ID: 919468882

View in Genome Browser
Species Human (GRCh38)
Location 1:197954401-197954423
Sequence CAAAGTTGAGTTTTGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919468882_919468887 7 Left 919468882 1:197954401-197954423 CCCTTCCTCAAAACTCAACTTTG No data
Right 919468887 1:197954431-197954453 ATGAAAGACCACCAGGCTATGGG No data
919468882_919468886 6 Left 919468882 1:197954401-197954423 CCCTTCCTCAAAACTCAACTTTG No data
Right 919468886 1:197954430-197954452 AATGAAAGACCACCAGGCTATGG No data
919468882_919468885 0 Left 919468882 1:197954401-197954423 CCCTTCCTCAAAACTCAACTTTG No data
Right 919468885 1:197954424-197954446 TAAGCTAATGAAAGACCACCAGG No data
919468882_919468889 11 Left 919468882 1:197954401-197954423 CCCTTCCTCAAAACTCAACTTTG No data
Right 919468889 1:197954435-197954457 AAGACCACCAGGCTATGGGGAGG No data
919468882_919468888 8 Left 919468882 1:197954401-197954423 CCCTTCCTCAAAACTCAACTTTG No data
Right 919468888 1:197954432-197954454 TGAAAGACCACCAGGCTATGGGG No data
919468882_919468891 16 Left 919468882 1:197954401-197954423 CCCTTCCTCAAAACTCAACTTTG No data
Right 919468891 1:197954440-197954462 CACCAGGCTATGGGGAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919468882 Original CRISPR CAAAGTTGAGTTTTGAGGAA GGG (reversed) Intergenic
No off target data available for this crispr