ID: 919479438

View in Genome Browser
Species Human (GRCh38)
Location 1:198069342-198069364
Sequence TGTTAGGGAAGCAGGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919479438_919479442 -2 Left 919479438 1:198069342-198069364 CCTGGGCGCCTGCTTCCCTAACA No data
Right 919479442 1:198069363-198069385 CACTTTCACTGAGAATCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919479438 Original CRISPR TGTTAGGGAAGCAGGCGCCC AGG (reversed) Intergenic
No off target data available for this crispr