ID: 919479121

View in Genome Browser
Species Human (GRCh38)
Location 1:198064647-198064669
Sequence CTTTCCAGCCAAAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919479121_919479129 24 Left 919479121 1:198064647-198064669 CCCTCCAGCCTTTGGCTGGAAAG No data
Right 919479129 1:198064694-198064716 ATTTTCTTGGATTTGCCTATAGG No data
919479121_919479126 11 Left 919479121 1:198064647-198064669 CCCTCCAGCCTTTGGCTGGAAAG No data
Right 919479126 1:198064681-198064703 ACTACCCATCAGAATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919479121 Original CRISPR CTTTCCAGCCAAAGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr