ID: 919466135

View in Genome Browser
Species Human (GRCh38)
Location 1:197922864-197922886
Sequence CAGGCACCATACCAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 933
Summary {0: 1, 1: 0, 2: 13, 3: 127, 4: 792}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919466135_919466138 -6 Left 919466135 1:197922864-197922886 CCCAGGGCCTGGTATGGTGCCTG 0: 1
1: 0
2: 13
3: 127
4: 792
Right 919466138 1:197922881-197922903 TGCCTGACATTGCTAGTCAATGG 0: 1
1: 0
2: 0
3: 7
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919466135 Original CRISPR CAGGCACCATACCAGGCCCT GGG (reversed) Intronic
900035132 1:401493-401515 CAGGCACCATCGCAGGTGCTGGG + Intergenic
900056752 1:637246-637268 CAGGCACCATCGCAGGTGCTGGG + Intergenic
900160998 1:1223759-1223781 CAGGCACCAGGCAAGGCCCATGG + Intronic
900403148 1:2480908-2480930 GAGCCAGCAAACCAGGCCCTGGG + Intronic
900740750 1:4329317-4329339 CAGGCTCCATTCCTGGCCCCTGG - Intergenic
900969017 1:5979236-5979258 CAGGCACATTTCCAGGCACTAGG + Intronic
901077068 1:6561843-6561865 CAGGCCCAACACCAGGCCGTGGG + Intronic
901178013 1:7318809-7318831 CAGGCACTGTGCTAGGCCCTAGG - Intronic
901282987 1:8053709-8053731 CAGGCACCGTTCTAGGCCCTGGG - Intergenic
901529040 1:9842288-9842310 CAGGAACCACAGCAGGGCCTGGG + Intergenic
901762141 1:11478557-11478579 CCGGAGCCATACCAGCCCCTGGG - Intergenic
901925749 1:12565129-12565151 CTGGCACCATTCCAGGGGCTTGG - Intergenic
902393584 1:16120076-16120098 AAGGCCCCATCCCAGGCCCTGGG + Intergenic
902528835 1:17077372-17077394 CAGGCACTATTCTAGGCTCTGGG - Intronic
902534769 1:17113334-17113356 CAGGCACTGTACCAAGCCCATGG + Intronic
902664981 1:17931151-17931173 CAGGCACTATACCAGGTGCTGGG - Intergenic
902704894 1:18197809-18197831 CAGGCATCATTCTAAGCCCTTGG - Intronic
902721432 1:18306879-18306901 CAGGCAATAGACCAGGCCCCAGG + Intronic
902912870 1:19613639-19613661 CAGGTACTATGCCACGCCCTGGG - Intronic
903051591 1:20605160-20605182 CAGGCACTGTACAGGGCCCTGGG + Intronic
903400089 1:23036993-23037015 CATGCACCACACCAGGCCACTGG - Intronic
903481172 1:23654494-23654516 CATGCACATGACCAGGCCCTAGG + Intergenic
903521873 1:23956878-23956900 CAGGCACTATGCCACGCTCTGGG - Intergenic
903771968 1:25769859-25769881 CAGGCACCATCTGAAGCCCTCGG - Intronic
903820885 1:26101691-26101713 CAGGCACCGTGCTAGGCACTGGG - Intergenic
903927725 1:26842799-26842821 CAGGCACGATTCTAGGCACTTGG - Intronic
903962698 1:27066775-27066797 CAAGCCCCATCCCATGCCCTGGG - Intergenic
904196552 1:28790005-28790027 CAGGCACAGTGCCAGGCACTGGG - Intergenic
904280256 1:29413858-29413880 CAGGCACGGTTCCAGGCCCTGGG - Intergenic
904520596 1:31092400-31092422 GAGCCACCACACCAAGCCCTTGG + Intergenic
904561563 1:31401552-31401574 CAGGCACAATTCTAGGCCCTGGG - Intergenic
904744761 1:32703638-32703660 CTGGCACCATAACAAGCCCCAGG + Intergenic
905004201 1:34697188-34697210 CAGGCACCGTGCCAGGCATTTGG - Intergenic
905012004 1:34754132-34754154 CAGGCACCATACTAGGCACAAGG + Intronic
905573654 1:39026213-39026235 CAGCCACCGTACCAGGCCAACGG + Intergenic
905843355 1:41204823-41204845 CAGGCACTATTCCAGGTGCTGGG - Intronic
905927852 1:41764694-41764716 AAGGCATCATGCCAGGCACTGGG + Intronic
905993916 1:42364520-42364542 CAGCCACCATGCCTGGCCCCAGG + Intergenic
905998129 1:42399851-42399873 CAGGCAGCATGCTAGGCACTGGG + Intronic
905998869 1:42406088-42406110 CAGGCACTATTCCAGGCTTTGGG + Intronic
906038978 1:42772141-42772163 CAGACACCACACTAGGCACTGGG - Intronic
906211746 1:44016103-44016125 CGGGCTCCACTCCAGGCCCTGGG + Intronic
906265126 1:44422985-44423007 CAGGCACCATGCGAGGTACTGGG + Intronic
906300726 1:44679857-44679879 CAGGCATTATGCCAGGTCCTAGG + Intronic
906428139 1:45731649-45731671 GAGCCACCACACCTGGCCCTGGG - Intronic
906518234 1:46452189-46452211 CAGTCACCATCCCTTGCCCTGGG - Intergenic
907264684 1:53250416-53250438 CAGGCACTGTTCTAGGCCCTGGG - Intronic
907329998 1:53664574-53664596 CAGGCACCATTCTAGGCCCTGGG + Intronic
907525008 1:55048947-55048969 CAGGCACCATATTAGGTGCTGGG + Intronic
908264329 1:62363323-62363345 CAGGCACTATTCTAGGCCCTGGG - Intergenic
908643972 1:66256659-66256681 CAGGCACCACACGAGGCCTGGGG - Intronic
909430911 1:75586803-75586825 CAGGCACCGTGCTAGGCCCTTGG - Intronic
909438187 1:75668604-75668626 GAGCCACCACACCCGGCCCTGGG + Intergenic
909881272 1:80881894-80881916 CAGGCACTATGCTAGGCCTTAGG - Intergenic
910134796 1:83955269-83955291 CAGGCACTATTCTAGGACCTGGG - Intronic
911168252 1:94744476-94744498 TAGGTACCATGCCAGACCCTGGG + Intergenic
911172336 1:94783009-94783031 CAGGCACCATCCTAGATCCTAGG + Intergenic
911564560 1:99448227-99448249 CAGGCACTGTGCCAGGCACTAGG - Intergenic
911566677 1:99470757-99470779 CAGGCACTGTACAAGGCACTGGG + Intergenic
912448389 1:109754290-109754312 CAGAGACCATACAAGGCCATTGG - Intronic
912459794 1:109822984-109823006 CAGGCAGCATCCCAGGGCCGGGG + Intergenic
912586488 1:110771625-110771647 CAGGCTCCTTCCAAGGCCCTGGG + Intergenic
912710625 1:111947300-111947322 CAGGCACCATTCCAGGTGCTAGG + Intronic
914490783 1:148149006-148149028 CAGGCTCCACACCAGTCCCGAGG - Intronic
914947555 1:152080186-152080208 CTGGTACAATCCCAGGCCCTTGG - Intergenic
915142280 1:153775191-153775213 CTCGCACCCTACCAGGTCCTGGG - Intronic
915243819 1:154542510-154542532 AAGCCACCATACCCAGCCCTAGG + Intronic
915617504 1:157050834-157050856 CAGGCACCATGCCAGGCCCCGGG + Intergenic
915774711 1:158470496-158470518 CAGGCACCATACAAGGAACTGGG - Intergenic
916975746 1:170075390-170075412 CAAACACCAAACCAGGCTCTAGG + Intronic
917588055 1:176448011-176448033 GAGCCACCATACCCAGCCCTAGG - Intergenic
917688069 1:177438304-177438326 CAGGCCCCATGCTAGGCACTTGG - Intergenic
917904095 1:179572511-179572533 CAGGCACTATTCTAAGCCCTGGG - Intronic
918062396 1:181073244-181073266 CAAGCACTATACCAGGACCTAGG - Intergenic
918466064 1:184822773-184822795 CAGGCGTGACACCAGGCCCTGGG + Intronic
918495551 1:185131854-185131876 GAGCCACCACACCTGGCCCTTGG - Intronic
919121610 1:193347948-193347970 CAGGCACTGTTCTAGGCCCTAGG - Intergenic
919466135 1:197922864-197922886 CAGGCACCATACCAGGCCCTGGG - Intronic
919540438 1:198838899-198838921 CATGCACTATTCCAGGCACTTGG + Intergenic
919632399 1:199972032-199972054 CAGGCACTGTTCCAGGCACTGGG + Intergenic
919728256 1:200897490-200897512 GAGGCCCCAGACCAGGGCCTTGG + Intronic
919808019 1:201392281-201392303 CAGGCACGATTCCAGGGGCTGGG + Intronic
919814592 1:201429562-201429584 CAGGCACCAACCCAGGCCTTGGG + Intronic
919839395 1:201598031-201598053 CAGGCATGATACCAGGCGCCAGG + Intergenic
919876684 1:201874500-201874522 CTGGCACCATGCTAGGCACTAGG + Intronic
919974502 1:202602038-202602060 CAGGTGCCATACCAGGAGCTTGG - Exonic
920370815 1:205478096-205478118 CAGGCACTGTGCCAGGCCCTGGG + Intergenic
920431298 1:205920943-205920965 CAGGCCCCATACCCAGCCTTGGG - Intronic
920432620 1:205928432-205928454 CAGGCACCATGCTGGGCCCTGGG - Intronic
920651513 1:207840737-207840759 CAGGCACCATTCTAGGTACTGGG - Intergenic
921389753 1:214606212-214606234 CAGGCTCCACACCAGTCCCGAGG + Intronic
921739202 1:218664592-218664614 GAGGCACCATGCCAGGCTGTTGG - Intergenic
921929442 1:220743071-220743093 AAGCCCCCATTCCAGGCCCTAGG - Intergenic
922119452 1:222649480-222649502 GAGCCACCACACCAGGCCTTGGG - Intronic
922211126 1:223487612-223487634 CAGGCACCTTCCCAGGCCCCAGG + Intergenic
922457834 1:225791183-225791205 CAGGCCCAACACCAGGCCATGGG + Intergenic
922459055 1:225800801-225800823 CAGGCCCAACACCAGGCCATGGG + Intergenic
922465237 1:225842120-225842142 CAGGCAGTGTGCCAGGCCCTGGG + Intronic
923695064 1:236240694-236240716 CAGGCACCATTCTAGGCACTAGG + Intronic
923778284 1:236999028-236999050 GAGCCACCATGCCAGGCACTGGG - Intergenic
924241032 1:242040689-242040711 GAGCCACCATCCCTGGCCCTTGG - Intergenic
924470706 1:244340337-244340359 CAGCCACAATTCCAGACCCTGGG + Intergenic
1063864065 10:10344954-10344976 CAGGCACCATAGGAGGACTTAGG + Intergenic
1064736913 10:18391498-18391520 CTGGCACTATTCCAGGCACTTGG + Intronic
1064819441 10:19309506-19309528 CAGGCACCGTTCCAGGTGCTGGG + Intronic
1065152801 10:22839517-22839539 CAGGCACCGTGCCAGGCTCTGGG - Intergenic
1065472460 10:26096117-26096139 CAGGCACTGTTCCAGGCGCTGGG - Intronic
1065583788 10:27198165-27198187 CAGGCTCTGTGCCAGGCCCTGGG + Intronic
1066017219 10:31260026-31260048 AAGGCACCATACCTGAGCCTGGG - Intergenic
1066026402 10:31363428-31363450 CTGGTACAATCCCAGGCCCTTGG - Intronic
