Intronic
1186392299 X:9173198-9173220 GAATTCAAGGAGAAAGTGGATGG - Intergenic
1186568595 X:10690930-10690952 GAAATGATGGTGATAGTGGATGG + Intronic
1186666601 X:11723170-11723192 GAAATGATGCAGAAAGTGCATGG + Intergenic
1187069778 X:15877139-15877161 ATATTCATGGAGAAGTTGGAAGG + Intergenic
1187102408 X:16207618-16207640 GAAGAGGTGGAGAAGGTGAAAGG + Intergenic
1187251389 X:17601306-17601328 GAAATCATGGAGAAGCAGGAAGG + Intronic
1187342784 X:18436279-18436301 GAAGAGGTAGAGAAGGTGGAAGG + Intronic
1187972959 X:24676959-24676981 GAATTAGTGGAAAAGGAGGACGG - Intergenic
1188138253 X:26516356-26516378 GAAGAGGTAGAGAAGGTGGAAGG - Intergenic
1189016808 X:37293459-37293481 GATTTTATGGATAAGATGGATGG + Intergenic
1189139147 X:38582747-38582769 TAATTGCTGGAGCAGGTGTAGGG - Intronic
1189381698 X:40506847-40506869 GACTTCATGGAGGGGGTGGAGGG + Intergenic
1189585579 X:42458384-42458406 GACTTGAGGGGAAAGGTGGAAGG - Intergenic
1190310003 X:49110528-49110550 TAAGTGAGGGAGAAGGTGGTAGG - Intergenic
1190417447 X:50193988-50194010 GAAATCAAGGAGAAGTTGGAAGG - Exonic
1190430750 X:50375889-50375911 AAACTGATGGAGAGAGTGGACGG - Intronic
1190795029 X:53732998-53733020 GAAGAGTTGGAGGAGGTGGAAGG - Intergenic
1192581616 X:72287484-72287506 AAATTGTTGGAGAGGGTGAAGGG - Intronic
1193319993 X:80109970-80109992 GAAATGAAAGTGAAGGTGGATGG + Intergenic
1194241551 X:91456177-91456199 GACTTGATGGAGAAGGCTTATGG + Intergenic
1194763596 X:97823113-97823135 GAATTCAAGCACAAGGTGGATGG + Intergenic
1195859231 X:109363494-109363516 GAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1195944585 X:110195273-110195295 AAATTGATGGAGGAAGTGCAAGG - Exonic
1196230827 X:113219060-113219082 GAAGAGATGGAGGAGGTGGAAGG - Intergenic
1196964172 X:121037762-121037784 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1197163578 X:123350954-123350976 GATTTGTTGGAGATGATGGATGG - Intronic
1198977970 X:142358568-142358590 GAATTGAAGGAGTTTGTGGATGG - Intergenic
1199074159 X:143510807-143510829 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199093153 X:143714068-143714090 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199192441 X:144986312-144986334 GAAGTAATGGATGAGGTGGAAGG - Intergenic
1199215182 X:145254092-145254114 GATCCGAAGGAGAAGGTGGAGGG + Intronic
1199693645 X:150328185-150328207 GAAGTGATGGTGATGATGGATGG - Intergenic