ID: 919468886

View in Genome Browser
Species Human (GRCh38)
Location 1:197954430-197954452
Sequence AATGAAAGACCACCAGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919468883_919468886 5 Left 919468883 1:197954402-197954424 CCTTCCTCAAAACTCAACTTTGT No data
Right 919468886 1:197954430-197954452 AATGAAAGACCACCAGGCTATGG No data
919468882_919468886 6 Left 919468882 1:197954401-197954423 CCCTTCCTCAAAACTCAACTTTG No data
Right 919468886 1:197954430-197954452 AATGAAAGACCACCAGGCTATGG No data
919468884_919468886 1 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468886 1:197954430-197954452 AATGAAAGACCACCAGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919468886 Original CRISPR AATGAAAGACCACCAGGCTA TGG Intergenic
No off target data available for this crispr