ID: 919468884

View in Genome Browser
Species Human (GRCh38)
Location 1:197954406-197954428
Sequence GCTTACAAAGTTGAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919468884_919468886 1 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468886 1:197954430-197954452 AATGAAAGACCACCAGGCTATGG No data
919468884_919468889 6 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468889 1:197954435-197954457 AAGACCACCAGGCTATGGGGAGG No data
919468884_919468893 30 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468893 1:197954459-197954481 GAGGAATCTGAATTCTGCTAAGG No data
919468884_919468885 -5 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468885 1:197954424-197954446 TAAGCTAATGAAAGACCACCAGG No data
919468884_919468891 11 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468891 1:197954440-197954462 CACCAGGCTATGGGGAGGAGAGG No data
919468884_919468888 3 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468888 1:197954432-197954454 TGAAAGACCACCAGGCTATGGGG No data
919468884_919468887 2 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468887 1:197954431-197954453 ATGAAAGACCACCAGGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919468884 Original CRISPR GCTTACAAAGTTGAGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr