ID: 919486389

View in Genome Browser
Species Human (GRCh38)
Location 1:198153205-198153227
Sequence TTTGTATAGTGACCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919486388_919486389 30 Left 919486388 1:198153152-198153174 CCTACTATTTTTCATGGGTGTTT No data
Right 919486389 1:198153205-198153227 TTTGTATAGTGACCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919486389 Original CRISPR TTTGTATAGTGACCACAGCC AGG Intergenic
No off target data available for this crispr