1067590059 10:47501423-47501445 GAGCCACCGTACCAGGCCCATGG - Intergenic
1067637182 10:48009520-48009542 GAGCCACCGTACCAGGCCCATGG - Intergenic
1067815081 10:49468070-49468092 CAGGCACTATCCCTGGCCATGGG + Intronic
1068727563 10:60320307-60320329 GAGCCACCATACCAGGCCCATGG - Intronic
1069724999 10:70571792-70571814 CAGGCACCATGCCAGGCACCAGG + Intergenic
1069746115 10:70716095-70716117 CAGTCACCAAGGCAGGCCCTCGG - Intronic
1069894444 10:71671976-71671998 CAGGCCCTATACTAGGCCCTGGG + Intronic
1070670695 10:78375362-78375384 CAGACACTGTGCCAGGCCCTGGG + Intergenic
1070707671 10:78652946-78652968 CAAGCAACATGCCAGGCGCTGGG + Intergenic
1070743836 10:78920527-78920549 CAGGCACCGCACCAGCCACTGGG + Intergenic
1070771161 10:79083022-79083044 CAGGCACTCTTCCAGGCCCTGGG + Intronic
1070816827 10:79329596-79329618 CAGGCTCTATTCCAGGCACTAGG - Intergenic
1071235097 10:83636351-83636373 CAGACACTATTCCAGGCACTTGG + Intergenic
1071369248 10:84934516-84934538 CAGGCACTATTCTAGGCTCTGGG + Intergenic
1072421400 10:95292657-95292679 CAGGCACTATTCTAGGCACTGGG - Intergenic
1072579621 10:96729385-96729407 CAGGCCCCATTCCATGTCCTGGG - Intergenic
1072671717 10:97434905-97434927 CAGCCACCATGCCTGGCCTTGGG - Intergenic
1072791408 10:98320948-98320970 CAGGCTCCAGGCTAGGCCCTGGG + Intergenic
1073046654 10:100643034-100643056 CAGGCACTAGTGCAGGCCCTGGG - Intergenic
1073266409 10:102230784-102230806 CGGGCACCGTGCCAGGGCCTGGG - Exonic
1074576794 10:114677209-114677231 CAGTCACCATGCTAGGACCTGGG - Intronic
1074773123 10:116746042-116746064 CAGGCACCATCCTAGGGTCTGGG - Intergenic
1074790135 10:116878287-116878309 CTGGCACCAACCCAGGCCCCTGG - Intronic
1075164387 10:120053924-120053946 CAGGCACTATAGCAGGTGCTAGG + Intergenic
1075209112 10:120476008-120476030 CAGGCACTGTGCCAGGCCCAGGG + Intronic
1075413553 10:122246701-122246723 CCGGCACTATCCTAGGCCCTGGG + Intronic
1075557210 10:123442282-123442304 CAGGCACTATTCCAGGCTCTGGG + Intergenic
1075577283 10:123586716-123586738 AAGCCACCATGCCCGGCCCTTGG - Intergenic
1075614385 10:123881001-123881023 CAGGTACCAAGCCAGGGCCTGGG - Intronic
1075634392 10:124020349-124020371 CTGGCACCAGAGCAGGCTCTGGG + Intronic
1075695991 10:124435749-124435771 CAGGCACTGTGCTAGGCCCTGGG - Intergenic
1075701050 10:124469717-124469739 AAGACACCATCCTAGGCCCTGGG + Intronic
1076423105 10:130346829-130346851 CAGGTACTATTCCAGTCCCTTGG + Intergenic
1076451468 10:130559855-130559877 CAGGTACCATCCCAGCCCCTGGG - Intergenic
1076745419 10:132510358-132510380 CAGGCACGGGACCAGGCCCCAGG - Intergenic
1076757205 10:132578815-132578837 CAGCCACCATGCCATTCCCTGGG - Intronic
1077468348 11:2744579-2744601 CAGGTACCTTACTAGGCCCTGGG + Intronic
1077492193 11:2866712-2866734 CCGGCACCATGCCAGGCTGTGGG - Intergenic
1077646259 11:3928031-3928053 CAGGCACAAATCTAGGCCCTGGG - Intronic
1077649436 11:3956943-3956965 CAGGCACTGTACGAGTCCCTTGG + Intronic
1077891430 11:6420713-6420735 CAGGTCCCAAGCCAGGCCCTAGG + Intergenic
1078064252 11:8067607-8067629 CAGGCACTGTACTAGGCACTGGG + Intronic
1078249969 11:9608833-9608855 CAGGCACCATTCTGGGCACTGGG + Intergenic
1078645445 11:13137825-13137847 CAGACACTGTACAAGGCCCTGGG + Intergenic
1078662487 11:13298603-13298625 CAGGCACCAATCCAGGCACTGGG - Intronic
1078909135 11:15714515-15714537 CAAGCACCATGCTAGGCTCTGGG + Intergenic
1079327693 11:19508389-19508411 CAAGCACAAAACCAGCCCCTTGG + Intronic
1079358302 11:19748577-19748599 CAGGCACCATGCTAGGCGCCAGG - Intronic
1079506042 11:21153471-21153493 CAGGCACTGTACTAGGCACTGGG + Intronic
1080214541 11:29826367-29826389 AAGGCACAATGCCAGGCTCTAGG - Intergenic
1080400793 11:31933813-31933835 CAGGCACCTTGCAAGACCCTTGG - Intronic
1080490195 11:32753894-32753916 GAGGCACCACACCCAGCCCTGGG + Intronic
1080540329 11:33258120-33258142 CCGGCGCCACGCCAGGCCCTGGG + Intronic
1080588038 11:33699083-33699105 CAGCCACCACACCCGGCCCCTGG + Intronic
1081598062 11:44473003-44473025 CCGGCACTGTGCCAGGCCCTAGG - Intergenic
1081710937 11:45214913-45214935 CCAGCACCATGCCAGGCCCTCGG + Intronic
1081794309 11:45809146-45809168 CAGGCACCATGCCAGGCTTTGGG + Intronic
1081809077 11:45905288-45905310 CACGCCCAATCCCAGGCCCTGGG + Intronic
1081869776 11:46378056-46378078 CAAGCACTATTCCAGGCACTGGG - Intronic
1081914510 11:46722199-46722221 CAGGCACTATATCAGGTGCTGGG + Intronic
1082818202 11:57524681-57524703 CAGGCACCATTCCAGGTACTTGG - Intergenic
1082821427 11:57546789-57546811 CAGGCACTGTTTCAGGCCCTGGG + Intronic
1083035601 11:59634660-59634682 CAGCCACTATACCTGGCCCTGGG - Intergenic
1083432936 11:62624150-62624172 GAGGCACCATGCCTGGCCATGGG - Intergenic
1083633252 11:64106429-64106451 CAGGCTCCATGCCAGGCACAAGG + Intronic
1083679986 11:64347146-64347168 CAGGCCCTGTACCAGGCTCTGGG + Intronic
1084420831 11:69059708-69059730 CCAGCACCATCCCAGGACCTGGG - Intronic
1084683333 11:70679689-70679711 CAGACACCGTTCCAGGCCCTGGG - Intronic
1084873714 11:72115329-72115351 CAGACACCTTTCTAGGCCCTGGG + Intronic
1084949372 11:72656320-72656342 CAGGCCCAATATCAGGCCCCAGG + Intronic
1084963367 11:72729631-72729653 GAGCCACCATACCCAGCCCTAGG - Intronic
1085296849 11:75436183-75436205 CCAGCACTCTACCAGGCCCTGGG - Intronic
1085525355 11:77160626-77160648 CACCCACCACACCAGGCCCTGGG + Intronic
1085904553 11:80744627-80744649 CAGGCAATATACCAGGCACTGGG + Intergenic
1086539430 11:87890418-87890440 CATGACCCATACCAAGCCCTTGG + Intergenic
1087045870 11:93843411-93843433 CAGGCACTGTGCTAGGCCCTGGG - Intronic
1087756413 11:102059362-102059384 GAGCCACCATGCCTGGCCCTTGG - Intronic
1087773781 11:102239318-102239340 CAGGGACTATTCTAGGCCCTGGG + Intergenic
1088236582 11:107731577-107731599 CAGGCACTATGCCAGGCACTGGG - Intergenic
1088476623 11:110246488-110246510 GAGCCACCATGCCCGGCCCTGGG - Intronic
1088830082 11:113529475-113529497 TAGGCACTATACCAGACCCTGGG - Intergenic
1088879508 11:113962539-113962561 CGGGCACTATTCCAGGCACTTGG + Intergenic
1089222915 11:116890085-116890107 CAGGCACCGTCCAAAGCCCTGGG + Intronic
1089535611 11:119159079-119159101 CAGGCTCTGTACCAGGCCCTAGG + Intronic
1089751836 11:120657176-120657198 CAGGCACTGTTCTAGGCCCTGGG + Intronic
1090380996 11:126327816-126327838 CAGGCACTATTCCAGGTGCTGGG + Intronic
1090441204 11:126727101-126727123 CAGGCTCCATGCTAGGCACTGGG - Intronic
1090520556 11:127474647-127474669 CAGGCGCCATGCCAGTCCCTGGG - Intergenic
1090667767 11:128926130-128926152 CAAGCACCCCACCAGGACCTGGG + Intergenic
1090821031 11:130341840-130341862 CAGGCAGTGTACTAGGCCCTGGG - Intergenic
1090824158 11:130372004-130372026 CAGGCACCATATATGGCCCTGGG - Intergenic
1090978884 11:131699303-131699325 CAGGCACTGTGCCAGGTCCTAGG + Intronic
1091332122 11:134737887-134737909 CAGGCACCATCCCAGGGGCCTGG - Intergenic
1092757647 12:11778473-11778495 CAGGCACTATACCCAGCCCCAGG - Intronic
1092892970 12:12986464-12986486 CAGGCACCAAACCAGGCTCAGGG - Intronic
1092981401 12:13798320-13798342 AATGCATCATACCAGCCCCTAGG + Intronic
1093075025 12:14749102-14749124 CAGCCTCCATACCAGGACCAGGG + Intergenic
1093245165 12:16727522-16727544 CAGGTACCGTACTAGGCACTGGG - Intergenic
1093955042 12:25207190-25207212 CAGTCACCACACAAGGCACTGGG - Intronic
1093993914 12:25621130-25621152 CAGGCACTGTTCTAGGCCCTTGG - Intronic
1094538500 12:31343199-31343221 AAGCCACCATGCCAGACCCTCGG + Intergenic
1096000819 12:48128519-48128541 CAGGCACTATGCTAGGCACTGGG - Intronic
1096523590 12:52197930-52197952 CAGGCACTATGCCAGGCATTGGG - Intergenic
1096533158 12:52254492-52254514 AAGGCATGATACCAGGCACTGGG - Intronic
1096875421 12:54626412-54626434 CAGGCACTATTCTAGGCACTGGG + Intergenic
1096882522 12:54684531-54684553 GAGGCAACATAACAGGCTCTAGG + Intergenic
1097054786 12:56242929-56242951 CAGGGAGCACCCCAGGCCCTTGG - Exonic
1097694649 12:62764651-62764673 CAGGCACTGTACTAGGCACTGGG + Intronic
1100452008 12:94716132-94716154 CAGGCACAGTATCAGGCACTTGG - Intergenic
1101101143 12:101393967-101393989 CAGGCGCCATACCAGATACTAGG + Exonic
1101180699 12:102213786-102213808 CAGGCACTCTACTAGGCACTGGG + Intergenic
1101230635 12:102737604-102737626 CAGGCACAATGATAGGCCCTGGG - Intergenic
1101542122 12:105674810-105674832 CAGGCACTCTACCAGGTGCTGGG + Intergenic
1101775218 12:107787366-107787388 GAGCCACCACACCTGGCCCTTGG + Intergenic
1102221420 12:111197444-111197466 CAGGCACTGTTCCAGGCACTGGG - Intronic
1102511871 12:113421365-113421387 CAGGCACCCCGCCTGGCCCTGGG - Intronic
1102689043 12:114746177-114746199 CAGGCACCATGCTAGGGGCTGGG + Intergenic
