ID: 919490769

View in Genome Browser
Species Human (GRCh38)
Location 1:198202628-198202650
Sequence ACTTTCCACCATGAATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919490769_919490770 -3 Left 919490769 1:198202628-198202650 CCTCACAATTCATGGTGGAAAGT 0: 1
1: 0
2: 3
3: 20
4: 136
Right 919490770 1:198202648-198202670 AGTGAAAGACATGTTTTACATGG 0: 1
1: 1
2: 41
3: 340
4: 1403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919490769 Original CRISPR ACTTTCCACCATGAATTGTG AGG (reversed) Intronic
903248845 1:22037447-22037469 ACTTTCCAGCAAGAAGTGTAAGG + Intergenic
907384372 1:54116552-54116574 TCTATCCACCAAGAATTGTCTGG + Intergenic
908802106 1:67891024-67891046 ATTTACCACCTTGATTTGTGAGG + Intergenic
909068266 1:70962533-70962555 ACCTTCCACCATGAAGTGTGAGG - Intronic
909142080 1:71880161-71880183 ACTTTCCACCATGATGCCTGGGG - Intronic
910160370 1:84266068-84266090 ACTTTCCAGCATGGTTTGGGTGG - Intergenic
910910771 1:92231577-92231599 ATTATCCACAATTAATTGTGGGG + Intronic
911289503 1:96039722-96039744 ACCTTTCACCTTGATTTGTGAGG + Intergenic
912023965 1:105142520-105142542 ACTCTCCTCCATGAATTATGAGG - Intergenic
912503913 1:110142426-110142448 GCTTTCCACCATGACATGTCAGG + Intergenic
916915075 1:169397738-169397760 ACTATCCATCATGAACTTTGAGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919490769 1:198202628-198202650 ACTTTCCACCATGAATTGTGAGG - Intronic
921365556 1:214370377-214370399 ACTTTCCACCATGGACTGTGAGG - Intronic
924480986 1:244433941-244433963 ACTTACTACAGTGAATTGTGAGG + Intronic
1062829714 10:597452-597474 CCTTTCCACCTAGAATTGTAGGG - Intronic
1064105195 10:12494889-12494911 ACTTTTCACCATGATTGGTTTGG + Intronic
1067905890 10:50290488-50290510 AATTTCCACCCTGAAATCTGTGG - Intergenic
1068766631 10:60771697-60771719 AATTTCAACTATGAATTTTGAGG - Intergenic
1075316352 10:121456790-121456812 ACCTTCCGCCATGTAATGTGTGG + Intergenic
1085982957 11:81746711-81746733 CCTTTCCACCATGCCTTCTGAGG + Intergenic
1087725699 11:101713809-101713831 GCCTTCCACCATGATTTATGAGG - Intronic
1089209805 11:116792212-116792234 TTTTTCCACCATGAAATGGGAGG - Intronic
1093006594 12:14058147-14058169 CTTTTCCACCATGCATAGTGAGG - Intergenic
1093130178 12:15382378-15382400 ACTTGCCACCTGGAAGTGTGGGG - Intronic
1093647528 12:21604754-21604776 TCCTTCCACCAGGAATTCTGTGG - Exonic
1093825525 12:23681922-23681944 ATTTTTCATCATAAATTGTGAGG - Intronic
1094369378 12:29720073-29720095 TCTCTCGACCATGAATTCTGAGG + Intronic
1095108968 12:38270265-38270287 ACTTTACACCATAAATTATGAGG + Intergenic
1095825607 12:46527523-46527545 ACTTTTCTCCAGGAATTGTATGG + Intergenic
1098140749 12:67448104-67448126 ACTTTCCCCCAAGAATACTGTGG - Intergenic
1098956059 12:76691058-76691080 TCTTTCCAGCATGAATTCTCTGG - Intergenic
1104758015 12:131280972-131280994 ACCTTCCGCCATGAATTTTCAGG + Intergenic
1105479030 13:20756485-20756507 TCTTTCCACCAGGATTTCTGGGG + Intronic
1106301917 13:28474527-28474549 ACTTAGCACAATGATTTGTGGGG - Intronic
