ID: 919488012

View in Genome Browser
Species Human (GRCh38)
Location 1:198168357-198168379
Sequence TTAGTGTGTGGTCCCTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 242}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919488008_919488012 17 Left 919488008 1:198168317-198168339 CCAACGGTATCTGGTTAGAAAAT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 919488012 1:198168357-198168379 TTAGTGTGTGGTCCCTGGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919488012 Original CRISPR TTAGTGTGTGGTCCCTGGCA GGG Intronic
900477070 1:2880913-2880935 TGAGTGTGTGGTGCTGGGCAGGG + Intergenic
900910577 1:5594337-5594359 TTGGGGTCTGTTCCCTGGCAGGG - Intergenic
901029633 1:6299471-6299493 TCTGTGTGTGGTGCCTGGTAAGG - Intronic
901029644 1:6299518-6299540 TCTGTGTGTGGTGCCTGGTAAGG - Intronic
901889613 1:12251495-12251517 TTACTGTGTGGGTCCTGACATGG - Intronic
902332147 1:15735968-15735990 TGACTGGGAGGTCCCTGGCATGG - Intergenic
902524597 1:17047967-17047989 AGAGTATGTGGGCCCTGGCATGG - Intronic
903332580 1:22603492-22603514 CTAGTGTGTGGTCCCTCTCAGGG + Exonic
903770012 1:25757860-25757882 TTACTGTGTGATCTCAGGCAGGG + Intronic
904319198 1:29685545-29685567 TGAGTGTGTGCTCCCAGGAAGGG - Intergenic
905205756 1:36342080-36342102 TGAGGGTGTGGTGCCTGGAAGGG - Intronic
905566940 1:38973267-38973289 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
905661343 1:39728409-39728431 GGAGGGTGTGGTCCCTGGCTAGG - Intronic
906639935 1:47435688-47435710 TTGGTGTGTGGTCCATGGTGTGG + Intergenic
906751697 1:48268187-48268209 GAAGGGTGGGGTCCCTGGCAAGG - Intergenic
907471071 1:54673803-54673825 TTTGTGAGTGGCCCCTGGGAGGG + Exonic
907600916 1:55768327-55768349 TGAATGGGTGGTCTCTGGCAGGG + Intergenic
908223594 1:62033845-62033867 TTGTAGTGTGGTACCTGGCAGGG - Intronic
909263513 1:73526712-73526734 GAAGGGTGTGGTCCCTGGCTAGG + Intergenic
909662786 1:78102576-78102598 TAAGTGTGTAGTCTCTGCCAGGG + Intronic
914859670 1:151375527-151375549 TTAGTGTGTAGGGCCCGGCATGG - Intergenic
916820880 1:168397512-168397534 TTAGGGTGTGGTTCTAGGCATGG + Intergenic
919488012 1:198168357-198168379 TTAGTGTGTGGTCCCTGGCAGGG + Intronic
919626191 1:199912459-199912481 TTAGTGTGTGTGCCATGACATGG + Intergenic
922714107 1:227857568-227857590 TTACTGTGTGTTGACTGGCAAGG - Intergenic
923109994 1:230882843-230882865 CTAGGGCGTGGTCCCTGGCTAGG - Intergenic
1063034364 10:2270747-2270769 TTATTTTGTGTTTCCTGGCATGG - Intergenic
1063907708 10:10798116-10798138 TTACTGTGTGTTTTCTGGCAGGG - Intergenic
1064869310 10:19920257-19920279 GGAGGGTGTGGTCCCTGGCTAGG + Intronic
1065130971 10:22619950-22619972 TGAGTTTGTGGACCCTGGAAAGG - Intronic
1065466533 10:26030092-26030114 TGAGTGTGGGGTCCCTTGCCTGG - Intronic
1065778221 10:29142609-29142631 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1066367756 10:34793252-34793274 TTCGTGAGTTGTCCCTGGCCTGG - Intronic
1067157551 10:43794739-43794761 CCAGTGTGAGGGCCCTGGCAAGG - Intergenic
1067794595 10:49311557-49311579 TTGGTGTGAGGTCCCTGGCTTGG - Intronic
1068134615 10:52939770-52939792 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1068455225 10:57246894-57246916 AAAGGGTGGGGTCCCTGGCAAGG + Intergenic
1068868394 10:61918459-61918481 TTAGGATGTGGTCCCTGACCAGG - Intronic
1071486781 10:86107514-86107536 GAAGGGTGTGGTCCCTGGCTAGG + Intronic
1073611352 10:104947011-104947033 ATTGTCTGCGGTCCCTGGCATGG + Intronic
1074256184 10:111804852-111804874 TTAGGGTGCTGTCCTTGGCATGG - Intergenic
1074892690 10:117748682-117748704 CAAGAGTCTGGTCCCTGGCAGGG - Intergenic
1076825889 10:132967847-132967869 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1077586770 11:3459736-3459758 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1078100510 11:8327833-8327855 CTAGTTTGTGGTCCCTGGATTGG - Intergenic
1078736421 11:14024759-14024781 GAAGAGTGGGGTCCCTGGCAGGG - Intronic
1079331254 11:19534763-19534785 TTAGGGTCTGTTTCCTGGCATGG - Intronic
1081362949 11:42202486-42202508 TTAGTGTGTGGCCCTTTACAGGG - Intergenic
1084242768 11:67833769-67833791 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1084830233 11:71763211-71763233 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1087207020 11:95407405-95407427 TTAGTCAGAGGTCCCTGGAAAGG - Intergenic
1087422528 11:97948454-97948476 GAAGTGTGTGGTCCCTAGCTAGG + Intergenic
1090678856 11:129031672-129031694 GAAGAGGGTGGTCCCTGGCAAGG + Intronic
1091082143 11:132681185-132681207 AAAGGGTGCGGTCCCTGGCAAGG + Intronic
1091317233 11:134623130-134623152 TGAGTGTGTGGTGTCAGGCAAGG - Intergenic
1091663220 12:2399759-2399781 AAAGAGTGGGGTCCCTGGCAAGG - Intronic
1092413006 12:8268469-8268491 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1092569485 12:9707501-9707523 TGAGGGTGTGGTCTCTGGCTAGG + Intergenic
1093000026 12:13985974-13985996 GAAGGGTGTGGTCCCTGGCGAGG - Intergenic
1093508961 12:19903778-19903800 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1094461001 12:30696544-30696566 GGAGTGTGTGGTCCCTTGCTAGG + Intergenic
1095567865 12:43647488-43647510 TAAGTGTTTGGTCTATGGCATGG - Intergenic
1095977608 12:47950336-47950358 CAAGTGTGTGGTCAGTGGCAAGG + Intergenic
1096258348 12:50076065-50076087 GTTGAGTGTGGTCCTTGGCATGG + Intronic
1096841834 12:54384643-54384665 TGAGTGTGGGGGCCCTGGCTAGG - Intronic
1097637948 12:62145165-62145187 TTAGTTTGTGCTACATGGCAGGG + Intronic
1102329962 12:112020547-112020569 TAAGTGTTTAGTCCCAGGCAGGG + Intronic
1102569888 12:113820978-113821000 TCACTGTGTGAGCCCTGGCAGGG + Intronic
1106064025 13:26326632-26326654 TTAGTTTGAGGTCTCTGGCTGGG + Intronic
1106169793 13:27279425-27279447 GGAGGGTGTGGTCCCTGGTAGGG + Intergenic
1106942239 13:34791974-34791996 AAAGGGTGTGGTCCCTGGCAAGG + Intergenic
1109172954 13:59118341-59118363 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1109784458 13:67156093-67156115 GAAGGGTGTGGTCCCTGGCTAGG + Intronic
1111097212 13:83532759-83532781 GGAGGGTGTGGTCCCTGGCTGGG + Intergenic
1111156831 13:84338382-84338404 GAATGGTGTGGTCCCTGGCAAGG - Intergenic
1111430553 13:88144444-88144466 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1114219051 14:20681026-20681048 TAAATGTGTGGACCTTGGCATGG + Intergenic
1116498399 14:45590528-45590550 ATTGTGTTTGGTCACTGGCAGGG + Intergenic
1119858360 14:77918067-77918089 TTAGTGTAAAGTGCCTGGCATGG + Intronic