1103175874 12:118862621-118862643 CAGCCTCCATCCCACGCCCTTGG - Intergenic
1103221982 12:119253722-119253744 CAGGCACTATTCTAGGCACTGGG - Intergenic
1103360296 12:120349621-120349643 CAGACACCACTCCAGGCACTGGG - Intronic
1103451756 12:121034084-121034106 CAGGCACCCCACCAAACCCTTGG - Intronic
1103598851 12:122041316-122041338 CTGCCACCATGCCAGGCACTGGG - Intronic
1103684567 12:122721811-122721833 GAGCCACCATGCCAGGCCATCGG + Intergenic
1103795849 12:123502639-123502661 CAGGCACCATATGGGGCCCAGGG - Intronic
1103892676 12:124251637-124251659 GAGCCACGATACCTGGCCCTAGG - Intronic
1103893749 12:124259668-124259690 CAGAAACCATTCCAGGCACTTGG + Intronic
1104047297 12:125172446-125172468 CAGGCACTATCACAGGCACTGGG - Intergenic
1104054792 12:125221234-125221256 CAGGCAGCATTCTAGGTCCTGGG - Intronic
1104939318 12:132387460-132387482 AAGGCCCCATTGCAGGCCCTGGG - Intergenic
1105458551 13:20563256-20563278 GAGCCACCATACCAGGCCTGAGG + Intergenic
1106310855 13:28552995-28553017 CAGGCACTATTCTAGGCCTTGGG + Intergenic
1106666336 13:31854645-31854667 CAGGCACAATGCTAGGCTCTAGG - Intergenic
1106687238 13:32073659-32073681 CAGGCACTGTTCCAGGCACTGGG - Intronic
1106888800 13:34219917-34219939 AAGGAACCATCCCTGGCCCTTGG + Intergenic
1106922517 13:34578724-34578746 CAGGCATCTCACCAGGCCCGGGG + Intergenic
1107132723 13:36913345-36913367 GAGGCCCCAGAACAGGCCCTGGG - Intronic
1107526238 13:41234461-41234483 GAGCCACCACACCTGGCCCTGGG + Intronic
1107889409 13:44901217-44901239 CAGGTACCATCCTAGGCACTGGG + Intergenic
1108622990 13:52202098-52202120 CAGGCACAATTCTAGGCTCTTGG - Intergenic
1108663737 13:52608944-52608966 CAGGCACAGTTCCAGGCTCTTGG + Intergenic
1110626761 13:77662005-77662027 CTGGTACAATCCCAGGCCCTTGG - Intergenic
1110905819 13:80888101-80888123 CACGCAGCAGACCAGCCCCTCGG - Intergenic
1111968401 13:94884374-94884396 GAGCCACCGTGCCAGGCCCTTGG - Intergenic
1111974579 13:94952108-94952130 CAGACTCTAAACCAGGCCCTGGG - Intergenic
1112253507 13:97806281-97806303 CAGGCACCATTCTAGGCACTGGG + Intergenic
1112643677 13:101305843-101305865 CAGGCACTGGCCCAGGCCCTAGG - Intronic
1112714026 13:102163396-102163418 CAGGCACCATACTAAGCTCCAGG + Intronic
1113432338 13:110261803-110261825 CAGGCACTGCACCAGGCCCGGGG - Intronic
1114208288 14:20593911-20593933 CAGGCACTCTTCTAGGCCCTTGG + Intronic
1114423887 14:22606417-22606439 GCTGCACCAGACCAGGCCCTGGG - Exonic
1114542634 14:23473281-23473303 GAGCCACCACACCAGGCCTTGGG + Intronic
1114552768 14:23543184-23543206 CAGGCACCGTGCTAGGCCCTCGG + Intronic
1115359203 14:32482620-32482642 CAAGCACTTTTCCAGGCCCTTGG - Intronic
1116873140 14:50086502-50086524 CAGGCACCCTACAAAGACCTTGG + Intronic
1116960522 14:50963743-50963765 GAGCCACCATACCCAGCCCTGGG - Intergenic
1117049330 14:51844681-51844703 GAGGCACCACACCATGGCCTTGG + Intronic
1117643321 14:57823550-57823572 CAGGCACTATATCAGGCACCAGG - Intronic
1117742199 14:58830381-58830403 CAGGTACCATGCTAGGCACTCGG + Intergenic
1117766875 14:59092745-59092767 CAGGCTCCATTCTAGGCACTGGG - Intergenic
1118225065 14:63890940-63890962 CAGGCACTATATCAGGCACTGGG - Intronic
1118670455 14:68120478-68120500 TAGGCACCTTTCCAGGCACTGGG - Intronic
1118741744 14:68744734-68744756 CAGGCACCACACTAGGTTCTGGG + Intergenic
1119331337 14:73796268-73796290 CTGGAACCATACCAGGACCTGGG - Intergenic
1119491450 14:75037434-75037456 CAGGGACTGTACCAGGCCCTAGG - Intronic
1119851056 14:77867044-77867066 CAGGTACTACACCAGCCCCTGGG + Intronic
1119890969 14:78181914-78181936 CAGGCACTATACCAGGTGCTGGG + Intergenic
1120546028 14:85812553-85812575 CATGCTTCATGCCAGGCCCTTGG + Intergenic
1120703327 14:87722764-87722786 CAGGCACTATTCCAGGTGCTGGG + Intergenic
1120845509 14:89121647-89121669 CAGGGACCATGTCAGGCCCTGGG + Intergenic
1120924009 14:89780125-89780147 CAGGCCCCATGCCAGGCACTGGG - Intergenic
1121025621 14:90614048-90614070 CAGGCACTATTCCAGGAGCTGGG - Intronic
1121346270 14:93137977-93137999 CAGGCACCACACCAGGGGCTGGG - Intergenic
1121735822 14:96217538-96217560 CTGGCTCCATGCCAGCCCCTGGG + Intronic
1121750267 14:96348396-96348418 GAGCCACCATGCCTGGCCCTTGG - Intronic
1121777866 14:96602703-96602725 CAGGCACTATGCCAGGTCTTGGG - Intergenic
1122389563 14:101370985-101371007 CAGGCACCATGCTAGGCACGGGG + Intergenic
1123448161 15:20344404-20344426 CAGGCATCAGACCAGGAGCTCGG - Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1125029976 15:35066504-35066526 CAGGCACTATGCTAGGTCCTAGG - Intergenic
1125608936 15:40958010-40958032 CATGCACCATTCCAGGCACGGGG + Intergenic
1125786027 15:42318876-42318898 GAGCCACCATGCCTGGCCCTAGG + Intronic
1125788285 15:42342147-42342169 CGGGCACCATGCTAGGCTCTGGG - Intronic
1125807181 15:42503652-42503674 GAGCCACCATACCCGGCCTTTGG + Intronic
1126041381 15:44594459-44594481 CAGTCACCACACCTGGCCCAGGG - Intronic
1126492772 15:49258160-49258182 CAGGCACTATTCCTGGCACTGGG + Intronic
1126589701 15:50326371-50326393 GAGCCACCATACCTGGCTCTTGG - Intronic
1126861657 15:52890173-52890195 CCAGCACCATACTAGACCCTGGG - Intergenic
1127321062 15:57846966-57846988 CAGGCACCATGCTAGGCACTGGG - Intergenic
1127907433 15:63386346-63386368 CAGGCACTATGCTAGGCTCTTGG + Intergenic
1127966643 15:63927640-63927662 CAGGCACTGTACCAGGCACTAGG - Intronic
1128263612 15:66250498-66250520 CAGGCACTGGACTAGGCCCTTGG - Intronic
1128291634 15:66482666-66482688 CAGGCCCCATGCCAGGCACTAGG - Intronic
1128310682 15:66630277-66630299 CAGGCACCATGCTAGGTGCTGGG + Intronic
1128352378 15:66899776-66899798 CAAGCACCATTCTAGACCCTGGG - Intergenic
1128584530 15:68836577-68836599 GAGCCACCATGCCTGGCCCTGGG - Intronic
1128588901 15:68876799-68876821 GAGCCACCATGCCCGGCCCTGGG + Intronic
1128759981 15:70209984-70210006 CAGGTACTATTCCAGGCACTGGG - Intergenic
1128917136 15:71573206-71573228 CAGGCACTGTGCAAGGCCCTGGG - Intronic
1128929362 15:71690353-71690375 CAGGCACCATCCCAGGAGGTGGG - Intronic
1128945073 15:71814259-71814281 CAGGCACAGTGCCAGGCCCCGGG + Intronic
1129169276 15:73798009-73798031 CAGGCCCCATTCTGGGCCCTGGG + Intergenic
1129237013 15:74229810-74229832 CAGGCAACATGCTGGGCCCTGGG + Intergenic
1129339336 15:74874609-74874631 TAGGCAACATACCAGGACCCTGG + Intergenic
1129524715 15:76206439-76206461 CTGGCACCATGCCAGGCCCTGGG + Intronic
1129960117 15:79676448-79676470 CAAGCACTAGACCAGGCTCTGGG - Intergenic
1130356156 15:83132369-83132391 CAGGCTCCTTACCAAGCCCATGG - Exonic
1130533032 15:84762137-84762159 CAGGCACTATTCTAGGCACTGGG + Intronic
1130996131 15:88905362-88905384 CAGACACCATTCTAGGCCCTGGG + Intronic
1131209517 15:90481740-90481762 CAGGCACAATAACAGGCACTTGG - Intronic
1131434756 15:92413929-92413951 TAGGCACCAGCCCAGACCCTGGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132142853 15:99409350-99409372 CAGCCACCGTGCCCGGCCCTGGG - Intergenic
1132827279 16:1911659-1911681 CAGGCGCCGGACCAGGGCCTGGG + Exonic
1133202115 16:4210059-4210081 CAGGCAGGGTGCCAGGCCCTGGG - Intronic
1133219148 16:4311473-4311495 CTGACAACATGCCAGGCCCTGGG + Intergenic
1133595467 16:7286911-7286933 GAGTCACCATGCCTGGCCCTGGG + Intronic
1133608056 16:7407509-7407531 CAGGCAACATAGCAGCCTCTGGG - Intronic
1133857808 16:9565994-9566016 CAGGCGCCATTCTAGGCACTGGG - Intergenic
1134041729 16:11073770-11073792 CAGGCCCTGTGCCAGGCCCTAGG - Intronic
1134135241 16:11673044-11673066 CAGGCACCCCAGCAGGCCCTGGG + Intronic
1134511758 16:14854261-14854283 CAGGCACCATTCCAGGACTGGGG + Intronic
1134619332 16:15675708-15675730 GAGGCACCACACCTGGCTCTGGG + Intronic
1134620080 16:15681543-15681565 GAGCCACCATACCCGGCCTTTGG + Intronic
1134681953 16:16132456-16132478 CAGCCACCATTCCTGGCCCCTGG + Intronic
1134699401 16:16252757-16252779 CAGGCACCATTCCAGGACTGGGG + Intronic
1134773590 16:16832369-16832391 CAGGCACCATGCAAGGCACTGGG + Intergenic
1134798902 16:17066459-17066481 CAGGCACCACACCAAGCACCAGG - Intergenic
1134806000 16:17125977-17125999 CAGGCACTGTACAAGGCCCTGGG + Intronic
1134904641 16:17969843-17969865 CAGGTACCATGCTAGGCCCTGGG + Intergenic
1134972428 16:18541915-18541937 CAGGCACCATTCCAGGACTGGGG - Intronic
1135075819 16:19392761-19392783 CAGGCACCATCCTAGGCACTGGG + Intergenic
1135138483 16:19902216-19902238 CAGGCACTGTCCCAGGCCCTTGG + Intergenic
1135231974 16:20716840-20716862 CAGACCCAATACCAGGCCGTGGG - Intronic
1135725816 16:24853251-24853273 CAGGCTCTGTACTAGGCCCTGGG - Intronic