1106351999 13:28939869-28939891 ACCTTCCACCATTGATTGTGAGG - Intronic
1111714381 13:91861364-91861386 ACTTTCCTTCATGAATTATGAGG + Intronic
1112385796 13:98938760-98938782 ACTTCCCACCAGGAATTAAGAGG - Intronic
1112472662 13:99702942-99702964 ACTTTCCACCATGAACTCTTTGG + Intronic
1113549763 13:111183883-111183905 AGTCTCCACCAGGACTTGTGGGG + Intronic
1114867431 14:26614030-26614052 TCTTTCCACCATGAAGTCTCAGG + Intergenic
1115072852 14:29346904-29346926 ATTTTCCCCCATTACTTGTGTGG - Intergenic
1119449995 14:74701375-74701397 ACCTTCCACCGTGATTTGTGAGG - Intronic
1119866233 14:77977478-77977500 ACTTTCACCTATGAACTGTGTGG + Intergenic
1125167469 15:36724877-36724899 AGTTTCTACCATGAGTTATGTGG + Intronic
1126408120 15:48343929-48343951 AGTTCCCAGCATGAATTTTGGGG + Intergenic
1126822075 15:52514256-52514278 ACTTTATACAATGAATTGTATGG + Intronic
1127973802 15:63982644-63982666 AAATTCCATCATGAACTGTGAGG + Intronic
1128200149 15:65798120-65798142 ACTTTCCACCAGGAATAGAAAGG - Intronic
1128671579 15:69577976-69577998 ACTTGCCACCGTGAATTGGCAGG - Intergenic
1131523353 15:93133548-93133570 AGTTCCCACCATGAAGGGTGGGG - Intergenic
1133486963 16:6229017-6229039 ACTGTCCTCCAACAATTGTGGGG - Intronic
1134867149 16:17618558-17618580 AGTTTCAACCATAAACTGTGTGG - Intergenic
1136674453 16:31889867-31889889 ACTTTTCAACATGAGTTTTGTGG + Intronic
1136907001 16:34104238-34104260 CTTTTCCCCCATGAATAGTGAGG - Intergenic
1140146661 16:72317809-72317831 ATTTTCCAGCATTAAATGTGAGG - Intergenic
1141936835 16:87245653-87245675 ACTTTCCCCCACGAAATATGCGG + Intronic
1149925435 17:60697615-60697637 ACTTTACACCTTGACTTTTGAGG + Intronic
1152612945 17:81324410-81324432 ACATTCCACCAGTAAGTGTGGGG + Intronic
1153769769 18:8405909-8405931 ACCTTCCACCCAGCATTGTGGGG + Intronic
1155800149 18:30091094-30091116 ACTTTCCTCCATTAATTATAAGG + Intergenic
1157093112 18:44659960-44659982 CCTTTCAACCATGAAATGTCAGG + Intergenic
1157964335 18:52191045-52191067 TCTTAACACCTTGAATTGTGAGG - Intergenic
1157998726 18:52591467-52591489 ACTTTCCACTTTTAAGTGTGAGG + Intronic
1158290656 18:55938087-55938109 ACTTTCCACCATCTATTGTTTGG + Intergenic
1159939355 18:74394827-74394849 ACCTTCTGCCATGATTTGTGAGG - Intergenic
1160191456 18:76717502-76717524 AGTTTCCAACATGCATTTTGGGG + Intergenic
1164741771 19:30581167-30581189 ACTTTCCATCATAAATTTAGAGG - Intronic
1165029321 19:32986122-32986144 GCTTTCCACCACCAGTTGTGTGG - Intronic
1165619416 19:37232676-37232698 ACTTTCCCTCATCAATTGTTTGG + Intronic
1166048795 19:40245808-40245830 AGTATCCACCATGAGTTCTGGGG - Intronic
1168603194 19:57736903-57736925 ACTTACCAAGATGAATTATGAGG + Intronic
927386494 2:22540186-22540208 ACCTGCCACCATGATTTGTGAGG - Intergenic
928082015 2:28320065-28320087 AATTTCCAGCATGAATTGAGTGG - Intronic
933185504 2:79274658-79274680 ACATTCAACCATATATTGTGAGG + Intronic
938940428 2:136164736-136164758 ACTTTCCCTCATGAGTTCTGAGG - Intergenic