1121177541 14:91902145-91902167 CCAGTGTATGGTCCCTGCCACGG + Intronic
1121450127 14:94001690-94001712 TTTGTGTTTGGTGCCTCGCAAGG - Intergenic
1125393717 15:39224830-39224852 AAAATGAGTGGTCCCTGGCAAGG + Intergenic
1126065117 15:44820509-44820531 TTAGTGTGTGGTGCAGGGGAAGG + Intergenic
1126090584 15:45047831-45047853 TTAGTGTCTGGGCTCAGGCAGGG + Intronic
1126094712 15:45080074-45080096 TTAGTGTGTGGTGCAGGGGAAGG - Intergenic
1127909415 15:63403795-63403817 TTTGTGTGTGTACCTTGGCAAGG - Intergenic
1130682775 15:86010852-86010874 GAAGGGTGTGGTCCCTGGCTAGG - Intergenic
1130917592 15:88318123-88318145 CTTGTGTGTGGTCCCCGGGATGG - Intergenic
1130927415 15:88396031-88396053 GAAGGGTGTGGTCCCTGGCTAGG - Intergenic
1132663259 16:1070842-1070864 TTAGGGTGGGGTCCCTGGAGAGG + Intergenic
1133795510 16:9043086-9043108 TTAGTCAGAGGTCCCAGGCAGGG - Intergenic
1134049022 16:11123948-11123970 TGAGTGGCTGGACCCTGGCAGGG + Intronic
1134599662 16:15523442-15523464 GGAGGGTGTGGTCCCTGGTAAGG - Intronic
1137884899 16:52092651-52092673 TTGGTGCGTGGGCCCTGCCAGGG + Intergenic
1138128393 16:54457304-54457326 GAAGGGTGTGGTCCCTGGCTAGG - Intergenic
1140323259 16:73974543-73974565 TGAGTGTGTGGTTCCTGTCTTGG + Intergenic
1140532296 16:75677297-75677319 TAAGTGTGTGGTGACAGGCATGG - Intronic
1140577274 16:76185460-76185482 TTAGTATGTGGTTACAGGCAGGG + Intergenic
1141536581 16:84685349-84685371 TTAAAGTGTGGTCCCTGGACCGG - Intergenic
1141676026 16:85517897-85517919 TCAGTGTGTGGCGCCTGGCAGGG + Intergenic
1141799038 16:86294932-86294954 TCAGTGTGGGGGCTCTGGCAAGG - Intergenic
1142423997 16:89991076-89991098 TTAGTGTGGGGCCCTGGGCATGG + Intergenic
1144345869 17:14348839-14348861 TTAGTAGGTGGTACCTGGAAAGG + Exonic
1148210907 17:45807959-45807981 TTTGGGTGTGGTCCTGGGCATGG + Intronic
1150202398 17:63370892-63370914 TGAATGCGAGGTCCCTGGCAAGG + Intronic
1153588651 18:6650284-6650306 TTAATCTGTGTTTCCTGGCAGGG - Intergenic
1156359381 18:36370798-36370820 TTAGAGCCTGGCCCCTGGCAGGG + Intronic
1157486321 18:48089993-48090015 TGGGAGTGTGGTCCGTGGCAGGG + Intronic
1158675178 18:59512191-59512213 GAAGGGTGTGGTCCCTGGCTAGG + Intronic
1159278202 18:66248272-66248294 TTAGTCTGTACTCCCTGGGATGG + Intergenic
1159919714 18:74216479-74216501 TTTGTGTGGGGTCTCAGGCAGGG - Intergenic
1160052847 18:75452774-75452796 TTAGTGTGTGGTGTGAGGCAAGG + Intergenic
1161918923 19:7251698-7251720 CTAGGATGTGGTCCGTGGCATGG + Intronic
1162133495 19:8541886-8541908 GCAGTGAGTGGTCCCAGGCATGG - Exonic
1163025334 19:14507729-14507751 TGGGGGTGGGGTCCCTGGCAAGG + Intergenic
1163905417 19:20148247-20148269 GTAGTCTGTGGTCCATGGGAGGG - Intergenic
1164138994 19:22440676-22440698 GTAGTTTGTGGTCCATTGCAGGG + Intronic
1164150577 19:22546926-22546948 TCAAAGTGTGGTCCCTGGCTGGG + Intergenic
1164495239 19:28754496-28754518 TTAGTGGGTGGGGCCAGGCAGGG - Intergenic
1165024328 19:32948666-32948688 GCATTGGGTGGTCCCTGGCAGGG - Intronic
1165295906 19:34925714-34925736 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1166758995 19:45212967-45212989 GGGGTGTGTGGTCCCAGGCAGGG + Exonic
1167405991 19:49309076-49309098 TGAGTGTGTGGTCTCTAGCAGGG - Exonic
