ID: 919468893

View in Genome Browser
Species Human (GRCh38)
Location 1:197954459-197954481
Sequence GAGGAATCTGAATTCTGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919468890_919468893 -3 Left 919468890 1:197954439-197954461 CCACCAGGCTATGGGGAGGAGAG No data
Right 919468893 1:197954459-197954481 GAGGAATCTGAATTCTGCTAAGG No data
919468884_919468893 30 Left 919468884 1:197954406-197954428 CCTCAAAACTCAACTTTGTAAGC No data
Right 919468893 1:197954459-197954481 GAGGAATCTGAATTCTGCTAAGG No data
919468892_919468893 -6 Left 919468892 1:197954442-197954464 CCAGGCTATGGGGAGGAGAGGAA No data
Right 919468893 1:197954459-197954481 GAGGAATCTGAATTCTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919468893 Original CRISPR GAGGAATCTGAATTCTGCTA AGG Intergenic
No off target data available for this crispr