1135725826 16:24853315-24853337 CAGGCTCTGTACTAGGCCCTGGG - Intronic
1136005180 16:27324462-27324484 CAGGCACCGTGCTAGGCTCTGGG + Intronic
1136012613 16:27373786-27373808 CAGGCACTGTTCTAGGCCCTGGG - Intergenic
1136420801 16:30131678-30131700 GAGCCACCATGCCTGGCCCTTGG + Intergenic
1136429334 16:30187686-30187708 GAGGTAACATCCCAGGCCCTGGG - Intronic
1136532080 16:30876514-30876536 CAGGCACCACACTAGGCCCTAGG + Intronic
1136549975 16:30977800-30977822 CCGGCACCAGGCCCGGCCCTAGG - Intronic
1137058173 16:35755179-35755201 CTGGCACCATAGCAGCCTCTGGG + Intergenic
1137272083 16:46908430-46908452 CCAGCACCATTCCAGGCCCTGGG - Intronic
1137500774 16:49010372-49010394 CAGGCAGCAGCCCTGGCCCTTGG + Intergenic
1137505669 16:49051852-49051874 CAGTTTCCATCCCAGGCCCTTGG - Intergenic
1137788470 16:51155129-51155151 CAGGCCCCATCCCAGACCCGAGG - Intergenic
1137830567 16:51539464-51539486 CAGTCACCAGCCCATGCCCTGGG + Intergenic
1137866228 16:51899391-51899413 CAGGCACTGTGCCAGGCTCTGGG - Intergenic
1138088815 16:54157361-54157383 CAGCCACCATGCCAGGCCCGTGG + Intergenic
1138556998 16:57776642-57776664 CAGGCACTGTTCCAGGCACTGGG - Intronic
1138727692 16:59158673-59158695 CAGGCATCATACTAAGCACTTGG - Intergenic
1139327133 16:66161247-66161269 CCTGCACCAGACCAGCCCCTAGG - Intergenic
1139666574 16:68461179-68461201 CAGGCACCATTCTAGGCACTGGG - Intergenic
1140302773 16:73774277-73774299 CAAGCACCATGCTAGGCCATGGG - Intergenic
1140513357 16:75524419-75524441 CAGGCCCAGTACCAGGCCCCAGG - Intergenic
1140804266 16:78518683-78518705 CAGCCACCATGCAAGGTCCTGGG + Intronic
1140929029 16:79610005-79610027 CAGGCACCATGCCAAACACTTGG - Intergenic
1140957247 16:79877042-79877064 CAGACACCATTCCAGGTGCTGGG + Intergenic
1140963310 16:79938756-79938778 CAGGAACTATGCCAGGCACTTGG + Intergenic
1140963403 16:79940163-79940185 CAGGAACAATGCCAGGCACTTGG + Intergenic
1141234146 16:82199869-82199891 CAGGCACCATGCTAGGTGCTGGG + Intergenic
1141247073 16:82317912-82317934 CAGGCTACATTCCAGGCACTGGG - Intergenic
1141400599 16:83743848-83743870 CAGGCACTCTACTCGGCCCTGGG + Intronic
1141466064 16:84206533-84206555 CAGACACGGTTCCAGGCCCTGGG - Intergenic
1141648370 16:85379340-85379362 CAGGCACCATTCTAGGCACTGGG - Intergenic
1141761440 16:86031232-86031254 CAGGCTTTGTACCAGGCCCTGGG + Intergenic
1141773738 16:86107727-86107749 CAGGCACTATACCAAGTACTGGG - Intergenic
1141919214 16:87124058-87124080 CACGCCCCAAACCAAGCCCTGGG + Intronic
1142177588 16:88652085-88652107 CAGCCACCATCCGAGGCACTTGG + Exonic
1142575575 17:904826-904848 GAGCCACCATGCCCGGCCCTTGG + Intronic
1142684235 17:1568433-1568455 CAGGCACGATTCTAGGCACTGGG + Intergenic
1143053762 17:4147331-4147353 CAGGCACTGTACCAGACACTGGG + Intronic
1143253423 17:5538685-5538707 TAAGCACCAGACCAGGCCTTGGG - Intronic
1144237818 17:13279136-13279158 CAGGCACCATAACAGGCCTTGGG - Intergenic
1145016745 17:19403715-19403737 CAGACATCATACTAGGCTCTGGG - Intergenic
1145191364 17:20843602-20843624 CAGGCTCCACACCAGTCCCGAGG - Intronic
1145272925 17:21414155-21414177 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145311128 17:21701591-21701613 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145325658 17:21821911-21821933 CAGGCACCATGCTAGGCCCTGGG - Intergenic
1146013951 17:29217695-29217717 TAGGCACCATGCCAGGCTCTGGG + Intergenic
1146231148 17:31110995-31111017 CATGCACTATACTAAGCCCTGGG - Intronic
1146334118 17:31954507-31954529 TAGGCACTATACTAAGCCCTCGG + Intronic
1146470515 17:33120823-33120845 CAGCTACCAGGCCAGGCCCTGGG - Intronic
1146470583 17:33121282-33121304 CAGGAACCACATCAGGCCTTGGG + Intronic
1146558006 17:33843229-33843251 CAGGCACCATAGTAGGTTCTTGG - Intronic
1146645467 17:34574175-34574197 CAGGCACCATTCTGGGCACTGGG + Exonic
1146783445 17:35696891-35696913 CAGACATCGTTCCAGGCCCTGGG - Intronic
1146805540 17:35862280-35862302 CAGGCACTGTCCTAGGCCCTTGG - Intronic
1146860546 17:36294150-36294172 GAGCCACCATGCCTGGCCCTGGG + Intronic
1147090875 17:38098248-38098270 GAGCCACCATGCCTGGCCCTGGG + Intergenic
1147106336 17:38222258-38222280 GAGCCACCATGCCTGGCCCTGGG - Intergenic
1147180844 17:38684741-38684763 CAAGCCCCAGGCCAGGCCCTGGG + Intergenic
1148052585 17:44776426-44776448 CAGGCACCGGGCCAGGCGCTGGG - Intronic
1148317719 17:46718085-46718107 CAGGCACCACCTCAGGGCCTGGG + Intronic
1148423175 17:47566261-47566283 GAGCCACCATGCCTGGCCCTGGG + Intronic
1148465610 17:47863379-47863401 CAGGCACCATTCCAAGCACTGGG - Intergenic
1148756365 17:49975241-49975263 CAGGCACCTTACCAGCCCCCAGG + Intergenic
1148989478 17:51652845-51652867 CAGTCACCATGCTAGCCCCTGGG - Intronic
1149209540 17:54287797-54287819 CAGGGACCATAGCAGGTTCTTGG + Intergenic
1149566751 17:57645710-57645732 GAGACACCACACCTGGCCCTGGG + Intronic
1149814117 17:59706580-59706602 CAGGCACCATACTAGACTCTGGG - Intronic
1150091393 17:62328981-62329003 CAGGCACTGTTCTAGGCCCTTGG + Intergenic
1150133297 17:62680646-62680668 CAGGCACCGTGCCAGGCCCCAGG - Intronic
1150301350 17:64049623-64049645 CAGGCACCATTCTGGGCCCTGGG - Intronic
1150447923 17:65242026-65242048 AAGCCACCATACCTGGCCTTTGG - Intergenic
1150545527 17:66153876-66153898 GAGCCACCACACCCGGCCCTTGG - Intronic
1150597175 17:66616510-66616532 CAGGCACCGTGCTAGGCACTGGG + Intronic
1151248571 17:72815635-72815657 GAGCCACCACACCTGGCCCTAGG - Intronic
1151269689 17:72984595-72984617 CAGGCCCCATTCCAGGCCTCTGG + Intronic
1151297674 17:73197468-73197490 CAGCCACCATGCTAGGCTCTGGG + Intronic
1151644742 17:75422750-75422772 CAGGCACACCACCAGGCACTAGG + Intergenic
1151818446 17:76483567-76483589 CAGCCACCACACCCGGCCCTAGG + Intronic
1152252950 17:79221221-79221243 CAGGCTCCCGACCGGGCCCTGGG - Intronic
1152340636 17:79722176-79722198 CAGGCATCAGACCAGGAGCTCGG + Intergenic
1152564064 17:81092383-81092405 GACACACCACACCAGGCCCTGGG + Intronic
1152611151 17:81315530-81315552 CTGTCACCACCCCAGGCCCTGGG - Intronic
1152660771 17:81540974-81540996 CAGGCCCCCCACCTGGCCCTGGG + Intronic
1152747322 17:82047293-82047315 CAGCCAACAGCCCAGGCCCTTGG - Intergenic
1152814843 17:82401424-82401446 GAGCCACCACACCCGGCCCTGGG + Intronic
1152835224 17:82525500-82525522 TAGCCTCCAGACCAGGCCCTTGG - Intronic
1152908807 17:82985114-82985136 CAGGCACCACCCCAGGCCACTGG + Intronic
1153192485 18:2557346-2557368 CAGGCACTATTCTTGGCCCTAGG - Intronic
1153355046 18:4125145-4125167 CAGGCATTATGCCAGGCACTGGG + Intronic
1153986141 18:10352568-10352590 CAGGAACAGGACCAGGCCCTCGG + Intergenic
1154289279 18:13092868-13092890 GAGCCACCATACCTGGCCGTAGG - Intronic
1155282939 18:24259257-24259279 CAGGGACCATTCCAGGTACTAGG - Intronic
1155511294 18:26580147-26580169 CAAGCCCCATTCCAGGCTCTTGG + Intronic
1156209990 18:34928942-34928964 CAGGTAACATCCCAGGCCCTGGG - Intergenic
1156267369 18:35500839-35500861 GAGCCACCATACCTGGCCTTGGG - Intergenic
1156376197 18:36517338-36517360 CATGCACCATGTCAGGCCCTGGG + Intronic
1156456812 18:37299427-37299449 CGGCCCCCATACCAGGCCCCTGG - Intronic
1156813641 18:41282186-41282208 CAGTCACCAGTCCAGGCCTTCGG + Intergenic
1157399334 18:47373936-47373958 CAGGCACCATGACAGGACATGGG - Intergenic
1157842226 18:50968778-50968800 CATGCACCATTCTAGGCACTAGG - Intronic
1157880102 18:51313368-51313390 CAGGTACCAGGCCAGGCTCTGGG + Intergenic
1158143232 18:54280021-54280043 CAGTCACTATCACAGGCCCTTGG + Intronic
1158296449 18:56002240-56002262 CAATCACCATTCCAGACCCTCGG - Intergenic
1159457858 18:68685144-68685166 TAGGCACCATACCAAGCCACAGG + Intronic
1160185780 18:76675186-76675208 CAGGCACCTTTCCAGGCTCTGGG - Intergenic
1160196928 18:76763259-76763281 GAGCCACCATACCCGGCCCTTGG + Intergenic
1160270150 18:77376294-77376316 CGGGCACCATTCCAAGCTCTAGG - Intergenic
1160592110 18:79950897-79950919 CAGGAGCCAGTCCAGGCCCTCGG + Exonic
1160694060 19:474132-474154 CAGGCCCCAAGCCAGGTCCTCGG - Intronic
1160838597 19:1136350-1136372 CAGGGCCCATACCAGGCACCTGG - Intronic
1160919787 19:1513961-1513983 CAGGGATGAGACCAGGCCCTGGG + Intergenic
1160994836 19:1877820-1877842 CAGGCTCCACACCAGTCCCGAGG + Intronic
1161792437 19:6368469-6368491 CAGGACCCAGACCTGGCCCTGGG + Intronic
1162145914 19:8611898-8611920 CAGGCACTGTACCAGGCGCCTGG - Intergenic
1162150023 19:8638545-8638567 CAGGCTCCATTCCAAGCACTGGG + Intergenic
1163129591 19:15264291-15264313 CAGCCACCGTTCCAGGGCCTGGG + Intronic
1163517450 19:17773724-17773746 CTGGAACCAGACCAGCCCCTTGG + Intronic