925200518 2:1964781-1964803 TTAGTGAGTGTTCCATGACAGGG - Intronic
925201721 2:1972577-1972599 TTAGTGAGTGCTCTCTGTCAAGG + Intronic
926779050 2:16450436-16450458 TCCTTGTGTGGTCCCTGGAATGG + Intergenic
927293869 2:21431099-21431121 CTAGTGTGTGGCCCCTGTCTGGG + Intergenic
931578730 2:63749953-63749975 TTAATGTGTTGTCCCTCCCAAGG - Intronic
937873752 2:126804731-126804753 ATAGGGTGTGGTCCCTGGCTAGG - Intergenic
938449617 2:131405413-131405435 TTCCTGTGTGCACCCTGGCAGGG + Intergenic
939818816 2:146930637-146930659 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
943906586 2:193506468-193506490 AGAGGGTGTGGTCCCTGGCTAGG - Intergenic
947326769 2:228987808-228987830 TTTATGTGTGGGCCCTGCCAGGG - Intronic
947906436 2:233766587-233766609 AGAGGGTGTGGTCCCTGGCGAGG - Intronic
1170243489 20:14195432-14195454 GAAGGGTGTGGTCCCTGGCTAGG + Intronic
1174959443 20:55138520-55138542 TCAGTGTCTGGTATCTGGCAGGG + Intergenic
1176513319 21:7764852-7764874 TGAGTGAGTGGTCCATGGTAAGG - Intronic
1176933676 21:14842482-14842504 GTGCGGTGTGGTCCCTGGCAAGG - Intergenic
1178337098 21:31752968-31752990 TTTGTTTGTTGTACCTGGCAAGG - Intergenic
1178647432 21:34395376-34395398 TGAGTGAGTGGTCCATGGTAAGG - Intronic
1179917971 21:44490301-44490323 AGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1180196649 21:46200460-46200482 TTGGTGTGTGCTTCCTGGTAAGG + Intronic
1181451741 22:23027194-23027216 GGAGGGTGTGGTCCCTGGCTGGG - Intergenic
1182325313 22:29508297-29508319 TTTGTCTGTGGTTCCTGGCAAGG - Exonic
1183724195 22:39579316-39579338 TCAGTGTGTGGCCCTAGGCATGG - Intronic
1184201924 22:42975709-42975731 CTAGTGGGTGCTCCCTGCCAGGG - Intronic
1185168081 22:49274652-49274674 TTGGTGTGGGGCCCCTGTCATGG + Intergenic
950665465 3:14492393-14492415 CTAGTGAGTGGTGCCTGGGATGG - Exonic
952561717 3:34603347-34603369 AAAGGGTGGGGTCCCTGGCAAGG + Intergenic
953059615 3:39416294-39416316 CTAGTGTGTGGTTCTGGGCAAGG + Intergenic
961175407 3:124831176-124831198 TAAGTGGGTGGTGCCGGGCATGG - Intronic
961239821 3:125400945-125400967 TCAGCGTGGGGACCCTGGCATGG - Intergenic
961890567 3:130127123-130127145 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
962020902 3:131501047-131501069 TAAGTGTGTGGTCCCTGGTTAGG - Intronic
963445076 3:145395369-145395391 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
966217611 3:177519514-177519536 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
966285850 3:178294136-178294158 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
966456096 3:180117945-180117967 ACAGTGTGGGGTCCCTGGCATGG - Intergenic
966456109 3:180117990-180118012 AGAGTGTGGGGTCCCTGACATGG - Intergenic
966456119 3:180118035-180118057 AGAGTGTGGGGTCCCTGACATGG - Intergenic
966456131 3:180118080-180118102 AGAGTGTGGGGTCCCTGACATGG - Intergenic
966456154 3:180118170-180118192 AGAGTGTGGGGTCCCTGACATGG - Intergenic
967875337 3:194265034-194265056 GCAGTGTGTGCTCCCTGGCCCGG + Intergenic
968468472 4:765010-765032 TGAGTGTGTGGTCCTTGCCCAGG - Exonic
969001951 4:3989535-3989557 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
969049750 4:4364248-4364270 TTCCTGTGTGGCCCCAGGCATGG + Intronic
969150185 4:5162752-5162774 TAAGTTTGGGGTCCTTGGCAGGG - Intronic
969752052 4:9118998-9119020 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
969811966 4:9655273-9655295 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
971129722 4:23793661-23793683 TGAGTGTGGAGTCCCTGGAATGG - Exonic
973141091 4:46768557-46768579 AAAGAGTGGGGTCCCTGGCAAGG - Intronic
977721549 4:100245005-100245027 AGAGGGTGGGGTCCCTGGCAAGG - Intergenic
977849046 4:101802116-101802138 GGAGGGTGTGGTCCCTGGCTAGG - Intronic
979774722 4:124575581-124575603 TAAGTGTGTGGCTCCTGGAAAGG - Intergenic
982808463 4:159796088-159796110 CTATTGTGGAGTCCCTGGCATGG - Intergenic
983793945 4:171836523-171836545 ATAGTGTGTGGTACATGACAAGG - Intronic
983951963 4:173653229-173653251 TTAGTGTGTGGTACAGGGGAGGG - Intergenic
988037952 5:25852033-25852055 TTAGTGTGTGGCCCTTTCCAGGG + Intergenic
988139436 5:27217563-27217585 TAAGGGTGTGGTCCCTGACTAGG + Intergenic
990624918 5:57599851-57599873 TTCTTTTGTGGTACCTGGCATGG - Intergenic
993132513 5:83917143-83917165 CTAGTGTGGGGTTCCTAGCATGG - Intergenic
994568691 5:101485374-101485396 GAAGTGTTTGATCCCTGGCATGG + Intergenic
995185692 5:109267899-109267921 TTAGTCTGTGGTGGCTGGCCTGG - Intergenic
998023195 5:138789124-138789146 ATAGTGTGTGGTCCCTGAGGGGG + Intronic
999007357 5:147997151-147997173 GGAGGGTGTGGTCCCTGGCTGGG - Intergenic
1001192032 5:169640240-169640262 ATAATCTGTGGTCTCTGGCATGG + Intronic
1001227216 5:169955237-169955259 GTCCTGTGTGGTCCCGGGCAGGG - Intronic
1001940061 5:175733981-175734003 GGAGGGTGTGGTCCCTGGTAGGG + Intergenic
1002843294 6:924196-924218 GGAGGGTGTGGTCCCTGGCTGGG + Intergenic
1003499846 6:6695174-6695196 GAAGGGTGTGGTCCCTGGCTAGG - Intergenic
1005660967 6:27999002-27999024 GGAGAGTGTGGTCCCTGGCTAGG - Intergenic
1006416882 6:33909738-33909760 TCAATGCGTCGTCCCTGGCATGG - Intergenic
1010172067 6:72986510-72986532 TAAGAGTGTGGTCCATGGGAAGG + Intronic
1018752893 6:166822540-166822562 CGAGTCTGTGGTCCCTGTCAGGG + Intronic
1021732039 7:23605195-23605217 TTAATGTGTTTTCCCTAGCATGG + Intronic
1022278620 7:28882557-28882579 TCGGTGAGTGGTCCCTGGCATGG - Intergenic
1022669914 7:32446299-32446321 TTAATGTGTGGGTCATGGCATGG + Intergenic
1022876973 7:34544498-34544520 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1022958405 7:35402126-35402148 CTACTGTGTGATCACTGGCAGGG - Intergenic
1023622416 7:42086972-42086994 TGGGTGTGTGCACCCTGGCAGGG - Intronic
1025815136 7:64903864-64903886 GTAGTTTGTGGTCCATGGGAAGG + Intronic
1025865203 7:65374484-65374506 GTAGTTTGTGGTCCGTGGGAGGG + Intronic
1031712696 7:125068565-125068587 ACAGGGTGGGGTCCCTGGCAAGG - Intergenic
1031823410 7:126532674-126532696 TTAATGTGTCCTCCTTGGCAAGG - Intronic
1032195469 7:129785990-129786012 TTCGTGTCTGGGCCCTGGCGGGG + Intergenic
1035468687 7:159096239-159096261 GGAGTGTGTGGCCCCAGGCAGGG - Intronic
1035643621 8:1201572-1201594 CCAGTGTGTGGTCACCGGCACGG + Intergenic
1036375271 8:8194404-8194426 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1036854268 8:12228744-12228766 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1036875629 8:12471244-12471266 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1038338070 8:26661524-26661546 ACTGTGTGTGATCCCTGGCAGGG - Intergenic