940208898 2:151236197-151236219 ACTGTCCACTATAAATTGTTTGG + Intergenic
940971684 2:159903364-159903386 CTTTTCCACCTTGGATTGTGGGG + Intronic
943251829 2:185531945-185531967 AATTTCCACATTAAATTGTGGGG - Intergenic
943312997 2:186350997-186351019 ACTTTCTACCATGAAAAATGAGG - Intergenic
943422389 2:187682541-187682563 AATAACCACCATGAATTGTCAGG + Intergenic
943775130 2:191757071-191757093 ATTTCCCATAATGAATTGTGTGG + Intergenic
948302004 2:236914608-236914630 ACATTCCACCATTATGTGTGTGG - Intergenic
1174983060 20:55419305-55419327 ACTTTAAACCATGAAGTTTGTGG + Intergenic
1177570121 21:22876537-22876559 AATTTCAACCATGTTTTGTGGGG - Intergenic
1183462114 22:37957769-37957791 ACATTCCTGCAGGAATTGTGTGG + Intronic
1184436354 22:44480228-44480250 ATTTCCCAGCATGAATTCTGAGG + Intergenic
949109009 3:236050-236072 TCTTCCCACCATGAATGCTGAGG - Intronic
951495197 3:23317574-23317596 GCCTTCCACCATTGATTGTGAGG - Intronic
952200246 3:31118882-31118904 GCCTTCCACTATGATTTGTGAGG - Intergenic
957726934 3:84079010-84079032 ACTTTCTACCTTGAATTATCTGG + Intergenic
957872955 3:86111420-86111442 ACCTTCCGCCATGATTAGTGAGG + Intergenic
970347141 4:15163430-15163452 AATTTTGACCATGAATTCTGTGG + Intergenic
971046883 4:22814798-22814820 TCTTGCCACCATGATTTATGAGG - Intergenic
972691808 4:41406439-41406461 ATATTTCACCATGAATGGTGAGG + Intronic
973608098 4:52607696-52607718 ACTCTCCACGATGTATGGTGAGG - Intronic
974644606 4:64674677-64674699 ACTTCCCATCATGAACTGGGTGG - Intergenic
975371644 4:73595610-73595632 ACTTAACATCATGAATTTTGTGG + Intronic
976461682 4:85319796-85319818 ACCTTCAACCATGAAGTGGGAGG + Intergenic
980677282 4:136102906-136102928 ACTTTCCATCTTGAATCGTGAGG - Intergenic
980796377 4:137689002-137689024 ACATTCCAGCATCAATTATGTGG - Intergenic
982146864 4:152404103-152404125 TCTTTCCACTATGAAATGGGGGG + Intronic
982929574 4:161386248-161386270 ACCGTCCACCATGACCTGTGGGG + Exonic
983992721 4:174140753-174140775 ACTTTCCAGCTTGAACTATGTGG + Intergenic
984450208 4:179890316-179890338 ACTTTTCAACATAAATTGAGTGG + Intergenic
986084977 5:4435762-4435784 AGTTTCCACAAAGAATTCTGTGG + Intergenic
988335893 5:29908951-29908973 GCCTTCTGCCATGAATTGTGAGG - Intergenic
993382079 5:87219645-87219667 AGTTTCCAACATGAATTTAGGGG - Intergenic
994888061 5:105592161-105592183 TCTTTCCACTATAAATGGTGTGG + Intergenic
995701969 5:114946344-114946366 ACTCTCCTCCATTAATTTTGAGG + Intergenic
1001046044 5:168372579-168372601 ACATCCCACCAGGAATTGGGAGG - Intronic
1002792848 6:448296-448318 ACTTTTCAACATGAGTTTTGTGG - Intergenic
1005091919 6:22066066-22066088 AGTTGACACCATGAATTGTCTGG + Intergenic
1007918733 6:45586713-45586735 CCCTTCCACCATGGAGTGTGAGG + Intronic
1008859041 6:56127106-56127128 ACTTCCCACCATGAATGCAGAGG + Intronic
1011504472 6:88027133-88027155 ACTCCCCACCATGAACAGTGTGG + Intergenic
1015803723 6:137087816-137087838 ATTTCCCACCATGTATTCTGAGG + Intergenic
1017153351 6:151301082-151301104 ACTTTCCTCCCTGAAATGGGTGG + Intronic
