ID: 919483541

View in Genome Browser
Species Human (GRCh38)
Location 1:198118948-198118970
Sequence GTTCCTGTATTTATTACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919483533_919483541 27 Left 919483533 1:198118898-198118920 CCCCTCCAAACCTGATTTACCTC No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data
919483536_919483541 22 Left 919483536 1:198118903-198118925 CCAAACCTGATTTACCTCTTTAC No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data
919483540_919483541 -8 Left 919483540 1:198118933-198118955 CCTATCTTTTTCTATGTTCCTGT No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data
919483539_919483541 0 Left 919483539 1:198118925-198118947 CCATATTTCCTATCTTTTTCTAT No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data
919483538_919483541 8 Left 919483538 1:198118917-198118939 CCTCTTTACCATATTTCCTATCT No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data
919483537_919483541 17 Left 919483537 1:198118908-198118930 CCTGATTTACCTCTTTACCATAT No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data
919483535_919483541 25 Left 919483535 1:198118900-198118922 CCTCCAAACCTGATTTACCTCTT No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data
919483534_919483541 26 Left 919483534 1:198118899-198118921 CCCTCCAAACCTGATTTACCTCT No data
Right 919483541 1:198118948-198118970 GTTCCTGTATTTATTACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919483541 Original CRISPR GTTCCTGTATTTATTACATC AGG Intergenic
No off target data available for this crispr