1038862311 8:31401239-31401261 GAAGGGTGTGGTCCCTGGCTAGG + Intergenic
1039039636 8:33395156-33395178 AGAGGGTGGGGTCCCTGGCAAGG + Intronic
1039076309 8:33693369-33693391 GAAGAGTGTGGTCCCTGGCTAGG - Intergenic
1042057349 8:64779592-64779614 TTACTGTTGGGTCACTGGCATGG - Intronic
1046289768 8:112142319-112142341 TGAACATGTGGTCCCTGGCAGGG - Intergenic
1047206122 8:122803976-122803998 ATAGTGCCTGGTGCCTGGCAAGG + Intronic
1048623447 8:136159463-136159485 GAAGGGTGGGGTCCCTGGCAAGG - Intergenic
1048922277 8:139242074-139242096 TTCCTGTCTGGTACCTGGCAGGG - Intergenic
1049926147 9:409379-409401 TTAGTCTGTGGTCCCGGCAATGG - Intronic
1050202228 9:3157413-3157435 GGAGTGTGTGGTCCCTGGCTAGG - Intergenic
1050217476 9:3343374-3343396 TTAGTGTTTGATCCCTGACTTGG - Intronic
1050342545 9:4654917-4654939 GAAGGGTGTGGTCCCTGGCTAGG - Intronic
1050479246 9:6073076-6073098 GTAGGGCGTGGTCCCTGGCTAGG + Intergenic
1053426546 9:38013981-38014003 ATGGAGTCTGGTCCCTGGCAGGG + Intronic
1053887367 9:42654186-42654208 GTCCTGTGTGGTCCCAGGCAGGG - Intergenic
1054226389 9:62461637-62461659 GTCCTGTGTGGTCCCAGGCAGGG - Intergenic
1056270921 9:84947446-84947468 ATTGGGTGTGGTCACTGGCATGG - Intronic
1056569382 9:87802487-87802509 GGAGTGTGTGGGCCCTGGTAAGG - Intergenic
1056669944 9:88618382-88618404 GCAGGCTGTGGTCCCTGGCAAGG + Intergenic
1057411899 9:94823938-94823960 TTACTATGCAGTCCCTGGCATGG + Intronic
1059470232 9:114499482-114499504 TTAGTCTGGGGTCCCTGAGAAGG + Intronic
1062485362 9:136772025-136772047 TGAGTCTGTGGTCCCTCCCATGG + Intergenic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1185837820 X:3361322-3361344 GGAGGGTGTGGTCCCTGGCTAGG - Intergenic
1186649274 X:11541334-11541356 CTAGTGTCTGGTACCTGGCCTGG + Intronic
1187093529 X:16122404-16122426 TTTCTTTGTGGGCCCTGGCATGG + Intergenic
1189041541 X:37545421-37545443 ATGGTGTGTGGTCCATGGGATGG + Intronic
1189079629 X:37957451-37957473 TTTGTGTGTGGTGTATGGCATGG + Intronic
1189144875 X:38645295-38645317 TTACTGTGGGGACCCTGTCAAGG - Intronic
1189833411 X:44997613-44997635 GGAGGGTGTGGTCCCTGGCTAGG - Intronic
1190790421 X:53694843-53694865 TCATTGTGTGGTCCCTGGACTGG + Intergenic
1191626344 X:63275187-63275209 TTGGTCTGTGGTCCCTGGTTTGG - Intergenic
1191766651 X:64705537-64705559 GAAGTGTCTGGTCCCTGGCTAGG - Intergenic
1193311549 X:80015943-80015965 TTAATGTGGGGACCCTGGGAAGG + Intronic
1193608130 X:83593828-83593850 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic
1193914484 X:87349264-87349286 TCAGTCTGTGGTCGATGGCATGG + Intergenic
1194068330 X:89288729-89288751 TAAGGTTGTGGTCCCTGGCTAGG - Intergenic
1195026004 X:100878428-100878450 TTAATGTGTGGTCTTGGGCACGG - Intergenic
1195367359 X:104139066-104139088 GAAGAGTGTGGTCCCTGGCTAGG - Intronic
1199775738 X:151009895-151009917 TTTGTGTGTGATGCCAGGCAGGG - Intergenic
1199985836 X:152949460-152949482 TTTGGGTCTGGTCACTGGCATGG + Intronic
1200722472 Y:6622898-6622920 TAAGGTTGTGGTCCCTGGCTAGG - Intergenic
1201238021 Y:11930411-11930433 GGAGGGTGTGGTCCCTGGCTAGG + Intergenic