1164539048 19:29108709-29108731 CAGGCATTTTACAAGGCCCTGGG + Intergenic
1164577859 19:29416693-29416715 CAGGTACCACGCCAGGTCCTGGG - Intergenic
1164609891 19:29624710-29624732 AAGGCACCACACCTGGCCCAAGG - Intergenic
1165110017 19:33496871-33496893 CAGGGCCCAGACCAGGCCCGAGG + Intronic
1166133067 19:40758347-40758369 CAGGCGCCATTCAAGGCTCTGGG - Intronic
1166358096 19:42239289-42239311 AAGGAACCAGACCAGGGCCTCGG - Intronic
1166534538 19:43564137-43564159 CAGGCAGTATTCCAGGCACTTGG - Intronic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167497251 19:49826926-49826948 CTGGAACCAACCCAGGCCCTCGG - Intronic
1167538198 19:50068843-50068865 CAGCCACCAAGCCAGGCTCTAGG - Intergenic
1167961083 19:53104436-53104458 GAGCCACCATACCTGGCCCCAGG + Intergenic
1168426040 19:56239877-56239899 GAGCCACCACACCTGGCCCTAGG - Intronic
925488856 2:4369250-4369272 CAGGCTCCTACCCAGGCCCTGGG - Intergenic
925879158 2:8336548-8336570 CCAGGACCATACCAGACCCTGGG - Intergenic
925910093 2:8568178-8568200 CAGGCACCAGGCCAAGCACTAGG - Intergenic
925953465 2:8937818-8937840 CAGGCACTCTGCTAGGCCCTGGG + Intronic
926138496 2:10354355-10354377 CAGGGAAGATAGCAGGCCCTGGG - Intronic
926276013 2:11403779-11403801 CAGGAACCATACTAGGGACTAGG - Intergenic
926701358 2:15806178-15806200 CAGATACCGTACCAGGCCCTGGG - Intergenic
926738955 2:16095213-16095235 CAGGCACAATACTAGGTGCTAGG - Intergenic
927884116 2:26707984-26708006 CAGGCCCCATTCTAGGCCCCAGG + Intronic
928936323 2:36682662-36682684 CAGGCTCTACACCAAGCCCTGGG + Intergenic
929008861 2:37421750-37421772 TAGACACCACACCAGGCTCTGGG + Intergenic
929885206 2:45871987-45872009 CAGGCACCATGGGAGGCACTGGG + Intronic
930382220 2:50645579-50645601 CAGGCACTCTCCCAGTCCCTGGG - Intronic
930819297 2:55629454-55629476 CAGCCACCATACCTGGCCAATGG - Intergenic
931061411 2:58533644-58533666 CAGTCATCATGTCAGGCCCTGGG + Intergenic
931092845 2:58904820-58904842 CAGGCACTCTTCTAGGCCCTGGG - Intergenic
931183516 2:59927513-59927535 CTGGCACCATTCAAGACCCTGGG + Intergenic
931423822 2:62152560-62152582 CAGGCACCATGCTAGGTGCTGGG - Intergenic
931630576 2:64295008-64295030 CAGGAACCCTACCAGGTTCTAGG - Intergenic
931738109 2:65216607-65216629 CAGGCTCCATTCTAGGACCTGGG - Intergenic
932063319 2:68528843-68528865 CTGGTACAATCCCAGGCCCTTGG - Intronic
932144728 2:69307198-69307220 CAGGCACTTTTCTAGGCCCTGGG - Intergenic
932327085 2:70870496-70870518 GAGCCACCATTCCTGGCCCTTGG + Intergenic
932369669 2:71176702-71176724 CAAGCACCATGCTGGGCCCTGGG - Intergenic
934051564 2:88215494-88215516 GAGGCACTCTACCAGGCCCCCGG + Intergenic
935204723 2:100887796-100887818 CCGGCACCAGCCCAGGCCCTCGG - Intronic
936156649 2:110051320-110051342 CAGGCACCATGCTAGGCACTGGG - Intergenic
936188043 2:110320124-110320146 CAGGCACCATGCTAGGCACTGGG + Intergenic
936287756 2:111194258-111194280 CAGGCACCATTCTAGGCACTAGG + Intergenic
936376481 2:111945723-111945745 AGGGCACCAAACCAGGACCTGGG - Intronic
936385569 2:112025405-112025427 CAGCCAACACACCAGGTCCTGGG - Intronic
936919163 2:117670118-117670140 CAGGCACCATGCTAGGCACTGGG + Intergenic
937102625 2:119283351-119283373 CTGGCACCAAGGCAGGCCCTGGG - Intergenic
937159252 2:119744751-119744773 CAGGCATCATGCCAGGATCTGGG - Intergenic
937261661 2:120590523-120590545 CAGACACTGTACAAGGCCCTAGG - Intergenic
937314459 2:120922133-120922155 CAGGCACTGTTCTAGGCCCTGGG - Intronic
938032724 2:128009185-128009207 CAGCCACCACACCTGGCCCTGGG - Intronic
939118229 2:138086151-138086173 CAGGCACTGTACAAGGTCCTGGG - Intergenic
939802659 2:146730350-146730372 CAGGCACTGTTCCAGGCACTGGG + Intergenic
939970238 2:148650153-148650175 CAGGCACAGTTCCAGGCACTTGG - Intronic
940012579 2:149070521-149070543 CAGGCACTCTTCCAGGCACTGGG - Intronic
940634654 2:156283963-156283985 CAGGCACAGTCCTAGGCCCTGGG - Intergenic
941150392 2:161907455-161907477 CAGGCACTATACTAGGTGCTAGG + Intronic
941343632 2:164339171-164339193 CAGGCCCTATTCCAGGGCCTGGG + Intergenic
942058197 2:172204818-172204840 CAGGCACCATTCCTGGAGCTTGG - Intergenic
942065134 2:172263649-172263671 GAGGCACCACACCCGGCCTTTGG - Intergenic
943957605 2:194212717-194212739 CAGGCACCATTCTCGGCTCTGGG + Intergenic
944207229 2:197169459-197169481 CAGGCACCATGACAGGTGCTGGG - Intronic
944315387 2:198279804-198279826 CAGCTTCCATACCAAGCCCTAGG - Intronic
944514940 2:200503202-200503224 CAGGCACTATTCCAGACACTTGG - Intronic
945011242 2:205466081-205466103 CAGGCCCCATCCCAGACCCCTGG - Intronic
945201063 2:207281998-207282020 CAGGCACCATGATAGGCACTGGG + Intergenic
945210190 2:207374936-207374958 GAGGCCCCTTTCCAGGCCCTAGG + Intergenic
945267893 2:207909483-207909505 CAAGCACTATGCCAGGCACTAGG + Intronic
945325868 2:208481493-208481515 GAGCCACCATACCCGGCCTTTGG + Intronic
945855367 2:215062959-215062981 CAGGCACCATTCTAGGCACTGGG - Intronic
946047262 2:216831534-216831556 CCGGCACTATACCAGGGCTTTGG - Intergenic
948075976 2:235165483-235165505 CAGGCCCCACCCCAGACCCTCGG + Intergenic
948785487 2:240350228-240350250 CAGGCACTGTCCCAGGCCCCAGG - Intergenic
948798967 2:240421549-240421571 CAGGGCCCATGCCAGGCCATGGG + Intergenic
948815579 2:240508689-240508711 CAGGCACCATTCTAGGCACTAGG - Intronic
1168762052 20:356038-356060 CAGCCACCCCTCCAGGCCCTAGG - Intronic
1168989879 20:2085964-2085986 CAGGCACTGTACAAGGCACTTGG - Intergenic
1169489382 20:6058115-6058137 CAGACACCACCCCAGGCACTAGG - Intergenic
1170681113 20:18526429-18526451 CAACCACCATGCCAGGCCCTTGG - Exonic
1170730508 20:18970817-18970839 AAGTCACCTTACCAAGCCCTAGG - Intergenic
1170742921 20:19073624-19073646 CAGGCACCATGCCAGACACTGGG + Intergenic
1171382377 20:24743369-24743391 CAGGCACCATACCAGGTACTGGG + Intergenic
1172221949 20:33280219-33280241 CAGGGTCCACACCCGGCCCTGGG + Intronic
1172293508 20:33792206-33792228 CGGGCACCATGCCAAGCCCCTGG - Exonic
1172382599 20:34508524-34508546 GAGCCACCATGCCCGGCCCTAGG - Exonic
1172484141 20:35288324-35288346 CAGGCATCATGCCAGGCTCAGGG - Intronic
1172574374 20:35996247-35996269 CAGGCATAATACGAAGCCCTGGG - Intronic
1173151595 20:40570872-40570894 CAGACACCGTGCCAGGCACTGGG + Intergenic
1173538516 20:43833719-43833741 CAGGCACTGTTCCAGGTCCTAGG + Intergenic
1173549097 20:43920160-43920182 CAGGCACGATGCCAGGTGCTGGG - Intronic
1173576904 20:44118112-44118134 CAGGCACTGTACCAGGCTCTGGG - Intronic
1173686710 20:44928986-44929008 GAGCCACCACACCTGGCCCTGGG - Intronic
1173752749 20:45489705-45489727 CAGGGACCAGACAAGGCCCCAGG + Intergenic
1173947504 20:46963398-46963420 CAGGCACCGTGCCAAGCCCTGGG + Intronic
1174039733 20:47690364-47690386 CAGGCACCCTGCTAGGCACTGGG + Intronic
1174179119 20:48663965-48663987 CAGGCACCGTGCCAGGTTCTGGG - Intronic
1174301957 20:49588985-49589007 CAGACACCATGCCAGGTGCTAGG + Intergenic
1174364462 20:50048137-50048159 CAAGCACCATGCTAGGCACTGGG - Intergenic
1174513471 20:51073564-51073586 CAGGCACTGTTCCAGGCTCTAGG + Intergenic
1174870856 20:54180667-54180689 CAGGCACCATTCCTAGCACTAGG + Intergenic
1175225173 20:57440365-57440387 GGGGCACCATACCAGGCCCAGGG - Intergenic
1175324121 20:58110655-58110677 CTGGCACCATGCAAGGCCCAGGG - Intergenic
1175353901 20:58346739-58346761 CAGGCACCATGCTAGGCCCTGGG - Intronic
1175504450 20:59471623-59471645 CAGGCACTGTTCCAGGCACTGGG + Intergenic
1175521060 20:59603296-59603318 CAGGCACCACACCAGGCATTAGG - Intronic
1175589600 20:60178004-60178026 CAGGCTCCATTCCAGGAGCTGGG + Intergenic
1175607639 20:60323931-60323953 AAGCCACCACACCTGGCCCTGGG + Intergenic
1175904075 20:62371306-62371328 CAGGCACCATGCCAGGAGCATGG + Intergenic
1176039297 20:63056004-63056026 CCGGCTCCCTGCCAGGCCCTGGG + Intergenic
1177190568 21:17846820-17846842 CAGACACCATGCCAGGCACTGGG + Intergenic
1177762165 21:25414377-25414399 CAGGCACTCTATTAGGCCCTAGG - Intergenic
1178432785 21:32531240-32531262 CAGGGACCAGGCCAGGCACTAGG + Intergenic
1178533925 21:33397224-33397246 CTGGCAGCTTCCCAGGCCCTGGG + Intergenic
1178958708 21:37044850-37044872 CAGGTACCATTCTAGGCCTTAGG + Intergenic
1179520933 21:41944047-41944069 CAGGCAACATGCCAGCCGCTCGG + Intronic
1179842465 21:44086226-44086248 CAGGCAAGATACCAGGACCGGGG - Intronic
1179896175 21:44364921-44364943 CAGGCCCCATCCCAGGCCTGTGG + Intronic
1180855801 22:19044004-19044026 CAGGCACGTCACCAGTCCCTGGG - Intronic
1180907380 22:19424122-19424144 CAAGTACCATTCCTGGCCCTGGG + Intronic
1181120894 22:20668353-20668375 CAGGCTCCACACCAGTCCCGAGG + Intergenic
1181333856 22:22115378-22115400 CAGGCTCCACACCAGTCCCGAGG + Intergenic
1181510640 22:23387243-23387265 CAGGCCACAGCCCAGGCCCTGGG + Intergenic
1182098739 22:27643065-27643087 CTTGCACCATGCCAGGCTCTGGG - Intergenic
1182265948 22:29115547-29115569 CCGGGACCACTCCAGGCCCTGGG + Intronic
1182364109 22:29766505-29766527 CAGGGACCAGAACAGGCGCTGGG + Intronic
1183068270 22:35378699-35378721 CAGGCACTATTCCAGGAACTGGG + Intergenic
1183268583 22:36846700-36846722 CAGGCACAGTGCTAGGCCCTGGG - Intergenic
1183329531 22:37211971-37211993 CAGGTTCCCTCCCAGGCCCTCGG + Exonic
1183344166 22:37297909-37297931 CAGGCACCATCCTAAGCCCTGGG + Intronic
1183346755 22:37312341-37312363 CTGGCACCAGGCCAGGCCCCAGG + Intronic
1183659445 22:39210085-39210107 CAGGCACCAAGGCAGGCCTTAGG + Intergenic
1183669675 22:39265000-39265022 CAAGCCCTGTACCAGGCCCTGGG - Intergenic
1183722025 22:39568208-39568230 CAGGCACCATTCCAGGTGCTGGG + Intergenic
1184335821 22:43852514-43852536 CAGGCAACAGCCCAGGACCTGGG + Intronic
1184355225 22:43975195-43975217 AGGGCACCATGCCAGGCACTGGG - Intronic
1184359473 22:44006233-44006255 AAGGCACCACACCAGGCCCATGG + Intronic
1184783578 22:46661001-46661023 CAGGCACCAAGCCAGGCCACAGG - Intronic
1184879317 22:47295029-47295051 CAAGCACCGTCCCAGGCCTTGGG - Intergenic
1185080772 22:48708303-48708325 CAGCCACCAGGCCAGGCCCAGGG - Intronic
1185265863 22:49903685-49903707 CAGACACCAGACCAGGTCCAGGG - Exonic
949204652 3:1423635-1423657 CAGCCATCATACCACGCACTTGG + Intergenic
949330786 3:2919448-2919470 CAAGCACCGTGCCAGGCCCAAGG + Intronic
949441739 3:4088683-4088705 CAGGCTCCATCCTAGGCGCTGGG - Intronic
949875766 3:8625155-8625177 CAGGCACTATTCTTGGCCCTGGG - Intronic
949981883 3:9507222-9507244 CAGGCACTAGACCAGGCCTGCGG + Intronic
949989176 3:9563389-9563411 CAGGCCCTATGCCAGGCACTGGG + Intergenic
950073458 3:10170666-10170688 CAGGCACTGTCCCAGGCTCTGGG - Intronic
950209284 3:11107770-11107792 GAGTCACCATACCTGGCCTTAGG - Intergenic
950376526 3:12576861-12576883 CAGGCACCATGCTGGGCTCTGGG + Intronic
950401953 3:12775735-12775757 CAGGCACTGTACCAGGTGCTAGG + Intergenic
950490503 3:13301806-13301828 CAGCCACCACCCCAGGCCTTCGG + Intergenic
950646090 3:14377708-14377730 CAGGCACCATGCTAGGCCTTGGG - Intergenic
950805595 3:15600681-15600703 CAGGCACCACACTAAGCACTGGG + Intronic
951000373 3:17552543-17552565 CTGGCACTATTCTAGGCCCTAGG + Intronic
951850093 3:27129712-27129734 CAGGCACTGTGCAAGGCCCTGGG + Intronic
952545077 3:34410249-34410271 CAGGCACCGCACTAGACCCTGGG + Intergenic
953238041 3:41123284-41123306 CAGGCATCATGCAAGGCCCAGGG + Intergenic
953551928 3:43909760-43909782 GAGCCACCATACCCGGCCATTGG - Intergenic
953763212 3:45710964-45710986 CAGGAACTATACTAGCCCCTGGG + Intronic
955412318 3:58663787-58663809 CAGGCACAAAACCAAGGCCTTGG - Intronic
955659007 3:61276797-61276819 TAGGCACCATTCTAGGCTCTAGG + Intergenic
955953980 3:64269170-64269192 CAGGCCCCATGCCAGGTACTAGG + Intronic
956459750 3:69459979-69460001 CAAGCACAATGCCAGGCACTGGG - Intronic
956780763 3:72601454-72601476 CAGGCACCACACCAGGCTTTAGG + Intergenic
957528571 3:81410397-81410419 GAGGCACCATGTCAGGTCCTAGG - Intergenic
957543118 3:81601891-81601913 CAGGCACAATGCCAGGTGCTAGG + Intronic
959093927 3:101933267-101933289 CAGACACCATTCCAGGCATTGGG - Intergenic
959426315 3:106193216-106193238 CAGGCACTATCCTAGGCTCTGGG - Intergenic
959437784 3:106338302-106338324 CAATCACCATCCCAGTCCCTGGG + Intergenic
960193097 3:114730788-114730810 CAGGCACCATATCAGTCTGTAGG - Intronic
960206441 3:114906121-114906143 CAGGCACTAAACTAGACCCTGGG - Intronic
960345935 3:116532983-116533005 CAGGCACCAGTCCAGCTCCTTGG - Intronic
960498702 3:118408652-118408674 CAGGCACTATGCCAGGCTCAGGG + Intergenic
960598482 3:119430523-119430545 TAGGCACTATATTAGGCCCTGGG - Exonic
960820937 3:121730620-121730642 CTGGCACCAAACAAGGCCCAGGG + Intronic
960864133 3:122183588-122183610 CAGGCACCGTGCCAGGGGCTAGG + Intergenic
961436144 3:126918389-126918411 CAGACACCATGCTAGGCCCTGGG + Intronic
961726703 3:128935425-128935447 GAGTCACCATACCCGGCCCCTGG - Intronic
962199330 3:133388763-133388785 CAGGCAGCCTACAGGGCCCTGGG + Intronic
962330884 3:134476808-134476830 GAGGCACCATGCCTGGCACTGGG - Intergenic
962695766 3:137945690-137945712 GAGCCACCACACCAGGCCTTGGG + Intergenic
962755316 3:138461618-138461640 CAGGCACCATCCCTGTCCCCCGG + Intronic
962757210 3:138474403-138474425 CAGGCAACATAACAGGTACTTGG - Intronic
963238338 3:142977183-142977205 CAGGCACTGTACCAGGTGCTGGG - Intronic
964225065 3:154389110-154389132 TAGGCACTATACTAGGCTCTTGG + Intronic
964376787 3:156055773-156055795 CAGGCACCATTCTAGGTACTGGG - Intronic
964646411 3:158962894-158962916 CAGGCACCATGCTAGGTGCTGGG + Intronic
964821628 3:160776881-160776903 GAGCCACCATGCCCGGCCCTTGG + Intronic
965847564 3:172982045-172982067 CAGGCACCATTCTAGGCACAGGG - Intronic
966245874 3:177807796-177807818 TAGACCCCATACCAGGCCCCGGG - Intergenic
966248388 3:177834292-177834314 CAGGCACAGTACAAGGGCCTGGG + Intergenic
966731947 3:183158784-183158806 CAGGCTCTGTACCAGGCACTGGG + Intronic
966974193 3:185070574-185070596 CAGGCACCAGACTTGGCCCCAGG + Intergenic
967810171 3:193752981-193753003 GAGCCACCATGCCAGGCCCTGGG + Intergenic
967901082 3:194452908-194452930 CAGGCACTATGCTAGGCTCTGGG - Intronic
967971663 3:195003916-195003938 CAGGGACCATTCCAAACCCTGGG - Intergenic
968318716 3:197746945-197746967 CAGGCACTGTAATAGGCCCTGGG - Intronic
968447999 4:662129-662151 CAGGAACCGCACCAGGACCTGGG - Exonic
968543291 4:1179206-1179228 CAGCCACCATGCCAGGCTCACGG + Intronic
968962497 4:3752706-3752728 CCGGCACCACGCCAGGGCCTAGG + Intergenic
969040081 4:4289315-4289337 CAGGCACTATGCTAGACCCTGGG + Intronic
969241567 4:5902033-5902055 CAGGCACCACAGTAGGCCCTGGG - Intronic
969540427 4:7785138-7785160 CAGGCACGGTGCCCGGCCCTGGG - Intronic
969695957 4:8735010-8735032 TGGGCTCCATACTAGGCCCTGGG - Intergenic
969926729 4:10592553-10592575 CAGGCATCATAGGAGGCTCTCGG + Intronic
970130671 4:12866734-12866756 CAGGGACTATACTAGGCACTGGG - Intergenic
970133281 4:12894378-12894400 CAGGCACCATGCTAGGCACAGGG - Intergenic
970510334 4:16775797-16775819 CAGACACTATGCCAGGCACTAGG - Intronic
970994353 4:22248485-22248507 CAGGCTCCATTCTAGGCACTTGG - Intergenic
971188376 4:24402912-24402934 CAGGCATCATACTAGGCTGTGGG - Intergenic
971529186 4:27662770-27662792 CAGACCCAATACCAGGCCGTGGG - Intergenic
975555783 4:75663576-75663598 GAGCCACCGTACCTGGCCCTGGG - Intronic
975975912 4:80096645-80096667 CAGGCAGCATGCCAGGTACTGGG - Intronic
976368461 4:84258730-84258752 CAGGCATCATTCCAGGTACTGGG - Intergenic
976404827 4:84651680-84651702 CAGGCATCATGCCAGACACTGGG - Intergenic
976486094 4:85606700-85606722 CAGGCACTATTCCAAGCCCCAGG + Intronic
976708727 4:88046003-88046025 GAGCCACCATGCCTGGCCCTAGG - Intronic
977318735 4:95483957-95483979 CAGGCACCATTCTAGGCATTAGG + Intronic
977727933 4:100319485-100319507 CAGACACCATTCTAGGCCCTGGG + Intergenic
977792395 4:101123218-101123240 CAGGCACTATCCTAGGCCCTAGG - Intronic
979404794 4:120296414-120296436 CAGGTACTATACCAGGCTCTGGG - Intergenic
979455191 4:120919336-120919358 CAGGTACTGTACTAGGCCCTGGG - Intronic
980155490 4:129099306-129099328 CAGGTACCATACCAGGTGCTGGG - Intronic
981930946 4:150188615-150188637 GAGCCACCATGCCCGGCCCTTGG - Intronic
984311462 4:178065681-178065703 CAGCCACCATACCTGGCCTAAGG + Intergenic
986012447 5:3728342-3728364 CAGGCACAGTACCAGGTCCTGGG + Intergenic
986338462 5:6771510-6771532 CAGGCCCCATCACAAGCCCTGGG - Intergenic
986398454 5:7354844-7354866 CAGACACAACACCAGGCCATGGG + Intergenic
986824573 5:11506726-11506748 CAGGCACTTTGCCAAGCCCTGGG - Intronic
988193188 5:27965047-27965069 CAGACACAACACCAGGCCTTGGG - Intergenic
988439590 5:31217590-31217612 CAGACACCATGCCAGACACTGGG + Intronic
989541014 5:42618926-42618948 AAGGCACTATACTAGGCACTGGG - Intronic
990511581 5:56493916-56493938 CAGGCCCCATCCCAGGCCTGAGG - Intergenic
990530667 5:56670153-56670175 CTGGCTCCATACCAAGGCCTCGG + Intergenic
990836521 5:60027668-60027690 CAGACACCATTCCAGGCCCTGGG - Intronic
990889393 5:60632308-60632330 CAGGCATCATCCCAGGTGCTAGG + Intronic
992533068 5:77671018-77671040 CAGGCACCATGCTAGGCTCTGGG - Intergenic
992586252 5:78243460-78243482 CAGGGACCATCCTAGGCCTTAGG + Intronic
992774222 5:80075916-80075938 CAGGGACCAGACCATGCTCTAGG - Intronic
994169994 5:96648920-96648942 CAGACAGTATTCCAGGCCCTGGG - Intronic
995625667 5:114073728-114073750 CAGGCACTATACTAGGCAATGGG - Intergenic
995756354 5:115508782-115508804 GAGCCACCGTACCCGGCCCTTGG - Intergenic
996436257 5:123435758-123435780 CAAGCACTATCCTAGGCCCTGGG - Intergenic
996725367 5:126669506-126669528 CAGGCAGTCTCCCAGGCCCTGGG - Intergenic
996950826 5:129123639-129123661 CAGACACCTTGCCAGGCACTAGG + Intergenic
997426103 5:133803724-133803746 CAGGCACTATGCTAGGCACTGGG + Intergenic
997436925 5:133882295-133882317 CAGGCACCATGCCAGGCTTCAGG - Intergenic
997881868 5:137598956-137598978 CAGGCACAGTGCCAGGCCCTGGG - Intergenic
998045130 5:138980918-138980940 GAGCCACCATACCTGGCCCAGGG - Intronic
998878606 5:146625031-146625053 CAGGCACTGTTCCAGGCACTAGG - Intronic
998891667 5:146752729-146752751 CAGGCACTGTGCCAGGCTCTGGG + Intronic
999087600 5:148906792-148906814 CAGACACCATACTGTGCCCTGGG + Intergenic
999127623 5:149258154-149258176 CAGGCACCATGCAAGGCACAGGG + Intronic
999269983 5:150291249-150291271 GAGGCACCATGCCCGGCCTTTGG + Intergenic
999363261 5:151004043-151004065 GAGACACCACACCCGGCCCTGGG - Intergenic
999439793 5:151592333-151592355 CAGACACCGTACTAGGCCCTGGG + Intergenic
1000018583 5:157299995-157300017 CAGGCACCATTCTAGGTCCCGGG - Intronic
1000163647 5:158626131-158626153 CAGGCACCATGCTGGGCTCTGGG + Intergenic
1000257298 5:159552153-159552175 CAGGCACCATGCTAGTTCCTGGG + Intergenic
1000297181 5:159922086-159922108 CAGGCACTGTACCAGACACTGGG + Intronic
1001211864 5:169817393-169817415 CAGGTACCATGCTAGGCCTTTGG + Intronic
1001328740 5:170747498-170747520 CAGGCGCCAGGCCAGGTCCTGGG - Intergenic
1001411992 5:171518787-171518809 CAGCCGCCATCCCCGGCCCTGGG - Intergenic
1001433958 5:171685261-171685283 CAGGCACTATTCCAGGTGCTTGG + Intergenic
1001446272 5:171786237-171786259 CAAGCACCATGCTAGGCACTAGG - Intronic
1001560871 5:172668230-172668252 CAGGCACCATGCCAGGCACTGGG - Intronic
1001567539 5:172709728-172709750 GAGGCACCATGCCCAGCCCTTGG + Intergenic
1001594944 5:172892261-172892283 CAGGCGCCATGCCAAGCCCTGGG + Intronic
1001638897 5:173231712-173231734 CAGGCACGGTTCCAGGCACTGGG - Intergenic
1001683356 5:173575186-173575208 AAGGCCCCTTTCCAGGCCCTGGG + Intergenic
1001695532 5:173667261-173667283 AAGCCACCATACCAGTCCCAGGG + Intergenic
1002738687 5:181417378-181417400 CAGGCACCATCGCAGGTGCTGGG - Intergenic
1002885694 6:1292025-1292047 CAGGCACCATTCAGAGCCCTTGG - Intergenic
1002913691 6:1511093-1511115 CAGGCACTGTTCCAGGCTCTGGG - Intergenic
1003000029 6:2323283-2323305 CAGCCACCATGCCTGGCCCCTGG + Intergenic
1003626016 6:7741933-7741955 AAGGCACCATGCTAGGCACTTGG - Intronic
1003859442 6:10308661-10308683 GAGCCACCATGCCTGGCCCTAGG + Intergenic
1003979161 6:11373592-11373614 CAGGCACCATATTAGGTGCTGGG - Intronic
1004041866 6:11987011-11987033 GAGCCACCATCCCCGGCCCTTGG + Intergenic
1004088094 6:12471510-12471532 CAGGCTCTATTACAGGCCCTGGG - Intergenic
1004199918 6:13538614-13538636 CAGGCACCATGCCAAGTGCTAGG + Intergenic
1004721314 6:18269850-18269872 CAGGCACCATGCCAAGCACCGGG - Intergenic
1004802283 6:19162918-19162940 CAGGGACCATACTAGGCACTAGG + Intergenic
1005243225 6:23854809-23854831 CTGGTACAATCCCAGGCCCTTGG + Intergenic
1005451991 6:25982541-25982563 CAGGCCCAACACCAGGCCGTGGG - Intronic
1005468507 6:26139335-26139357 CAGGCACCATGCTGGGACCTGGG - Intergenic
1005755147 6:28919409-28919431 CAGGCACTATTCTAGGCACTGGG - Intronic
1006472984 6:34238328-34238350 CAGGCTCCAGACCCGGCCCGAGG - Intronic
1006555618 6:34863606-34863628 AAGGCACCATACTAGGCACTAGG - Intronic
1006626824 6:35403590-35403612 CAGGCACCGTGCCAGGTGCTGGG + Intronic
1006679366 6:35786455-35786477 CAGGCACTGTTCCAGGCACTGGG - Intronic
1006935274 6:37712907-37712929 CAGGCAGCACTCCTGGCCCTGGG - Intergenic
1006982560 6:38157840-38157862 CAGGCAGCATCCCAGACACTGGG + Intergenic
1007072325 6:39046867-39046889 CAGACACCATTCTAGGTCCTGGG - Intergenic
1007104167 6:39272118-39272140 CAGGCACAAAAACAGGCCCTGGG - Intergenic
1007210154 6:40187221-40187243 CAGACACAATACCAGGCTCTGGG + Intergenic
1007229067 6:40335614-40335636 CAGGCACTGTCTCAGGCCCTGGG - Intergenic
1007632853 6:43282534-43282556 CAGAGACCATTCTAGGCCCTGGG + Intronic
1007934819 6:45723502-45723524 CAGCCACCATGCCTGGCCTTTGG - Intergenic
1008044434 6:46837409-46837431 CTGGCACCATAACATGCTCTAGG + Intronic
1009398619 6:63229715-63229737 CTGGTACAATCCCAGGCCCTTGG - Intergenic
1009823831 6:68840543-68840565 CAGCCACCAGCACAGGCCCTTGG - Intronic
1012036979 6:94154928-94154950 CAGGCAGCATCCCAGGCCAGGGG + Intergenic
1012716473 6:102679188-102679210 CAGACACTGTACCAGACCCTGGG + Intergenic
1012881617 6:104797782-104797804 GAGCCACCATGCCTGGCCCTGGG - Intronic
1013018798 6:106189018-106189040 CAGGTACCATGCTAGGCACTGGG - Intronic
1013464846 6:110409112-110409134 CAGGGACCATACCATCCCCCAGG + Intronic
1013482053 6:110561389-110561411 CATGCACCATACTAGGTACTGGG + Intergenic
1014324763 6:119979382-119979404 CTGGCATGATACCAGGCCATGGG + Intergenic
1014866845 6:126542851-126542873 CAGGCACTATTCTAGGCTCTTGG - Intergenic
1015366642 6:132403083-132403105 CAAGCACCATACCAGGGACGTGG + Intergenic
1015370761 6:132449413-132449435 AAGCCACCATACCAGGTCCCAGG + Exonic
1015583227 6:134749223-134749245 CAGGCATTAAGCCAGGCCCTAGG - Intergenic
1015914148 6:138198307-138198329 CAGGCACTGTTTCAGGCCCTAGG - Intronic
1016462821 6:144296140-144296162 CTGGTACCAGTCCAGGCCCTGGG - Intronic
1016475544 6:144423035-144423057 GAGGCACCATCCCAGGCTCCAGG - Intronic
1016671375 6:146712469-146712491 GAGCCACCATGCCAGGCCCTGGG + Intronic
1016844480 6:148557427-148557449 CAGGCACTGTACCAGGTACTGGG - Intergenic
1016985041 6:149888802-149888824 CAGCCACTCTACCAGGCCCTGGG + Intronic
1017100668 6:150847187-150847209 GAGCCACCACACCCGGCCCTCGG + Intergenic
1017286293 6:152680460-152680482 GAGGCACCACACCTGGCCCAAGG - Intergenic
1017311457 6:152982422-152982444 GAGGCACCTGGCCAGGCCCTGGG + Intronic
1017450307 6:154548687-154548709 CGGGCATTATGCCAGGCCCTGGG + Intergenic
1017590944 6:155977315-155977337 GAGTCACCATACCCGGCCCTAGG + Intergenic
1017674436 6:156798316-156798338 CAGGCACGACCCCAGGCACTGGG - Intronic
1018451926 6:163917164-163917186 GAGCCACCATACCCGGCCCAGGG - Intergenic
1018641757 6:165910088-165910110 CAGGCACTATTCTAGGCACTGGG - Intronic
1019243791 6:170692930-170692952 CAGGCACCATCGCAGGTGCTGGG - Intergenic
1019497528 7:1347460-1347482 GAGCCACCACACCCGGCCCTTGG + Intergenic
1020267913 7:6573664-6573686 AAGCCACCATGCCCGGCCCTGGG + Intergenic
1020822303 7:12985374-12985396 CAGGCCCCATAACTGGACCTTGG + Intergenic
1021191204 7:17621694-17621716 CAGTCACCATACCATGCCTTTGG - Intergenic
1022057608 7:26755666-26755688 CAGGCACTAATCTAGGCCCTAGG - Intronic
1022606353 7:31818427-31818449 CAGGCACCATGCTAAGCACTGGG - Intronic
1022703159 7:32780158-32780180 CAGGCACTGTACCAGGGGCTGGG - Intergenic
1022907391 7:34870292-34870314 CAGGCACTGTACCAGGGGCTGGG - Intronic
1023069778 7:36417957-36417979 GAGCCACCATACCTGGCCCAGGG + Intronic
1023376880 7:39565595-39565617 CAGGTACCATTCCAGGCTTTGGG - Intergenic
1024299766 7:47877934-47877956 CAGGTACTATCCTAGGCCCTGGG + Intronic
1024983425 7:55176433-55176455 AAGCCACCATGCCAGGCCCATGG - Intronic
1025790610 7:64684020-64684042 CAGGCAGTTTCCCAGGCCCTTGG + Intronic
1026966846 7:74445620-74445642 AAGCCACCATGCCTGGCCCTCGG + Intergenic
1028634454 7:92971461-92971483 CACTCACCATCCCTGGCCCTAGG - Intergenic
1028729253 7:94126419-94126441 CAGGTATCAAACCAGGCACTGGG + Intergenic
1028839514 7:95412808-95412830 CAGGCACTGTTCCAGGCACTGGG - Intronic
1029102124 7:98139886-98139908 CAGGCACCATAACAGAAGCTGGG - Intronic
1029539039 7:101172385-101172407 CACGCGCCACTCCAGGCCCTTGG + Exonic
1029664418 7:101985748-101985770 CTGACACCATACCCGGCACTGGG - Intronic
1029956141 7:104642310-104642332 GAGCCACCGTACCTGGCCCTAGG + Intronic
1030130609 7:106196242-106196264 CAGGCACTGTTCCAGACCCTGGG - Intergenic
1030148290 7:106378341-106378363 CAGGCACCATACCCAGCCTCTGG - Intergenic
1030229766 7:107195390-107195412 CAGGCAACATACCAGGCCTAAGG - Intronic
1031081834 7:117265439-117265461 GAGCCACCACACCTGGCCCTGGG + Intergenic
1031861407 7:126983827-126983849 CAAGCACCTTAGCAGGCCGTGGG - Intronic
1032019849 7:128401191-128401213 CCGGCACCAGGACAGGCCCTGGG + Intronic
1032168065 7:129561424-129561446 CAGGCAGGTTCCCAGGCCCTGGG - Intergenic
1032275599 7:130452576-130452598 CAGACACCATACCAGGTACTAGG - Intergenic
1032783911 7:135185930-135185952 CAGCCACAATACCAGTCTCTGGG + Exonic
1033921621 7:146400072-146400094 CAGGAACCATACCTAGCCCAGGG - Intronic
1034189497 7:149202847-149202869 CAGGTACCATTCCAGGCACAGGG - Intronic
1034194737 7:149237792-149237814 CAGGCACAATATCAGGACATAGG - Intergenic
1034696502 7:153058800-153058822 CAGGCACTGGACCAGCCCCTAGG - Intergenic
1035115311 7:156518766-156518788 CAGACACCATGTGAGGCCCTTGG + Intergenic
1035145389 7:156810675-156810697 GAGCCACCATGCCTGGCCCTGGG + Intronic
1035401115 7:158566455-158566477 CAGGCCCCATAGCGGGCACTTGG + Intronic
1035469227 7:159098999-159099021 CAAGCACCAGAACAGGCCCCAGG - Intronic
1035504332 8:115230-115252 CAGGCACCATCGCAGGTGCTGGG + Intergenic
1035561156 8:604439-604461 CAGTGACAATGCCAGGCCCTGGG - Intergenic
1038372998 8:27011750-27011772 CTGGTACAATCCCAGGCCCTTGG - Intergenic
1038460389 8:27711204-27711226 GAGCCACCACACCAGGCCCTGGG + Intergenic
1038529673 8:28308166-28308188 CAGGCACCATGCTAGGGGCTGGG - Intergenic
1040568459 8:48587562-48587584 CAGGGACTATACCCTGCCCTCGG - Intergenic
1040898717 8:52394711-52394733 CAGGCACAATATCAGGTGCTAGG - Intronic
1041144380 8:54858050-54858072 CAGGCACAATACTAGACACTAGG - Intergenic
1041331418 8:56729530-56729552 CAGGCACCATTCTAGGCACTGGG - Intergenic
1042186412 8:66140676-66140698 CATGCAGCAAACCAGGTCCTTGG + Intronic
1042276141 8:67007236-67007258 CAGGCACTGTTCTAGGCCCTTGG - Intronic
1042445619 8:68882163-68882185 CAGGCTCCATGCCAGGCACAGGG + Intergenic
1042455617 8:68999152-68999174 GAGCCACCACACCTGGCCCTGGG - Intergenic
1042571966 8:70175439-70175461 GAAGCACCCTACCAGGCACTTGG + Intronic
1042697871 8:71577920-71577942 CAGGCACTATTCCTGTCCCTGGG + Intronic
1042864213 8:73343518-73343540 TAGGCACCATCTCAGGCACTGGG + Intergenic
1043878352 8:85512020-85512042 CAAGCACTATACTAGGCACTGGG - Intergenic
1043919376 8:85963598-85963620 CAGGCACTATTCCAGGTGCTGGG - Intergenic
1044456785 8:92399308-92399330 CAGGGACCATTGCAGGCTCTTGG - Intergenic
1044868733 8:96597811-96597833 CAGGCACCATTCTAGGTTCTAGG + Intronic
1045244520 8:100431308-100431330 CAAGCACCTTGCCAGGCACTTGG + Intergenic
1045259792 8:100562347-100562369 CAGGCCCCTTCCAAGGCCCTGGG - Intergenic
1045413696 8:101945250-101945272 CAGGCATCATGCTAGGCTCTGGG + Intronic
1045419073 8:101996088-101996110 CAGGCACCATGCCAAGCCCTTGG - Intronic
1046726196 8:117676737-117676759 CAGGTTCCATACTAGGCTCTGGG - Intergenic
1046872674 8:119220945-119220967 CAGGCACTATGCCAGGTGCTGGG - Intronic
1047188455 8:122656695-122656717 CAGCCACCATGCCTGGCCCATGG - Intergenic
1047659836 8:127021153-127021175 CTTGCACAATGCCAGGCCCTTGG - Intergenic
1047659851 8:127021276-127021298 CTTGCACAATGCCAGGCCCTTGG - Intergenic
1047928791 8:129705871-129705893 CAAGCATCCTACCAGGACCTGGG - Intergenic
1048292665 8:133192391-133192413 CAGGCACCATGCCAGGCGTGAGG - Intronic
1048308440 8:133299675-133299697 CAGGCACCATTCTAGACCCTGGG + Intronic
1048449929 8:134524213-134524235 CCGGCACCAAGGCAGGCCCTCGG - Intronic
1049089079 8:140500588-140500610 CAGTCACCCTACCAGGCTCATGG + Intergenic
1049644879 8:143731751-143731773 CAGGGACCTTTCCAGGTCCTGGG + Intronic
1050609042 9:7332031-7332053 CAGGCACTATTCTAGGCCCTGGG - Intergenic
1051252841 9:15179282-15179304 AAGGGAACATACGAGGCCCTGGG + Intronic
1051356089 9:16240721-16240743 GAGGCACCATAGCAGCCCCATGG - Intronic
1052028196 9:23598382-23598404 CAGGCACCATTCTAGGTACTGGG + Intergenic
1052413343 9:28148585-28148607 CTGGTACAATCCCAGGCCCTTGG + Intronic
1053244959 9:36527424-36527446 GAGCCACCATGCCAGGCCATGGG + Intergenic
1053653161 9:40189526-40189548 CTGGCACCATAGCATGCTCTAGG - Intergenic
1053903564 9:42818829-42818851 CTGGCACCATAGCATGCTCTAGG - Intergenic
1054531423 9:66186697-66186719 CTGGCACCATAGCATGCTCTAGG + Intergenic
1054829005 9:69602724-69602746 CAGGCACCACTTTAGGCCCTGGG + Intronic
1055661585 9:78509025-78509047 CAGTCACTATACCAGGTTCTGGG - Intergenic
1056149892 9:83775289-83775311 CAGCCACCATGCCTGGCTCTGGG + Intronic
1056184549 9:84120800-84120822 CAGGCAGAATACCAGACCGTTGG + Intergenic
1056576404 9:87858663-87858685 CCGGTACAATCCCAGGCCCTTGG - Intergenic
1056590414 9:87962505-87962527 GAGACACCATGCCCGGCCCTAGG + Intergenic
1057071633 9:92104800-92104822 CTGGTACAATCCCAGGCCCTTGG + Intronic
1058006690 9:99923703-99923725 CAGTCACAAGTCCAGGCCCTTGG + Intronic
1058723770 9:107783189-107783211 CAGGCACAATGCTAGGCACTAGG - Intergenic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1059401436 9:114072846-114072868 CAGAGACCATCCCAGCCCCTGGG - Intronic
1059701318 9:116777626-116777648 CAGTCACCACTCCAGACCCTCGG - Intronic
1059995326 9:119903296-119903318 CAGGGACTATAATAGGCCCTAGG + Intergenic
1059996087 9:119911234-119911256 CAGGCACTATTCTAGGCACTTGG + Intergenic
1060859311 9:126940804-126940826 CAGGCACCAGACCCGAACCTGGG + Intronic
1061086583 9:128402871-128402893 GAGCCACCACACCCGGCCCTAGG + Intergenic
1061372399 9:130204952-130204974 CAGGCACCGTCCCACACCCTGGG + Intronic
1061448950 9:130658586-130658608 CAGGTCCCATACAAGGCCCTGGG - Intergenic
1061482922 9:130906034-130906056 CAGGCCCCACCCCAGGCACTGGG - Intronic
1061504587 9:131024745-131024767 CAGGCACCTTGCTAGGCACTGGG + Intronic
1061609267 9:131735523-131735545 CAGGCTCCGTACAAGGCTCTGGG - Intronic
1061721417 9:132554010-132554032 CAGGCACCATTCCAGGGGCTTGG + Intronic
1061747788 9:132752983-132753005 CAGGCACCGTTCCAGACGCTGGG - Intronic
1061864301 9:133484693-133484715 CAGGCACCAGAGCAGACCCAGGG - Intergenic
1062037976 9:134391137-134391159 CCGGCCCCATGCCAGGCCCCAGG + Intronic
1062452030 9:136619853-136619875 CCGGCACCTGACCAGGGCCTGGG + Intergenic
1062593270 9:137284613-137284635 GAGCCACCATGCCTGGCCCTAGG + Intergenic
1203603980 Un_KI270748v1:42153-42175 CAGGCACCATCGCAGGTGCTGGG - Intergenic
1186710676 X:12192769-12192791 CAGGCACCATCCCAGACCTAAGG - Intronic
1186802986 X:13112085-13112107 CAGGCATTATACCTGACCCTGGG - Intergenic
1187254787 X:17632556-17632578 CAGGCACCGTTCTAGGCACTTGG + Intronic
1187427524 X:19191800-19191822 GAGCCACCACACCTGGCCCTGGG + Intergenic
1187429274 X:19206769-19206791 CAGGCACCATACCAGGTGCTGGG - Intergenic
1187974108 X:24687905-24687927 CTGGCACTATTCAAGGCCCTAGG - Intergenic
1188267168 X:28091557-28091579 CAGGCACCGTGCTAGGCACTGGG - Intergenic
1188320073 X:28725232-28725254 GAGCCACCATGCCTGGCCCTTGG + Intronic
1190070039 X:47272165-47272187 CTTGCTGCATACCAGGCCCTGGG + Intergenic
1190329063 X:49224609-49224631 CAGGCACCCTACCAAGCCCTAGG - Intronic
1190483694 X:50902985-50903007 CAGGCACTATGCTAGGCACTGGG - Intergenic
1190524577 X:51315682-51315704 CAGGCACCATTTCAGGCATTGGG + Intergenic
1191027098 X:55925493-55925515 CAGGCACCATGCCAAGCACTAGG + Intergenic
1191090142 X:56611570-56611592 GAGCCACCACACCAGGCCCATGG - Intergenic
1191998341 X:67121105-67121127 CAGGCACAGTCACAGGCCCTTGG + Intergenic
1192009792 X:67256680-67256702 CAGCCACCATGCCTAGCCCTGGG - Intergenic
1192177693 X:68896030-68896052 CAGGCTCAGTGCCAGGCCCTGGG + Intergenic
1192364466 X:70459640-70459662 CAGGCTCCATACTAGACGCTGGG - Intronic
1193012189 X:76688413-76688435 CAGGCAGCAGACCATGCCATGGG - Intergenic
1194349590 X:92809259-92809281 GAGTCACCAGACCAGGCTCTTGG - Intergenic
1194592313 X:95814534-95814556 CAGGCACTATGCTAGGCACTGGG + Intergenic
1195230896 X:102845776-102845798 CTGGCACCATGCTAGGCACTGGG - Intergenic
1195234619 X:102884253-102884275 CTGGCACCATACGAGGCACTGGG - Intergenic
1195380751 X:104268669-104268691 AAGCCACCACACCTGGCCCTTGG + Intergenic
1195615015 X:106905270-106905292 CCGGGACCGTGCCAGGCCCTTGG - Intronic
1196198434 X:112859174-112859196 CAGGCACTATGCTAAGCCCTGGG - Intergenic
1197083937 X:122450848-122450870 GAGCCACCATGCCAGGGCCTGGG - Intergenic
1198303111 X:135350609-135350631 CAGACACCATGCCAGACCCTGGG + Intronic
1198337305 X:135679342-135679364 CAGGCAGCATGCCAGGAGCTGGG + Intergenic
1198361891 X:135903472-135903494 CAGGCAGCATGCCAGGACCCAGG - Intronic
1199366664 X:146994046-146994068 CAGGCACCATTCTTGGCACTGGG + Intergenic
1199741717 X:150741706-150741728 AAGGCATCATGCCTGGCCCTCGG - Intronic
1199782537 X:151075796-151075818 CAGGCACTGTTCCAGGCTCTGGG - Intergenic
1199848980 X:151711804-151711826 CAGGGACCATAGCTGGCCCAGGG - Intergenic
1200657908 Y:5925860-5925882 GAGTCACCAGACCAGGCTCTTGG - Intergenic
1200758822 Y:7017037-7017059 GAGTCACCATACCAGGCCCAGGG - Intronic