1017870942 6:158486150-158486172 ACTTCCCAATATGAATTTTGGGG - Intronic
1019229538 6:170547457-170547479 AGTTTCCAAGAGGAATTGTGTGG - Intronic
1020955268 7:14733207-14733229 TCTTTCAATCATGAATTGAGAGG - Intronic
1022256167 7:28660779-28660801 ACTTCCCAGAATGAGTTGTGAGG - Intronic
1024334221 7:48188876-48188898 ACTTCTCACCATGAATTTCGTGG - Intronic
1025250500 7:57348356-57348378 ACCTTCCTCCAGGAATTGTTGGG + Intergenic
1027701575 7:81476413-81476435 AGTTTCAACTATGAATTGTGGGG + Intergenic
1030087838 7:105832116-105832138 ACTTGCCACCATGAAAAGTGAGG - Intronic
1033064036 7:138135785-138135807 ACTTTCCAACTGGATTTGTGAGG - Intergenic
1033337121 7:140463265-140463287 ACTTTCACTCATGAACTGTGGGG + Intronic
1037565641 8:20116012-20116034 GCCTTCCACCATGATTTGTGAGG - Intergenic
1038574200 8:28690118-28690140 ACTTTCAACCATCAAGTTTGAGG - Intronic
1038617853 8:29112065-29112087 ACTATCCAACATGACTTGAGAGG + Intronic
1039771429 8:40691684-40691706 CCATTCCACACTGAATTGTGTGG + Intronic
1040833895 8:51710907-51710929 ATTTTTCACCATGGAGTGTGAGG - Intronic
1040848706 8:51875384-51875406 ACTTACCACCATAACCTGTGTGG - Intronic
1041321096 8:56613392-56613414 ACTTTCCAGCAGGAAGGGTGAGG + Intergenic
1044496616 8:92894957-92894979 AGTTTCCAACATGAATTTTGGGG - Intronic
1045481448 8:102596253-102596275 ACTATGCACCAGGAACTGTGCGG + Intergenic
1047622798 8:126624870-126624892 ATTTGCCACCATGACTTTTGTGG + Intergenic
1048123438 8:131607302-131607324 GCCTTCCACCTTGATTTGTGAGG - Intergenic
1052530735 9:29681362-29681384 ACTTTCCACCATGATTCCTGAGG + Intergenic
1052672897 9:31580929-31580951 CCTTTCCTCCATGGCTTGTGTGG + Intergenic
1055301239 9:74885317-74885339 ACTTTCCTGCAAGAAATGTGTGG - Intronic
1057990491 9:99764165-99764187 ACTTTCCACTATGGATAGTGGGG - Intergenic
1058078614 9:100676707-100676729 AGATTCCAGCATGAATTTTGGGG + Intergenic
1058172324 9:101697302-101697324 ACTTTCAACCATGATTTGAAAGG - Intronic
1058358891 9:104118397-104118419 ATTTACCACAAAGAATTGTGAGG - Intronic
1058778454 9:108309254-108309276 ACTTTGCATCAAGAATTGTGTGG - Intergenic
1058921861 9:109624572-109624594 GCTTTCCACCATGACTGGTGAGG - Intergenic
1060179392 9:121522575-121522597 GCCTTCCACCATGAATTGTGAGG + Intergenic
1060670518 9:125465552-125465574 ACTTTACAACATAAATTATGTGG + Intronic
1188030330 X:25256326-25256348 ACCTTCCACCATGATTTCTGTGG + Intergenic
1188323639 X:28772503-28772525 GCTTTCCGCCAGGAAATGTGAGG + Intronic
1190014786 X:46817634-46817656 ACTTTCAAATATGAATTGGGTGG + Intergenic
1190071620 X:47284520-47284542 GCTCTCCAACATGAATGGTGAGG - Intergenic
1192805181 X:74502393-74502415 ACATTCCACTAGGACTTGTGTGG + Intronic
1195635493 X:107110004-107110026 ACTTTTCACCATTAATTATGAGG + Intronic
1197165926 X:123377570-123377592 AGTTTCCACCTTGAAGTCTGAGG + Intronic
1198012117 X:132568094-132568116 ATTTTCCATCATGACATGTGTGG - Intergenic
1199492105 X:148411607-148411629 ACTTTCCACCATGGACTTTTTGG - Intergenic
1201966162 Y:19738763-19738785 ACTTTGCCTCATGAATTGTATGG - Intronic